Among genes involved in the RB dependent cell cycle ... - Nature

Oncogene (1997) 15, 2225 ± 2232  1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00

Among genes involved in the RB dependent cell cycle regulatory cascade, the p16 tumor suppressor gene is frequently lost in the Ewing family of tumors Heinrich Kovar1, Gunhild Jug1, Dave NT Aryee1, Andreas Zoubek1, Peter Ambros1, Bernadette Gruber1, Reinhard Windhager2 and Helmut Gadner1 1

Children's Cancer Research Institute (CCRI), St. Anna Kinderspital, A-1090 Vienna Austria; 2Department of Orthopedics, University of Vienna, A-1090 Vienna, Austria

The pRB cell cycle regulatory cascade is frequently perturbed in neoplasia by overexpression of a component of the pRB-phosphorylating cyclin D1/CDK4 complex or by inactivation of pRB or the CDK4 inhibitors p16 and p15. We investigated the status and expression of p16, p15, CCND1, CDK4 and RB genes in the Ewing family of tumors. P16 loss was observed in 8 of 27 tumors (30%) and in 12 of 23 (52%) tumor cell lines from unrelated patients. There were no discrepancies in the p16 status between primary tumors and the corresponding cell lines and between cell lines established from consecutive tumor samples. p15 was codeleted in most cases but p15 mRNA was absent also in cell lines retaining the gene. In addition, posttranscriptional p16 inactivation was observed in two cases. Although no evidence for CDK4 or CCND1 ampli®cation was obtained, expression of these genes varied considerably in the cell lines in a case speci®c manner. In wild-type p16 cell lines, pRB expression was lost in one case. Our data indicate that, despite the absence of cytogenetically detectable 9p21 chromosomal aberrations, p16 deletions constitute the most frequent secondary molecular aberration in Ewing tumors so far. These results are discussed in the context of the stage of disease and the clinical outcome of the patients. The potential prognostic impact of these ®ndings remains to be further evaluated. Keywords: Ewing tumors; p16; Rb; cyclin D; prognosis

Introduction Dysregulation of the cell-division cycle machinery contributes to malignant cellular transformation and, eventually, to the development of cancer. Orderly transition through the cell-cycle is regulated by sequential protein phosphorylation in multi subunit protein complexes including cyclins and their catalytic partners, cyclin dependent kinases (CDKs) (for review MacLachlan et al., 1995). CDKs, a group of homologous serine/threonine kinases, are active when bound to their regulatory subunit, a cyclin. In addition to regulation by intrinsic activating and inhibitory phosphorylations, CDK activity is in¯uenced by a number of small proteins that physically associate with cyclins, CDKs, or their complexes. Among these factors there are negative regulators of cell growth, Correspondence: H Kovar Received 4 March 1997; revised 30 June 1997; accepted 7 July 1997

the CDK inhibitors (CDIs). Expression of one of them, p21 (WAF1/CIP1/CDKN1), a universal component of cyclin-CDK complexes (Zhang et al., 1993), is frequently abolished by mutational or viral inactivation of its positive regulator p53 in many tumors (ElDeiry et al., 1993; Hollstein et al., 1991). A key role in the regulation of S-phase entry of a cell is played by the product of the Rb tumor suppressor gene pRB. This protein releases the transcription factor E2F when either bound to viral oncoproteins (SV40 large T antigen, human papilloma virus E7 and adenovirus E1A) or when phosphorylated by either CDK4 or CDK6 associated with the D-type cyclins. E2F in turn activates a set of genes important for G1/S transition of the cell-division cycle, including the dihydrofolate reductase, thymidine kinase, DNA polymerase a, Cdc2, and c-myc genes. The CDI p16 (CDKN2, MTS1, INK4A) has been found to be associated with the cyclin D1/CDK4 complex preventing pRb phosphorylation and consequently S-phase entry (Serrano et al., 1993; Schulze et al., 1994; Lukas et al., 1995). The cell cycle regulatory complex that includes pRb, cyclin D1/ CDK4, and p16 has been found to be frequently compromised in cancer: Inactivation of pRb is common in retinoblastomas, osteosarcomas, bladder and breast cancers (Weinberg, 1991); the gene encoding cyclin D1, CCDN1, is frequently overexpressed in centrocytic lymphomas, breast cancer, head and neck squamous cell, esophageal and hepatocellular carcinomas (for review Hirama and Koeer, 1995); CDK4 is ampli®ed in brain tumors and in sarcomas (Kathib et al., 1993; Schmidt et al., 1994). P16 loss has been demonstrated in a broad spectrum of cancers (Kamb et al., 1994). In contrast to p53, where missense mutations prevail, p16 is most commonly homozygously deleted. However, p16 point mutations have also frequently been observed in esophageal, pancreas and non small cell lung carcinomas (Mori et al., 1994; Caldas et al., 1994; Hayashi et al., 1994). When the p16 gene is lost, the related p15 gene is most commonly but not necessarily co-deleted. In contrast, p15 deletion without p16 loss is unusual. Generally, a much lower frequency of p16 gene alterations was found in primary tumors as compared to cell lines. However, due to the presence of stromal cells in the primary samples, homozygous deletions are often dicult to detect resulting in an underestimation of the mutation frequency. Alterations of p53 and p16 genes are the most recurrent aberrations in cancer. However, while both the p53 and the pRB dependent pathways of cell cycle control are inactivated in viral carcinogenesis, no such association has been established for sporadic

P16 aberrations in Ewing tumors H Kovar et al

2226

neoplasms so far. Interestingly, with the exception of sarcomas, p53 mutations are rare in childhood cancer, including neuroblastoma, Ewing tumors, medulloblastoma, retinoblastoma, Wilm's tumor, hepatocellular carcinoma, and lymphoid hematologic malignancies (Vogan et al., 1993; Kovar et al., 1993; Rael et al., 1993; Malkin et al., 1994; Chen et al., 1995; Wada et al., 1993). Relatively little is known about p16 alterations in this group of neoplasma. While p16 mutation frequency is high in childhood acute lymphoblastic leukemia (Ohnishi et al., 1995), no alterations were found in neuroblastoma, medulloblas-

toma and ependymoma (Beltinger et al., 1995; Jen et al., 1994). However, in other neoplasms of neuroectodermal origin such as glioblastomas and familial melanomas, high frequencies of p16 loss and CDK4 ampli®cation have been reported (Schmidt et al., 1994). Ewing tumors are a family of presumably neural crest derived bone and soft tissue neoplasms in children and young adults. They are characterized by rearrangements between the EWS gene and an ETS-related transcription factor gene (Delattre et al., 1994). Today, two thirds of patients with localized disease can be

b a A1 E1 E2 E3 G

#13 #29 #47

K

#9

L1

M

S

#14 #37

U

#8

c

p15 #4 #30

#27

BM

H

p16 EWS

ψEWS

p15

p16

CCND1

CDK4

b A1 E1 E2 E3 G

K

L1

M

S

U

p15

p16

Figure 1 (a) Status of p15/p16, CCND1 and CDK4 genes in primary Ewing tumors. Representative Southern blot hybridized consecutively to probe HP.5 detecting germline EWS, an EWS pseudogene (cEWS) and an aberrant band resulting from the characteristic EWS gene rearrangement, a p16 exon 2 probe recognizing p16 and p15 genes, a CCND1 and a CDK4 cDNA probe. Patients' numbers are indicated on top of the ®gure. Arrow heads indicate loss of p16 and p15 alleles in one case. Tumors such as #29, #47, #37 and #30 were not included into further evaluation because of the lack of a visible chimeric EWS band. (b) Status of p16 and p15 genes in Ewing tumor cell lines. Representative Southern blot of EcoRI digested genomic DNA. As a loading control an ethidium bromide stained detail is shown in the lower part of the ®gure. Designation of cell lines as in Table 2. Note that while in cases A1, K, M, and S both p16 and p15 genes are lost, cell lines L1 and U retain p15. (c) Mutation and loss of heterozygosity of a p16 allele in case #27 and a cell line derived from it. Representative SSCP gel. The mutation was detected using primers p16S1 and p16A1. Lanes 1 and 2 tumor (#27), lanes 3 and 4 bone marrow (BM), lanes 5 and 6 cell line (H). Lanes 1, 3 and 5 display double stranded PCR fragments, samples in lanes 2, 4 and 6 were denatured before loading to the SSCP gel. Arrow heads point to the aberrantly migrating band which results from a C?T transition within codon 80 as revealed by direct sequencing of the PCR product (not shown)


cured by multimodal therapy. However, patients presenting with metastases and those with early relapse have an adverse prognosis. In search for genetic indicators of prognosis in this disease, we now report that among genes involved in pRB dependent cell cycle regulation, p16 is frequently altered in primary Ewing tumors. Together with p53 mutations, alterations of the pRb cell cycle regulatory pathway selectively facilitated the establishment of cell lines.

Results Status and expression of p15/p16 genes The genomic status of p16, p15, CDK4 and CCND1 genes in Ewing tumors was determined on Southern blots of EcoRI digested tumor DNA (Figure 1a). All samples were also investigated for subtle p16 sequence alterations by PCR ± SSCP analysis of exon 2 containing 87% of all published p16 mutations (for review Hirama and Koeer, 1995). With one exception, case #27, only those specimens were included in the analysis of gene copy number presented in Table 1 for which, by sequential hybridization of the blot to an EWS exon 7 probe, an aberrantly migrating band resulting from an EWS gene rearrangement in intron 7 could be detected in an intensity similar to the germline band (Figure 1a). This approach guaranteed a high tumor cell content in the samples preventing underestimation of gene deletion or ampli®cation frequency. The EWS probe used in our study was not informative for cases with EWS gene rearrangements downstream the EcoRI site in intro 8 which occur in approximately 11% of cases (Zoubek et al., 1996). As revealed by RT ± PCR for the presence of EWS chimeric transcripts, such specimens were not represented in our series except for case #27 carrying the recently described rare EWS exon 10 fusion to a novel ETS family member, FEV (Peter et al., 1997). Out of a series of 40 tumors studied on Southern blots, specimens from 27 patients were eligible for the analysis of gene copy number according to the above criteria. Representative results are illustrated in Figure 1a and summarized in Table 1. Seven tumors (26%) showed homozygous deletions of p16 and, concomitantly, p15 alleles. One tumor (#27) displayed a nonsense mutation at codon 80 (CGA?TGA) (Figure 1c). This mutation was also present in the cell line (STA-ET-10) derived from the tumor. Reduction of relative p16 signal intensities in the primary sample (not shown) and absence of the wild type sequence in the corresponding cell line indicated loss of heterozygosity in this case. In total, p16 inactivation occurred in eight of 27 Ewing tumors (30%). In two patients (#3 and #14), a constitutional heterozygous polymorphism resulting in an 148Ala?Thr exchange was seen (not shown). Further, 30 Ewing tumor cell lines from 23 patients were studied. Homozygous p16 deletions were detected in cell lines from 11 patients. Thus, including the cell line with the homozygous point mutation (STA-ET10), 52% of unrelated Ewing tumor cell lines showed p16 aberrations (Figure 1b, Table 2). In all but four cases, p15 was co-deleted (35%). In p16 negative cell lines retaining p15, the p15 signal intensities on the

Southern blot were reduced indicating either complete p15/p16 loss in a subpopulation of cells or hemizygosity for p15 in all cells. No deletion of p15 without concomitant p16 loss was observed. However, as revealed by RT ± PCR, p15 expression was generally undetectable in all Ewing tumor cell lines tested (Figure 2a). In contrast, RT ± PCR for the presence of a p16 mRNA and for the recently described alternative transcript p16bARF (Duro et al., 1995; Stone et al., 1995; Mao et al., 1995) was positive for all cell lines with intact p16 genes (Figure 2a). However, as shown in Figure 2b, p16 protein expression was undetectable in cell lines STA-ET-3, the STA-ET-7 series, and STA-ET-8 expressing a p16 transcript (compare to Figure 2a and 3b). These results indicate that, in addition to homozygous gene loss, p16 is frequently inactivated by post-transcriptional mechanisms in Ewing tumors as has been previously observed in hepatocellular carcinoma (Hui et al., 1996). For six cases, DNA from the primary tumor and from deduced cell lines was available, and for four cases, more than one cell line were established from independent surgical tumor specimens, some of which have been obtained from dierent stages of the disease, i.e. primary tumor before (SAL-1, STA-ET-2.1, STAET-7.1, WE-68) and after chemotherapy (SAL-2, STAET-1, STA-ET-7.3) and metastases (STA-ET-2.2, STATable 1 Status of p16, p5, CDK4, CCND1 and p53 genes in primary Ewing tumor samples

Case # 1 # 2 # 3 # 4 # 5 # 6 # 7 # 8 # 9 #10 #11 #12 #13 #14 #15 #16 #17 #18 #19 #20 #21 #22 #23 #24 #25 #26 #27

Metastases at CCNOut- Survival p16 p15 CDK4 D1 p53 diagnosis come (months) ❍ ● ❍ ● ❍ ❍ ❍ ❍ éa éa ❍ ❍ ❍ ❍ ❍ ❍ ● ❍ ❍ ● ● ● ❍ ❍ ❍ ● ❂

❍ ● ❍ ● ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ● ❍ ❍ ● ● ● ❍ ❍ ❍ ● ❍

❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍

❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍

❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❂ ❂ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍

n y n n n n n y n y n n y y n n y n y y n n y y n y y

doc doc cr cr cr dod cr cr dod dod dod cr cr dod cr cr dod cr cr cr dod dod dod cr dod pod dod

8 7 +95 +93 +15b 50 +60 +60 7 10 21 +44 +36 44 +26 +26 10 +34 +14 +22 13 27 8 +25 10 +4b 12

All samples were studied by Southern blot and SSCP analyses. ❍ no alteration, ● deleted, ❂ mutated and loss of heterozygosity, é no genomic alteration but lack of protein expression. Clinical data include the presence (y) or absence (n) of metastases at diagnosis, follow up information (dead of disease, dod; dead of complications, doc; complete remission, cr; progression of disease, pod; second malignant neoplasm, smn) and duration of survival. aThe protein expression status of cases 9 and 10 were presumed to be the same as in the cell lines derived from these tumors although experimental proof is not yet available. bAfter the indicated periods, patients 5 and 26 were lost for follow up

2227


2228

Table 2 Status of p16, p15, CDK4, CCND1 and p53 genes in Ewing tumor cell lines Cell line (case) A1 A2 A3 B1 (32) B2 C D E1 (9) E2 E3 F (10) G (14) H (27)a I (26) J K L1 L2 M N O P Q R S T U V (25) W (57)

Name a

SAL-1 SAL-2 STA-ET-1 STA-ET-2.1 STA-ET-2.2 STA-ET-3 STA-ET-6 STA-ET-7.1 STA-ET-7.2 STA-ET-7.3 STA-ET-8.1 STA-ET-9 STA-ET-10 STA-ET-11 STA-ET-12 VH-64 WE-68 WE-M2-68 IARC-EW2 SK-N-MC A673 SK-ES-1 SMB RD-ES FPBH RM82 TC252 GR-OH-1 KN-OH-1

p16 p15 CDK4 CCND1 Rb ● ● ● ● ● é ● é é é é ❍b ❂ ● ❍ ● ● ● ● ❍ ● ❍ ❍ ❍ ● ❍ ● ❍ ●

● ● ● ● ● ❍ ● ❍ ❍ ❍ ❍ ❍ ❍ ● ❍ ● ❍ ❍ ● ❍ ● ❍ ❍ ❍ ● ❍ ❍ ❍ ❍

❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍

❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❍

❍ ❍ ❍ ❍ ❍ ❍

❂ ❍ ❍ ❍ ❍ ❍ ❍

p53 ❍ ❍ ❍ ❂ ❂ ❍ ❍ ❂ ❂ ❂ ❂ ❍ ❍ ❍ ❍ ❍ ❍ ❍ ❂ ❂ ❂ ❂ ❂ ❂ ❍ ❂ ❍ ❍ ❍

Cell lines are numbered from A to W with index numbers indicating common origin from consecutive tumor samples of the same patient. Where available, corresponding primary tumor numbers are indicated in parentheses. ❍ no alteration, ● deleted, ❂ mutated and loss of heterozygosity, é no genomic alteration but lack of protein expression. aCell line SAL-1 has previously been reported to express p16 (HengstschlaÈger et al., 1996). This result could not be con®rmed in our study using the original cell line. bCase #14 showed a heterozygous 148Ala→Thr polymorphism. In the corresponing cell line STA-ET-9 only one p16 allele was retained. Genomic and cDNA sequencing of the whole coding region did not reveal any mutation in the expressed allele (data not shown)

ET-7.2, WE-M2-68). The status of the p15 and p16 genes was identical in all specimens obtained from the same patient. These results indicate that the higher frequency of p15/p16 alterations in cell lines as compared to the primary tumor samples could not be attributed to in vitro mutagenesis during the establishment or expansion of Ewing tumor cell lines but was most likely the consequence of selection. Status and expression of CDK4 and CCDN1 genes It has been demonstrated recently that ampli®cation and/or overexpression of CDK4 or CCND1 occurs alternatively to p16 loss in glioma, glioblastoma, sarcomas and head and neck cancer (He et al., 1994; Schmidt et al., 1994; Maelandsmo et al., 1995; Bartkova et al., 1995). In Ewing tumors, we did not observe increased CDK4 and CCND1 copy numbers in any of the primary Ewing tumors and any of the cell lines (Figure 1a and Tables 1 and 2). However, expression levels of these genes, in particular of CCND1, varied considerably among unrelated cells lines independent of the p16 gene status as determined in Northern blots (Figure 3a). In addition, the two dierentially polyadenylated CCND1 transcripts of

4.8 kb and 1.7 kb (Xiong et al., 1991) were present in diering proportions. For cell lines from consecutive tumor samples of the same patients, only little variation in total CDK4 and CCND1 RNA amounts was observed (Figure 3b) suggesting that expression levels of these genes were characteristic of the tumor and not due to in vitro growth variations. Expression of pRb Occasional loss of pRb function has previously been reported to be restricted to cancer cell lines retaining wild type p16 (Aagaard et al., 1995). In our series of Ewing tumor cell lines Rb protein was detectable in its variably phosphorylated isoforms in all cases. However, one cell line with wild type p16 (SK-N-MC) showed only very weak signals for pRb expression (Figure 4). Corroborating previous reports (Aagaard et al., 1995; Li et al., 1994), reduction of pRb was associated with increased p16 and decreased CCND1 RNA steady state levels in this case (Figure 3a). When comparing pRb phosphorylation patterns in p16 negative versus p16 positive Ewing tumor cell lines on Western blots, no evidence for a consistent relative reduction of the underphosphorylated isoform in p16 deleted as compared to p16 positive cells was obtained neither in asynchronously growing (Figure 4) nor in serum starved (data not shown) cells. P53 versus p16 gene status We previously reported a low incidence of p53 alterations in primary Ewing tumors as opposed to a high proportion of p53 mutated cell lines (Kovar et al., 1993). In order to evaluate the relation of impaired p53 and pRb pathways in Ewing tumors, p53 mutation data from an update of the preceding study were included in our analysis. Two of 27 primary tumors (7%) and 10/23 unrelated cell lines (43%) displayed aberrant p53 status (Table 1 and 2). Five of 10 independent cell lines with p53 mutations retained intact p16. On the other hand, two of eight primary tumors ± including cases 9 and 10 for which no p16 protein could be detected in the cell lines derived from them ± and only 5/15 cell lines with p16 aberrations showed concomitant p53 mutations. Discussion The p15 and p16 genes have been found to be homozygously deleted with high incidence in tumors with frequent cytogenetic 9p21 aberrations. This chromosomal region is rarely altered in Ewing tumors (Turc-Carel et al., 1988). However, we identi®ed homozygous p15/p16 loss in approximately one third of cases. For two patients retaining wildtype gene status, absence of p16 protein was observed in the cell lines derived from them. Consequently, p15/p16 aberrations constitute the most frequent accessory genetic alteration in Ewing tumors described so far. If the two patients with post-transcriptional p16 inactivation demonstrated in the tumor derived cell lines are included among the p16 negative cases, only two of 10 (20%) are in complete clinical remission after 93 and 22 months observation period. Six patients died


2229

a +

A2 C

E2 F

G

J

N

P

Q

R

T

V

L1

U

W

–

p16

p16β ARF

p15

EWS

b C0 A3

C

E1 F

G

L1

U W

P

R

N

Q V

p16

Figure 2 p15 and p16 gene expression in Ewing tumor cell lines. (a) RT ± PCR analysis of p15, p16, p16bARF and, for con®rmation of RNA quality, EWS RNA. Hela cell RNA served as a positive control (+). For negative control, cDNA synthesis was performed in the absence of RNA (7). In the last lane, a detail from a 100 base pair size marker is retained. Note that a p16 and a p16bARF transcript was only detectable in all Ewing tumor cell lines with intact p16 (C, E2, F, G, J, N, P, Q, R, T, V) but not in p16 deleted cell lines (A2, L1, U, W) while p15 RNA was absent from all Ewing tumor cell lines. (b) Representative Western blot analysis of p16 protein expression in Ewing tumor cell lines. A Hela cell extract served as a positive control. As a loading control a Ponceau S stained detail of the blot is shown in the lower part of the ®gure. Cell line designations indicated on top of the Figures as in Table 2. Note that among cell lines with p16 RNA expression (A3, C, E1, F, G, P, R, N, Q, V as well as J and T (not shown)) no corresponding protein was detectable in cell lines C, E1 and F

from the disease, one of complications and one showed rapid disease progression after 4 months. In contrast, 11/17 patients (65%) with intact p16 are free from disease after a median observation time of 34 months, one died from complications, one died due to a second malignant neoplasm, and only four died from the disease. So far, the presence or absence of metastases at diagnosis has been considered as the only reliable prognostic indicator for Ewing tumor patients. In our small series, 6/10 (60%) p16 negative and 6/17 (35%) p16 positive cases presented with disseminated disease. Among metastasized tumors, 1/6 (17%) p16 negative and 4/6 (67%) p16 positive cases are in complete clinical remission (median observation time 25 months). Similarly, among patients with localized disease, only 1/4 (25%) cases lacking p16 but 7/11 (64%) patients with tumors retaining p16 are still free of disease (median observation time 39 months). These data suggest that p16 alteration might serve as an independent prognostic parameter for Ewing tumors. However, the group of cases considered as p16 wild type in the above calculations might contain a number of tumors with post-transcriptionally inactivated p16, similar to cases 9 and 10. Since in all cell lines lacking genomic p16 aberrations the gene was transcribed, we concluded that inactivation by promoter methylation does not signi®cantly contribute to p16 inactivation. Therefore, in order to con®rm the putative prognostic impact of our ®ndings by statistical analysis, immunohistochemical data on p16 protein expression from a large series of Ewing tumors are warranted. Considering both inactivation of p16 and Rb, the pRb dependent cell cycle regulatory cascade was compromised in at least 65% of unrelated Ewing tumor cell lines. This proportion might even be higher

when cyclin D1 overexpression is included into the calculation. Cell lines established from consecutive tumor samples of the same patients were not only identical in their p15/p16 gene status but also very similar in their CDK4 and CCND1 RNA abundancy suggesting that the expression pattern of these cell cycle regulatory genes in the cell lines was representative of the tumors from which they were derived. The high steady state levels of either CDK4 or, more frequently, CCDN1 RNA in some cell lines could not be attributed to gene ampli®cation. CDK4 colocalizes with MDM2 to human chromosome 12q13. In contrast to sarcomas, the lack of CDK4 amplification in Ewing tumors and cell lines is compatible with infrequent MDM2 ampli®cation in this tumor entity (Kovar et al., 1993). If both the p53 and the pRb dependent pathways of growth regulation are considered, genetic alterations were observed in 37% of tumors but 87% of cell lines. This discrepancy could not be assigned to a signi®cant underestimation of mutational frequencies in the primary tumors due to the variable presence of stromal cells since our approach of monitoring EWS gene rearrangements guaranteed a high tumor cell content in the samples. The identity of the p15/p16 and the p53 status in primary tumors and the corresponding cell lines derived from them suggests that in vitro enrichment of aberrations in these genes in the cell lines was the consequence of selection and not of de novo mutation. Although p16 loss and p53 mutation occurred in approximately half of the cell lines each, only ®ve cases were aected by both alterations and one cell line showed p53 and Rb aberrations. This frequency is compatible with independent perturbation of the two cell cycle regulatory pathways. Of the three cell lines


2230

a

R Q

T

N

R

K

M

L

S

P

N

Q

A2

S

M

U

B2

A2 J ppRb

p16

pRb

CDK4

CCND1

Figure 4 Expression of the various phosphorylated pRb isoforms in Ewing tumor cell lines with intact p16 (R, P, N, Q) and in p16 deleted cell lines (A2, S, M, U, B2). Cell lines also dier in CCND1 expression with N and B2 showing low, R, P, A2, M and U intermediate and Q and S high levels (compare Figure 3). Representative Western blot successively probed with an antibody recognizing all pRb isoforms (ppRb) and an antibody recognizing only the underphosphorylated isoform (pRb). As a loading control a Ponceau S stained detail of the blot is shown in the lower part of the ®gure

18S rRNA

b A1 A2 A3

B1 B2

E1 E2 E3

L1 L2 L3

p16

CDK4

CCND1

tion patterns in p16 positive and negative cell lines might therefore indicate that these signals are not operating during continuous growth but possible at the time of in-vitro establishment of a cell line. We have recently reported experimental evidence that the characteristic rearrangement of EWS withFLI1 and presumably with related ETS transcription factor genes is involved in proliferation of Ewing tumor cells (Kovar et al., 1996). The results of the present study imply that additional genetic alterations are necessary for successful in-vitro propagation of these cells. Among them, we have identi®ed deletion of the tumor suppressor gene p16 as a recurrent aberration which already occurred in the primary tumors with high frequency. Future studies will have to further evaluate the biological impact of our ®ndings. Materials and methods

18S rRNA Figure 3 RNA levels for p16, CDK4 and CCND1 in Ewing tumor cell lines. Representative Northern blots. (a) Comparison of unrelated cell lines. (b) Comparison of cell lines from consecutive tumor samples

expressing both wild-type p53 and wild-type p16, two showed overexpression of cyclin D1 (cell line STA-ET12; J in Figure 3; cell line GR-OH-1: data not shown). It therefore appears that Ewing tumor cells gained selective in-vitro growth advantage when one of the pathways regulating S-phase entry was compromised. It should be noted that we did not observe a consistent change in the proportion of phosphorylated pRb isoforms in association with p16 gene loss. However, pRb is phosphorylated by multiple CDKs that are subject to negative regulation by several CDIs including p21, a downstream target of p53. While p15 is believed to act downstream of the TFGb signalling pathway, nothing is known about the signals regulating p16 activity. The similarity of phosphoryla-

Tumors and cell lines Primary tumor materials studied were obtained from surgical specimens of Ewing tumor patients referred to our institution between 1988 and 1995. All patients were treated according to two consecutive European cooperative Ewing's sarcoma studies (CESS86 and EICESS92). Cell lines SK-ES1, RDES, A673 were obtained from the American Type Culture Collection (ATCC, Rockville, USA). SAL-1, SAL-2 and SMB were kindly provided by G Hamilton (1. Dept. of Surgery, University of Vienna, Austria), SK-N-MC by J Biedler (Memorial Sloan Kettering Cancer Center, New York, USA), IARC-EW2 by GM Lenoir (International Agency for Research on Cancer, Lyon, France), RM 82, WE 68, WE-M1-68, WEM2- 68, and VH 64 by F Van Valen (Dept. of Paediatrics, University of MuÈnster, Germany), TC 252 by T Triche (Dept. of Pathology, Children's Hospital, Los Angeles, USA), FPBH by M Vetterlein (Institute for Tumour Biology and Cancer Research, University of Vienna, Austria), and GR-OH-1 and KN-OH-1 by E Koscielniak (Olgahospital, Stuttgart, Germany). All other cell lines (designated STA-ET) were established at the CCRI. From four patients several tumor cell lines were available: SAL1, STA-ETA2.1, STA-ET7.1 and WE-68 were established from biopsies of untreated primary tumors. SAL-2 and


STA-ET-1 originated from the same tumor as SAL-1 from two independent samples collected after chemotherapy. STA-ET-2.2 was obtained from a bone marrow in®ltrate of the tumor that gave rise to STA-ET-2.1. STA-ET-7.2 was established from a pleural eusion and STA-ET-7.3 from a post-chemotherapy sample of the tumor from which STAET-7.1 was obtained. WE-M1-68 and WE-M2-68 are cell lines that originate from two metastases corresponding to the primary tumor which gave rise to WE-68. By RT ± PCR (Zoubek et al., 1996), all tumour samples and cell lines were shown to express the Ewing tumor speci®c EWS-FLI1 chimeric transcripts, except for cases #25 and #26 and the respective cell lines GR-OH-1 and STA-ET-11 presenting EWS-ERG fusions and case #27 and the deduced cell line STA-ET-10 displaying the recently described rare EWS/FEV rearrangement (Peter et al., 1997). PCR SSCP analysis and DNA sequencing For mutation analysis of p16, exon 2 was ampli®ed with its ¯anking intronic sequences from 0.1 mg genomic DNA in two overlapping portions using the gene speci®c primer p16S1 (TATAAGCTTGGCTCTACACAAGCTTCCTT) with p16A1 (TATTCTAGAGTGCAGCACCACCAGCGTG) and p16S2 (TATAAGCTTCCTGGACACGCTGGTGG) with the gene speci®c primer p16A2 (TATTCTAGATGAGCTTTGGAAGCTCTCAG). Thirty ®ve cycles of denaturation at 948C for 30 s, annealing at either 578C (p16S1/p16A1) or 508C (p16S2/p16A2) for 30 s and polymerisation at 728C for 40 s were performed. SSCP analysis was carried out essentially as described previously (Kovar et al., 1993). DNA sequencing was performed on PCR ampli®ed DNA with same primers as described above using the DNA cycle sequencing system (BRL, Gaithersburg, MD, USA) according to the manufacturers instructions. Analysis of genomic status and expression of p16, p15, CDK4, CCND1 and Rb genes The genomic status of p16 and p15 genes was determined on Southern blots by hybridization of 5 to 10 mg EcoRI digested genomic DNA to an exon 2 probe generated by PCR ampli®cation using primers p16S1 and p16A1. High tumor cell content in the primary tumor samples was con®rmed by consecutive hybridization to the EWS speci®c

probe HP.5 (Zucman et al., 1993) which, in addition to the ubiquitous germline band and a band originating from a pseudogene, detects an aberrantly migrating restriction fragment resulting from the ET speci®c gene rearrangement in tumors with EWS intron 7 breakpoints (89% of cases). For evaluation of CDK4 and CCND1 gene copy numbers previously described probes generated by PCR were used (Kathib et al., 1993; He et al., 1994). Expression of p16, p15, CDK4, and CCND1 RNA was tested on Northern blots using 10 mg of total RNA with the same probes used for Southern blot analysis. Western blotting was performed after electrophoretic separation of 40 mg whole cell extracts on denaturing polyacrylamide gels according to standard procedures. Monoclonal antibodies G3-245 and G99-549 (Pharmingen, San Diego, CA) (0.5 mg/ml) served to detect pRb in its variably phosphorylated and its underphosphorylated isoforms on Western blots. A polyclonal antibody (15126E; Pharmingen, San Diego, CA) was used in a 1:1000 dilution to study p16 expression in cell lines. RT ± PCR analysis for the presence of p15, p16 and p16bARF was performed on oligo-dT or random hexamer primed cDNA of total RNA using forward primers speci®c for p15 exon 1 (GGACTCCGCGACGGTCCGCA) or p16 exon 1 (GAGCAGCATGGAGCCTTCG) or p16 exon 1b (AGTGGCGCTGCTCACCTC) with the common exon 2 speci®c reverse primer p16A1 to generate products of 550, 280 and 420 base pairs, respectively. After initial denaturation at 948C for 7 min, ampli®cation was achieved in the presence of 3% formamide by 36 cycles of denaturation at 948C for 30 s, annealing at 508C for 30 s and extension at 728C for 40 s, followed by a ®nal 7 min extension step. The integrity of RNA used for RT ± PCR was con®rmed by electrophoresis on 1.5% agarose gels and by control ampli®cation of EWS RNA using primers AAGACCCACCCACTGCCAAG and CCACCTCTGTCTCCACCACG by 34 cycles of 948C for 30 s, 648C for 1 min and 728C for 1 min, preceded by an initial 5 min denaturation step and followed by a ®nal 3 min extension step. PCR products were resolved on 1.5% agarose gels.

Acknowledgements This work was supported in part by grant P-10774 of the Fonds zur FoÈrderung der Wissenschaftlichen Forschung to HK and by private donations to the CCRI.

References Aagaard L, Lukas J, Bartkova J, Kjerul AA, Straus M and Bartek J. (1995). Int. J. Cancer, 61, 115 ± 120. Bartkova J, Lukas J, Muller H, Strauss M, Gusterson B and Bartek J. (1995). Cancer Res., 55, 949 ± 956. Beltinger CP, White PS, Sulman EP, Maris JM and Brodeur GM. (1995). Cancer Res., 55, 2053 ± 2055. Caldas C, Hahn SA, da Costa LT, Redston MS, Schutte M, Seymour AB, Weinstein CL, Hruban RA, Yeo CJ and Kern SE. (1994). Nat. Genet., 8, 27 ± 32. Chen TC, Hsieh LL and Kuo TTJ. (1995). Pathol., 176, 243 ± 247. Delattre O, Zucman J, Melot T, Sastre X, Zucker JM, Lenoir G, Ambros P, Sheer D, Turc-Carel C, Triche TJ, Aurias A and Thomas G. (1994). N. Engl. J. Med., 331, 294 ± 299. Duro D, Bernard O, Della Valle V, Berger R and Larsen C-J. (1995). Oncogene, 11, 21 ± 29. El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Lin DM, Mercer WE, Kinzler KMV and Vogelstein B. (1993). Cell, 7, 817 ± 825. Hayashi N, Sugimoto Y, Tsuchiya E, Ogawa M and Nakamura Y. (1994). Biochem. Biophys. Res. Comm., 202, 1426 ± 1430.

He J, Allen JR, Collins VP, Allalunis-Turner MJ, Godbout R, Day RS III and James CD. (1994). Cancer Res., 54, 5804 ± 5807. HengstschlaÈger M, Pusch O, HengstschlaÈger-Ottnand E, Ambros PF, Bernaschek G and Wawra E. (1996). DNA Cell Biol., 15, 41 ± 51. Hirama T and Koeer HP. (1995). Blood, 86, 841 ± 854. Hollstein M, Sidransky D, Vogelstein B and Harris CC. (1991). Science, 253, 49 ± 53. Hui AM, Sakamoto M, Kanai Y, Ino Y, Gotho M, Yokota J and Hirohashi S. (1996). Hepatology, 24, 575 ± 579. Jen J, Harper W, Bigner SH, Bigner DD, Papadpoulos N, Markowitz S, Willson JKV, Kinzler KW and Vogelstein B. (1994). Cancer Res., 54, 6353 ± 6358. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day RS, III, Johnson BE and Skolnick MH. (1994). Science, 264, 436 ± 440. Kathib ZA, Matsushime H, Valentine M, Shapiro DN, Sherr CJ and Look AT. (1993). Cancer Res., 53, 5535 ± 5541. Kovar H, Auinger A, Jug G, Aryee D, Zoubek A, SalzerKuntschik M, and Gadner H. (1993). Oncogene, 8, 2683 ± 2690.

2231


2232

Kovar H, Aryee DNT, Jug G, HenoÈckl C, Schemper M, Delattre O, Thomas G and Gadner H. (1996). Cell Growth and Di., 7, 429 ± 437. Li Y, Nichols MA, Shay JW and Xiong Y. (1994). Cancer Res., 5, 6078 ± 6082. Lukas J, Parry D, Aagaard L, Mann DJ, Bartkova J, Strauss M, Peters G and Bartek J. (1995). Nature, 375, 503 ± 506. MacLachlan TK, Sang N and Girodano A. (1995). Crit. Rev. Eukaryot. Gene Expression, 5, 127 ± 156. Maelandsmo GM, Berner JM, Florenes VA, Forus A, Hovig E, Fodstad O, and Myklebost O. (1995). Br. J. Cancer, 72, 393 ± 398. Malkin D, Sexsmith E, Yeger H, Williams BR and Coppes MJ. (1994). Cancer Res., 54, 2077 ± 2079. Mao L, Merlo A, Bedi G, Shapiro GI, Edwards CD, Rollins BJ and Sidranski D. (1995). Cancer Res., 55, 2995 ± 2997. Mori T, Miura K, Aoki T, Nishihara T, Mori S and Nakamura Y. (1994). Cancer Res., 54, 3396 ± 3397. Ohnishi H, Kawamura M, Ida K, Sheng XM, Hanada R, Nobori T, Yamamori S and Hayashi Y. (1995). Blood, 86, 1269 ± 1275. Peter M, Couturier J, Pacquement H, Michon J, Thomas G, Magdelenat H and Delattre O. (1997). Oncogene, in press. Rael C, Thomas GA, Tishler DM, Lasso S and Allen JC. (1993). Neurosurgery, 33, 301 ± 305. Schmidt EE, Ichimura K, Reifenberger G and Collins VP. (1994). Cancer Res., 54, 6321 ± 6324. Schulze A, Zerfaû K, Spitkovsky D, Henglein B and JansenDuÈrr P. (1994). Oncogene, 9, 3475 ± 3482.

Serrano M, Hannon GJ and Beach D. (1993). Nature, 372, 704 ± 707. Stone S, Jiang P, Dayananth P, Tavtigian SV, Katcher H, Parry D, Peters G and Kamb A. (1995). Cancer Res., 55, 2988 ± 2994. Turc-Carel C, Aurias A, Mugneret F, Lizard S, Siander I, Volk C, Thiery JP, Olschwang S, Philip I, Berger MP, Philip T, Lenoir GM and Mazabraud A. (1988). Cancer Genet. Cytogenet., 32, 229 ± 238. Vogan K, Bernstein M, Leclerc JM, Brisson L, Brossard J, Brodeur GM, Pelletier J and Gros P. (1993). Cancer Res., 53, 5269 ± 5273. Wada M, Bartram CR, Nakamura H, Hachiya M, Chen DL, Borenstein J, Miller CW, Ludwig L, Hansen-Hagge TE, Ludwig WD, Reiter A, Mizoguchi H and Koeer HP. (1993). Blood, 82, 3163 ± 3169. Weinberg RA. (1991). Science, 254, 1138 ± 1146. Xiong Y, Connolly T, Futcher B and Beach D. (1991). Cell, 65, 691 ± 699. Zhang H, Xiong Y and Beach D. (1993). Mol. Biol. Cell, 4, 897 ± 906. Zoubek A, Dockhorn-Dworniczak B, Delattre O, Christiansen H, Niggli F, Gatterer-Menz I, Smith TL, JuÈrgens H, Gadner H and Kovar H. (1996). J. Clin. Oncol., 14, 1245 ± 1251. Zucman J, Melot T, Desmaze C, Ghysdael J, Plougastel B, Peter M, Zuvker JM, Triche TJ, Sheer D, Turc-Carel C, Ambros P, Combaret V, Lenoir G, Aurias A, Thomas G and Delattre O. (1993). EMBO J., 12, 4481 ± 4487.