AMPA glutamate receptor-mediated calcium ... - Wiley Online Library

Journal of Neurochemistry, 2002, 81, 390–402

AMPA glutamate receptor-mediated calcium signaling is transiently enhanced during development of oligodendrocytes Takayuki Itoh, Jacqueline Beesley, Aki Itoh, Akiva S. Cohen, Bryan Kavanaugh, Douglas A. Coulter, Judith B. Grinspan and David Pleasure Neurology Research, The Children’s Hospital of Philadelphia, Philadelphia, Pennsylvania, USA

Abstract Cells of the oligodendroglial lineage express Ca2+-permeable a-amino-3-hydroxy-5-methyl-4-isoxazolepropionate-preferring glutamate receptors (AMPA-GluR) during development. Prolonged activation of their AMPA-GluR causes Ca2+ overload, resulting in excitotoxic death. Prior studies have shown that oligodendroglial progenitors and immature oligodendrocytes are susceptible to excitotoxicity, whereas mature oligodendrocytes are resistant. An unresolved issue has been why Ca2+-permeability of AMPA-GluR varies so markedly with oligodendroglial development, although the level of expression of edited GluR2, an AMPA-GluR subunit which blocks Ca2+ entry, is relatively constant. To address this question, we performed Ca2+ imaging, molecular and electrophysiological analyses using purified cultures of the rat oligodendroglial

lineage. We demonstrate that transient up-regulation of expression of GluR3 and GluR4 subunits in oligodendroglial progenitors and immature oligodendrocytes results in the assembly by these cells, but not by oligodendroglial pre-progenitors or mature oligodendrocytes, of a population of AMPAGluR which lack GluR2. This stage-specific up-regulation of edited GluR2-free, and hence Ca2+-permeable, AMPA-GluR explains the selective susceptibility to excitotoxicity of cells at these stages of oligodendroglial differentiation, and is likely to be important to these cells in the trans-synaptic Ca2+-signaling from glutamatergic neurons, which occurs in hippocampus in vivo. Keywords: AMPA receptor, calcium, electrophysiology, fura-2 microfluorometry, oligodendroglial lineage. J. Neurochem. (2002) 81, 390–402.

Oligodendrocytes, the myelin forming cells in the CNS, develop from a subset of precursor cells in the CNS germinal zones during late gestational and early post-natal periods. Development of oligodendroglial lineage cells (OLC) in vitro and in vivo has been well delineated with the aid of a series of antibodies against stage-specific surface markers (Sommer and Schachner 1981; Raff et al. 1983; Hardy and Reynolds 1991; Pfeiffer et al. 1993). OLC also express various cationic channels during differentiation, including ionotropic glutamate receptors (GluR) (Sontheimer et al. 1989; Barres et al. 1990; Borges et al. 1994; Patneau et al. 1994; Verkhratsky and Kettenmann 1996). Activation of ionotropic GluR causes Ca2+ influx in OLC, which is mainly mediated through Ca2+permeable a-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) GluRs (Borges et al. 1994; Holtzclaw et al. 1995; Itoh et al. 2000). An increase in intracellular Ca2+ levels ([Ca2+]i) triggers various Ca2+-dependent intracellular signaling pathways including a rapid induction of immediateearly genes (Pende et al. 1994). Prolonged activation of Ca2+-permeable AMPA-GluRs causes excitotoxic death of OLC, which is likely to be responsible for loss of OLC under

various pathological conditions (Follett et al. 2000; Li and Stys 2000; Pitt et al. 2000; Matute et al. 2001; Tekkok and Goldberg 2001). Previous studies have shown that, while oligodendroglial progenitor cells (OP) and immature

390

Received November 7, 2001; revised manuscript received January 14, 2002; accepted February 1, 2002. Address correspondence and reprint requests to Takayuki Itoh, Abramson Research Center Room 516 I, 3517 Civic Center Boulevard, Philadelphia, PA 19104, USA. E-mail: [email protected] Abbreviations used: AMPA-GluR, a-amino-3-hydroxy-5-methyl-4isoxazolepropionate-preferring glutamate receptor; [Ca2+]i, intracellular Ca2+ level; CICR, calcium-induced calcium release; CNS, central nervous system; CT, cycle threshold; DMEM, Dulbecco’s modified Eagle medium; Erev, reversal potential; FCCP, carbonyl cyanide 4-trifluoromethoxyphenylhydrazone; GalC, galactocerebroside; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IM, immature oligodendrocytes; JSTx-3, joro spider toxin tristrifluoracetate; MBP, myelin basic protein; MO, mature oligodendrocytes; OLC, oligodendroglial lineage cells; OP, oligodendroglial progenitor cells; PP, pre-progenitor cells; PSA–NCAM, polysialylated neural cell adhesion molecules; R/R, rectification ratio; RT, reverse transcriptase; SRM, standard recording medium; VGCC, voltage-gated calcium channel.

2002 International Society for Neurochemistry, Journal of Neurochemistry, 81, 390–402

AMPA receptors in oligodendroglial lineage 391

oligodendrocytes (IM) are very susceptible to Ca2+-dependent excitotoxic death, OLC become resistant after maturation (McDonald et al. 1998; Kavanaugh et al. 2000). The focus of our interest has been on the mechanisms responsible for this developmentally enhanced susceptibility of OLC to excitotoxicity. Ca2+-permeability of AMPA-GluR is determined by their subunit composition, particularly by the presence of an edited version of the GluR2 subunit (Hollmann et al. 1991; Geiger et al. 1995). Meucci et al. (1996) first reported that kainate-induced Ca2+ fluxes in cultured CG-4 and O-2A progenitor cells from rat cortex became less sensitive to spider toxins which block Ca2+-permeable AMPA-GluR after differentiation to oligodendroglia, and speculated that the increased expression of GluR2 after differentiation accounted for this change. We wished to test directly the hypothesis that the dramatic changes in AMPA-GluR Ca2+-permeability that take place during oligodendroglial differentiation are a consequence of developmentally determined alterations in the ratio of edited GluR2 to other AMPA-GluR subunits, causing the assembly, at these stages of differentiation, of AMPA-GluR lacking edited GluR2. If this hypothesis proves correct, we could explain both the much greater susceptibility of OP and IM than of MO to AMPA-GluR-mediated excitotoxicity, and how glutamatergic neurons elicit Ca2+ currents in IM with which they establish synaptic contacts in hippocampus (Bergles et al. 2000). In this study, we employed purified primary OLC cultures to examine developmental changes in [Ca2+]i response during activation of AMPA-GluR. We show here that [Ca2+]i responses as well as normalized outward Ca2+ currents of OLC in response to AMPA-GluR activation are markedly enhanced in OP and IM, and that this enhancement is attributable to stage-specific up-regulation of expression of GluR3 and GluR4 subunit proteins, permitting the assembly of GluR2-free AMPAGluR in OP and IM.

Materials and methods Cell culture Primary OLC cultures at various differentiation stages were prepared by methods described previously (Kavanaugh et al. 2000). Briefly, the primary mixed glial cultures were obtained from forebrains of 1-day-old Sprague–Dawley rats. OP were purified by sequential negative and positive immunopanning procedures with RAN-2 (generous gift from Dr Arthur F. McMorris, Wister Institute) and A2B5 (American Type Culture Collection, Manassas, VA, USA) antibodies, respectively. The purified OP (> 98%) were maintained in CM medium, which consisted of 70% (v/v) N1 medium [high glucose Dulbecco’s modified Eagle medium (DMEM) containing 100 units/mL penicillin, 100 lg/mL streptomycin, 6 mM glutamine, 10 ng/mL biotin, 5 lg/mL insulin, 5 lg/mL transferrin, 30 nM sodium selenite, 20 nM progesterone, and 100 lM putresine as final concentrations], 30% (v/v) B104 neuroblastoma-conditioned

medium, 10 ng/mL of bovine brain basic fibroblast growth factor (FGF) and 2 ng/mL of human recombinant platelet-derived growth factor (PDGF)AA (Louis et al. 1992). To induce differentiation of OP to oligodendrocytes, OP were removed from the CM medium and transferred to a DM medium [50% (v/v) high glucose DMEM, 50% (v/v) Ham’s F-12 medium, 100 units/mL penicillin, 100 lg/mL streptomycin, 4.5 mM glutamine, 10 ng/mL biotin, 12.5 lg/mL insulin, 50 lg/mL transferrin, 24 nM sodium selenite, 10 nM progesterone, 67 lM putresine, and 0.4 lg/mL 3,5,3¢,5¢-tetraiodothyronine as final concentrations]. We used these cultures at 2 days and 4 days after transfer to DM medium as cultures of IM and mature oligodendrocytes (MO), respectively, in accordance with the observations of immunoreactivities of their major population to O4 antigen and myelin basic protein (MBP; data shown below). Purified cultures of pre-progenitor cells (PP) from the white matter of newborn rats were obtained as described previously (Grinspan and Franceschini 1995) by sequential immunopanning procedures, based on their specific expression of polysialylated neural cell adhesion molecules (PSA-NCAM). Chemicals AMPA, cyclothiazide, and Joro spider toxin tristrifluoracetate (JSTx-3) were from Sigma/RBI (St Louis, MO, USA), fura-2 acetoxymethyl ester and pluronic F-127 were from Molecular Probes (Eugene, OR, USA), and fura-2FF acetoxymethyl ester was from Tef Laboratories (Austin, TX, USA). Cyclothiazide and carbonyl cyanide 4-trifluoromethoxyphenylhydrazone (FCCP) stock solutions were prepared in 100% dimethyl sulfoxide (DMSO). The final DMSO concentrations in the media never exceeded 0.2% (v/v). All other chemicals were purchased from Sigma. Standard recording medium (SRM) contained 140 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 0.8 mM MgCl2, 0.8 mM Na2HPO4, 10 mM HEPES, 25 mM D-glucose; was adjusted to pH 7.4 with NaOH, and was 319 milliosmolar. In Ca2+-free medium, CaCl2 was omitted, and 0.02 mM EGTA was added. Low Na+ medium was prepared by replacing NaCl with equimolar N-methyl-D-glucamine, omitting Na2HPO4, and adjusting the pH to 7.4 with HCl. Immunoblots and immunoprecipitation The rabbit polyclonal antibodies against rat GluR1, GluR2, and GluR4 were purchased from Chemicon (Temecula, CA, USA), and the mouse monoclonal antibody against rat GluR3 from Zymed Laboratories (San Francisco, CA, USA). For the regular immunoblots for GluR1 to GluR4 during differentiation, the OLC cultures were rinsed twice with ice-cold PBS, and dissolved directly in the lysis buffer [25 mM Tris–HCl (pH 7.6); 1 mM EDTA; 1 mM MgCl2; 1% (v/v) Triton X-100; 1% (w/v) SDS; 1 mM phenylmethylsulfonyl fluoride; 50 lg/mL antipain; 2 lg/mL aprotinin; 1 lg/mL pepstatin A; and 1 lg/mL leupeptin]. The lysate was centrifuged at 5000 g for 15 min at 4C and the supernatant was saved. Protein concentration of each preparation was quantified with the BCA Protein Assay Reagent (Pierce, Rockford, IL, USA). Twenty micrograms of protein from each sample was applied to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE). Immunoprecipitation was performed by the method of Wenthold et al. (1996) with minor modifications. The OLC cultures were


392 T. Itoh et al.

rinsed with ice-cold phosphate-buffered saline (PBS), and dissolved at 30–50 mg wet weight/mL in 50 mM Tris–HCl, pH 7.5, containing 1% (v/v) Triton X-100, 10% (v/v) glycerol, 1 mM EDTA, and 0.1 mM phenylmethylsulfonyl fluoride (PMSF). The lysate was then centrifuged at 20 000 g for 30 min at 4C, and the supernatant was stored at ) 80C until use. One microgram of anti-GluR2 antibody was incubated with 10 lL (volume of packed resin) of protein-A agarose (Amersham Pharmacia Biotech, Piscataway, NJ, USA) in the same solubilizing buffer containing 0.1% bovine serum albumin for at least 4 h. The resin was then washed four times and mixed overnight with 90 lL of the Triton X-100-solubilized preparation. The mixture was centrifuged briefly, and the unbound fraction was collected. The same volumes (10 lL) of the unbound fractions, as well as the untreated solubilized fractions that served as controls, were electrophoresed on 10% (w/v) SDS-polyacrylamide gels together with Full Range recombinant Rainbow Molecular Weight Markers (Amersham Pharmacia Biotech), and transferred to nitrocellulose membranes (Schleicher & Schnell, Keene, NH, USA). The membranes were blocked with 5% non-fat dry milk in PBS with 0.02% (v/v) sodium azide for 1 h and then incubated for 1 h with a primary polyclonal antibody, followed by a peroxidaseconjugated secondary antibody. Primary antibodies were used at the following concentrations (in lg/mL): GluR1 1.0, GluR2 0.5, GluR3 2.0, and GluR4 2.0. Immunoreactive bands were visualized using enhanced chemiluminescence according to the manufacturer’s protocol (NEN Life Science Products, Boston, MA, USA). In each experiment, immunoblot for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) on the same membrane was performed as a reference of loading. Densitometric analysis of the digitally captured TIFF images of immunoblots was done by NIH image program version 1.61. Real-time PCR Real-time PCR analysis was performed using the ABI Prism 7700 Sequence detection system (Applied Biosystems, Foster City, CA, USA). The set of primers and the corresponding real time PCR probe specific to each AMPA-GluR subunit were designed to detect the region containing the exon 16/exon 17 junction of each cDNA. The primers and probes for the analyses are shown in Table 1. A series of determined concentrations of the purified expression construct of each AMPA-GluR subunit, including the amplicon sequence of the real time PCR, was prepared, as a template for the concentration standards. Total RNA was isolated from the OLC by a single-step method (Chomczynski and Sacchi 1987). The first-strand cDNA was synthesized by Superscript II reverse transcriptase (RT; Life Technologies, Rockville, MD, USA) with oligo dT primer. The first strand cDNA from 50 ng of total RNA was applied to each 25 lL PCR reaction mixture containing 1 · TaqMan PCR Master Mix (Applied Biosystems), 400 nM of gene specific forward and reverse primers, and 240 nM of the corresponding real time PCR probe at final concentrations. Each reaction plate contained triplicates of samples at each developmental stage, non-template controls, and serial dilutions of the standard template. The reaction was performed with the following thermal cycle condition; 50C for 2 min, 95C for 10 min, and subsequent 40 two-step cycles of 95C for 30 s and 60C for 1 min. Emission data of each reaction well were collected at every amplification cycle, and stored in a Mac-OS

based computer for later off-line analysis. GAPDH cDNA level was also quantified as a reference with TaqMan Rodent GAPDH Control Reagents (Applied Biosystems) according to the manufacturer’s protocol. Emission data were analyzed by the program, Sequence Detector version 1.7a (Applied Biosystems). Cycle threshold (CT) number was calculated automatically by the program. In some cases, however, the threshold level was precisely adjusted manually. No detectable amplification in nontemplate controls was also confirmed to rule out contamination of template copies in the reaction mixtures. In the successful experiments, CT numbers showed a significant reverse linear correlation with logarithmic concentrations of the standard template (correlation coefficient > 0.99). The original copy numbers of the first strand cDNA in RT samples were calculated based on the obtained correlation parameters. Analysis of splice variants The entire coding segment of each AMPA-GluR subunit was amplified by Pfu DNA polymerase-based RT-PCR with the following primer sets; corresponding base numbers were 390–410 and 3113–3093 of rat GluR2 (Sommer et al. 1990; accession no. M38061), 129–149 and 2869–2849 of rat GluR3 (Boulter et al. 1990; accession no. M85036), 148–171 and 2910–2887 of rat GluR4 (Boulter et al. 1990; accession no. M85037). The 5¢ end of each reverse primer was labeled with biotin. The subunit-specific PCR products were digested with the following sets of restriction enzymes; HpaI and BspEI for GluR2, HpaI and AvaI for GluR3, and HpaI and EcoRI for GluR4. The cleaved fragments were separated by electrophoresis in 6% acrylamide gels, and transferred to nylon membranes. Biotin-labeled fragments were detected by chemiluminescence reaction. For confirmation of GluR2 long form, the PCR product with the primer set for GluR2 was recovered and ligated into pCR-Blunt II-TOPO cloning vector (Invitrogen, Carlsbad, CA, USA). Seven clones were randomly picked and sequenced from the 3¢ end. One clone contained GluR2 long form whose alternative splicing site of C-terminal was identical to that of mouse GluR2 long form. Microfluorometric analyses of intracellular Ca2+ concentrations [Ca2+]i was quantified by microfluorometry with fura-2 or fura-2FF, an analog of fura-2 with a lower affinity to Ca2+, as previously described (Itoh et al. 2000). Briefly, OLC grown on poly D-lysinecoated coverslips were incubated for 1 h with 5 lM fura-2 acetoxymethyl ester or fura-2FF acetoxymethyl ester and 0.02% pluronic F-127 in SRM. The coverslip was placed in a perfusion chamber (RC-21B; Warner Instrument Corp, Hamden, CT, USA) within which solutions could be changed within 15 s. After a 15-min incubation to permit complete hydrolysis of the acetoxymethyl ester form, the cells were alternatively illuminated with a 75 watt Xe arc lamp through 340 and 380 nm excitation filters. Emission fluorescence images were obtained with a SIT camera (C2400-08; Hamamatsu Photonics K. K., Japan) attached to an epifluorescence microscope (Optiphot; Nikon, Japan), and converted to digital data by an image-processing system (ARGUS-50; Hamamatsu Photonics K. K., Japan). All procedures were performed at room temperature (23 ± 1C). A whole somal area of each cell was selected for [Ca2+]i analysis. [Ca2+]i was calculated from the emission intensity ratio (R) at 340 to 380 nm excitation wavelength, using the following formula by Grynkiewicz et al. (1985):



Table 1 Primers and probes for the real-time PCR analysis Primers/Probes

Sequence

GR1R5 GR1R3 GR1R5FT GR2R5 GR2R3 GR2R5FT GR3R5 GR3R3 GR3R5FT GR4R5 GR4R3 GR4R5FT

5¢-CGAAGCGGATGAAGGGTTT-3¢ 5¢-GGAAGTCCTGGCTGACCAC-3¢ 5¢-FAM/CAATCCATCAATGAAGCCATACGGACATC/TAMRA-3¢ 5¢-CGTATATGGCATCGAGAGTGTT 5¢ 5¢-TGCTTTGGGAAATTCTGGAGT-3¢ 5¢-FAM/CAAGGCAAGGCTGTCAATTACAGGAAGTACTG/TAMRA-3¢ 5¢-GGCTACAACGTGTATGGAACAGA-3¢ 5¢-CGACACCAGGGAGAGTGAAAT-3¢ 5¢-FAM/AATCACTGAAAACGTGGCTGCTTCAAGG/TAMRA-3¢ 5¢-GTTACAAGTCCAGGGCAGAGG-3¢ 5¢-GTTTTCTCCCACACTCCCAGT-3¢ 5¢-FAM/TTCCGAAGCCATAAGAAACAAAGCCAGG/TAMRA-3¢

As for the designation of the primers and the probes for GluR1 (GR1), GluR2 (GR2), GluR3 (GR3) and GluR4 (GR4), ÔR5Õ, ÔR3Õ, and ÔR5FTÕ indicate a forward primer, a reverse primer, and a real-time PCR probe, respectively. In the real-time PCR probes, FAM (6-carboxyfluorescein) was a reporter dye attached to the 5¢ end, and TAMRA (carboxytetramethylrhodamine) was a quencher dye to the 3¢ end.

½Ca2 þ i ¼ b Kd ðR Rmin Þ=ðRmax RÞ where Kd is the dissociation constant of fura-2; b is the ratio of emission signals at 380 nm of Ca2+-free and Ca2+-saturated dye; Rmin is R in the absence of Ca2+ Rmax is R in saturating [Ca2+]i. These parameters were determined by in vitro calibration (Itoh et al. 1998). Kd values obtained by the calibration were 160 nM and 3 lM for fura-2 and fura-2FF, respectively. Although we have provided calibration bars in some microfluorometry figures, concentrations above four times these Kd values may be interpreted with caution, because the deviation from actual [Ca2+]i-values is significantly enhanced by variations of actual these parameters among cells above the range when calibration is done in vitro. Electrophysiology Whole-cell voltage-clamp recordings were conducted at room temperature on a Leica inverted microscope (Heidelberg, Germany) equipped with Hoffman modulation contrast optics. OLC at varying developmental stages were voltage clamped at )70 mV and signals were recorded and amplified with an Axopatch 1D amplifier (Axon Instruments, Foster City, CA, USA), filtered at 5 k Hz, and stored on a PC microcomputer for subsequent offline analysis. Data acquisition and analysis were performed with a Digidata 1200 A/D converter and pClamp 6.0 software (Axon Instruments). Electrodes were fabricated from thick-wall borosilicate glass (World Precision Instruments, Sarasota, FL, USA) and pulled to a resistance between 2 and 6 MW when filled with an internal solution composed of: KCl 140 mM; EGTA 10 mM; MgCl2 2 mM; HEPES 10 mM; NaATP 2 mM; pH 7.4 (with KOH) on a two-stage puller (Narishige PP-83, East Meadow, NY, USA). The external bath solution consisted of N-methyl-D-glucamine 105 mM; HEPES 5 mM; CaCl2 30 mM, pH 7.25 (with CsOH). Current voltage relationships were calculated by incrementing the voltage from )90 to +80 mV over a 1-s duration. Voltage ramp clamp commands were administered in control and glutamate (100 lM) plus cyclothiazide (100 lM, to block AMPA-GluR desensitization) containing external solution applied via a largebore multibarrel apparatus (200 lm internal barrel diameter).

Control ramps were subsequently subtracted from experimental ramps to provide leak-subtracted responses mediated by AMPAGluR activation. Statistical analysis Statistical significance was evaluated by ANOVA with the Bonferroni/ Dunn multiple comparison test, using the Mac OS-based program StatView version 4.5 (Abacus Concepts, Berkeley, CA, USA). Twotailed unpaired Student’s t-tests were performed to determine statistical significance at the p < 0.05 confidence level when comparing different treatments groups in the electrophysiological experiments. Data are shown as means and SD, unless otherwise noted.

Results

Characterization of the OLC cultures at different developmental stages Figure 1 clearly demonstrates that our primary OLC cultures consisted of uniform cells with similar morphology and rarely contained astrocytes which could easily be distinguished from OLC by their distinctive flat shapes. The purity of these OLC cultures ensured the significance of biomolecular analyses described below. Figure 1 also confirms that morphological changes from bipolar or tripolar cells to highly branched cells occurred in a relatively synchronized manner. We used immunocytochemistry to further characterize these populations of OLC as well as pre-progenitor cell (PP) cultures that were prepared separately (see Materials and methods). PP were PSA-NCAM+, OP were A2B5+ and O4–, IM were O4+ and MBP–, and MO were MBP+. Table 2 confirms that more than 80% of the OP and IM cultures fulfilled these criteria. More than 80% of the cells in the IM cultures also expressed galactocerebroside (GalC), another


394 T. Itoh et al.

Table 2 Immunocytological evaluation of the OP, IM and MO cultures with differentiation markers Percent of population OP (Day 0) A2B5+ O4– IM (Day 2 in DM) O4+ MBP– MO (Day 4 in DM) MBP+

99 ± 2 93 ± 3 81 ± 3 92 ± 0 54 ± 7

The cells were incubated with A2B5, O4, or MBP antibodies, followed by labeling with fluorescein- or tetramethyl rhodamine-conjugated secondary antibodies. In each condition, 10 fields (200· magnification) of at least two coverslips from at least three independent cultures were counted using a Leica DMR fluorescence microscope. Data are means ± SD.

Fig. 1 Phase-contrast pictures of the panned oligodendroglial cultures at 0 days (a), 2 days (b), and 4 days (c) after induction of differentiation by changing the medium from GM to DM medium. Note uniformity of the cells in each culture and morphological changes during differentiation. Scale bar; 100 lm.

marker for IM and later stages (data not shown). The MBP-positive population was 54% in MO cultures. The PP cultures also consisted of more than 80% PSA-NCAM+ cells (data not shown).

AMPA-GluR-mediated Ca2+-response changes during OLC development A brief application of AMPA elicited a significant [Ca2+]i increase in OP, IM and MO, which was quite reproducible until at least the third application. This response was largest at the stage of IM and diminished markedly after maturation to MO (Fig. 2a–c). Occasional astrocytes in the cultures did not show robust responses to AMPA at any stage of culture (Fig. 2d). Therefore, this transient enhancement of [Ca2+]i response to AMPA was observed only in the oligodendroglial lineage, but not in astrocytes. PP were far less [Ca2+]i responsive to AMPA alone (data not shown). Inhibition of AMPA-GluR desensitization by cyclothiazide greatly enhanced [Ca2+]i response of OP to AMPA and, within a few minutes of prolonged activation of AMPA-GluR, [Ca2+]i of OP exceeded more than 10 lM, which could be measured only by the low-affinity Ca2+ indicator, fura-2FF. Even in the presence of cyclothiazide, however, PP showed transient [Ca2+]i increases and no catastrophic increases in [Ca2+]i as observed in OP (Fig. 3). Prior studies have shown that, if a large part of AMPAstimulated Ca2+ influx is mediated by Ca2+-permeable AMPA-GluR which carry only the uncharged amino acid glutamine at the Q/R site, the [Ca2+]i increase can be blocked by such positively charged polyamines as Joro spider toxin (JSTx-3; Blaschke et al. 1993). To test this, we added JSTx-3 during the third application of AMPA as presented in Fig. 2 and calculated the percentage inhibition of the peak [Ca2+]i by JSTx-3 in relation to the averaged peak [Ca2+]i-values at preceding two applications of AMPA without JSTx-3. Figure 4 demonstrates a clear correlation between the JSTx-3 block and the peak [Ca2+]i, indicating that Ca2+permeable AMPA-GluR are responsible for this enhanced response. Figure 4 also demonstrates that the peak [Ca2+]i of IM are higher than those of OP.



Fig. 3 Fura-2FF microfluorometry of pre-progenitor cells (a; PP) and progenitor cells (b; OP). AMPA (250 lM) and cyclothiazide (50 lM) were added as indicated by a bar (AMPA + CYZ).

Fig. 2 Intracellular Ca2+ levels in response to 1 min applications of AMPA (250 lM) in the presence or absence of the Joro spider toxin analogue (JSTx-3, 500 nM). The panels show the traces of all single cells examined in a representative fura-2 microfluorometry from at least four independent experiments with progenitor cells (a; OP), immature oligodendrocytes (b; IM) and mature oligodendrocytes (c; MO). (d) A trace of an astrocyte (Astro) occasionally found in the field. All contaminating astrocytes at any culture stages showed similar responses to the drugs.

Developmental changes in AMPA-GluR subunits during OLC development The subunit composition of AMPA-GluR is an important determinant of their Ca2+-permeability. The purified OLC cultures permitted us to immunochemically quantify the protein levels of AMPA-GluR subunits at four developmental stages, using antibodies which specifically recognize each GluR subunit (Fig. 5). GluR1 was expressed only minimally in PP, and was barely detectable in OP, IM, and MO. GluR2 was expressed fairly constantly throughout OLC differentiation. In contrast, both GluR3 and GluR4 expressions were remarkably increased upon differentiation from PP to OP. While GluR3 decreased thereafter, GluR4 expression remained high in IM, and then fell after the maturation of IM to MO. Therefore, if the assembly of homomeric or

Fig. 4 The inhibitory effect of JSTx-3 was plotted against the averaged peak [Ca2+]i during the preceding two applications of AMPA (250 lM) in the absence of JSTx-3 at three developmental stages: OP (a), IM (b), and MO (c). Fura-2 microfluorometry was done as shown in Fig. 2. Results from at least four independent measurements are combined in each panel.

heteromeric AMPA-GluR takes place randomly, depending on the abundance of available subunit proteins, formation of Ca2+-permeable AMPA-GluR consisting only of GluR3 and/ or GluR4 is more likely in OP and IM than in PP and MO. To prove the presence of AMPA-GluR that lack GluR2, we employed immunoprecipitation as described for hippocampal tissues by Wenthold et al. (1996). According to their observations, a Triton X-100-soluble preparation retains 85% of [3H]AMPA binding activities, indicating that the assembly of most AMPA-GluR remains intact in the preparation. As shown in Fig. 6, more than 20% of immunoreactivities for GluR3 and GluR4 remained in the preparations immunoprecipitated by anti-GluR2 antibody,


396 T. Itoh et al.

Fig. 5 Expression of each AMPA-GluR subunit is developmentally regulated during the differentiation of OLC. Immunoblot analysis of GluR1, GluR2, GluR3, and GluR4 AMPA-GluR subunits in PP, OP, IM, MO, and rat brain (RB). RB was used as a positive control, because all GluR subunits are redundantly expressed in RB. Subsequent immunoblots for GAPDH (shown under each GluR immunoblot) verify equal loading in each lane. Molecular size markers on the right side of GluR immunoblots indicate 75 k and 105 kDa.

Fig. 6 Immunoprecipitation demonstrates the presence of AMPAGluR assembled exclusively of GluR3 and/or GluR4. The Triton X-100-soluble preparations from OP, IM, and MO cultures were immunoprecipitated by anti-GluR2 antibody. The same volumes of the unbound fractions (UF) and untreated inputs (C) were immunoblotted for GluR2, GluR3, and GluR4. Densitometric results are shown under the lanes as the percentages of corresponding untreated inputs. The immunoblot for GAPDH demonstrates that nonspecific loss of proteins is negligible between C and UF, and that the preparations of OP were diluted compared to those of IM and MO. Molecular size markers on the right side indicate 75 k and 105 kDa. Note that the highest immunoreactivities for GluR3 and GluR4 remains in UF from IM cultures.

thus indicating that this proportion of GluR3 and GluR4 participated in assembly of AMPA-GluR free of immunoreactive GluR2. It is also noteworthy that the highest

Fig. 7 Abundance of each AMPA-GluR subunit mRNA in OLC. The copy number of the first-strand cDNA synthesized from 1 lg of total RNA was quantified by real-time PCR as described in the Materials and methods. Note that the calculated numbers are plotted to a logarithmic scale. GluR3 and GluR4 mRNA levels were decreased after the differentiation from OP to IM, and from IM to MO, respectively, while GluR2 mRNA levels remained relatively constant. GluR1 mRNA level was 100-fold less at all three stages compared to the expression in rat brain as a positive control (RB, closed triangle). GAPDH mRNA levels are also shown as a reference. The results were averages of triplicate reactions from an experimental set.

remaining signals for GluR3 and GluR4 were observed at the IM stage. Real-time PCR analysis proved that the absolute mRNA levels of each AMPA-GluR also changed during the differentiation in good accordance with the protein levels. Almost 100-fold less expression of GluR1 in OP, IM and MO compared with GluR2–4 was confirmed as well (Fig. 7). Figure 8(a) confirmed that almost 100% of GluR2 was edited at all stages in agreement with previous studies. We also examined splice variants of each AMPA-GluR subunit by RT-PCR, because an alteration in splice variant expression might contribute to the changes in gating properties of AMPA-GluR during differentiation (Fig. 8b). To ensure detection of all possible variants, we performed long PCR using primer sets that flanked the entire coding region of each subunit. In regard to flip/flop alternative splicing, the flip variant accounted for almost all GluR3 and GluR4 mRNAs, though GluR3 flop form was faintly detectable at the stage of OP. Although GluR2 flip was also dominant, GluR2 flop was readily detected, and was reduced during the differentiation from OP to MO. We also detected increased expression of an alternative C-terminal variant of GluR2, ÔGluR2 long formÕ,



as OLC matured. We confirmed by subcloning that this variant was generated by splicing at the alternative 5¢ donor site within exon 16 as reported in mouse GluR2 long form (Ko¨hler et al. 1994). The similar C-terminal splicing variant of GluR4, GluR4c, was faintly observed only in OP (Gallo et al. 1992). Compared with the changes in expression levels of GluR3 and GluR4, these gradual changes in splice variants did not correspond with the transient increase in [Ca2+]i response at the stages of OP and IM.

Fig. 8 (a) Almost 100% of GluR2 mRNA is edited in OLC. The segment including Q/R editing site was amplified by RT-PCR from total RNA of OP (lane 1), IM (lane 2), and MO (lane 3). Lane 4: expression construct of GluR2 non-edited form as a template, Lane 6: expression construct of GluR2 edited form, Lane 5: 1 : 1 mixture of both expression constructs. Following digestion with Bbv I which specifically cleaves non-edited forms, the fragments of non-edited (Q) and edited (R) forms migrated separately as indicated on the right. An extremely faint signal of non-edited forms was observed in MO by longer exposure (not visible here). The efficiency of Bbv I digestion was not 100%, because very faint signal of the uncut fragment is still observed in lane 4. (b) Composition of splice variants of each subunit in OP, IM and MO. RT-PCR products from OP (lane 1), IM (lane 2), MO (lane 3), rat brain (lane 4), GluR4 flip expression construct (lane 5), and GluR4 flop expression construct (lane 6) were digested with a combination of the restriction enzymes including HpaI (see Materials and methods). The corresponding position of each variant is shown on the right; GluR4 flip (4i), GluR4 flop (4o), GluR4c flip (4ci), GluR4c flop (4co), GluR3 flip (3i), GluR3 flop (3o), GluR2 flip (2i), GluR2 flop (2o), GluR2 long flip (2Li), and GluR2 long flop (2Lo). Size markers on the left indicate 500 bp and 300 bp.

Electrophysiological characteristics of OLC changes during development In order to assess putative changes in Ca2+ conductance of AMPA-GluR during oligodendroglial development, we examined current–voltage (I–V) relationships at various developmental stages under experimental conditions similar to those employed by Sakmann’s group (Geiger et al. 1995). Glutamate-evoked currents, which were principally mediated by flux of Ca2+ ions as a charge carrier under the conditions we employed, were observed in OP, IM, and MO during application of glutamate plus cyclothiazide, while there was no detectable current in PP (Fig. 9a). The rectification ratio (R/R) of glutamate-evoked current was calculated by dividing the current present 30 mV positive to the reversal potential (Erev) by that 30 mV negative to Erev. The R/R was not significantly different among OP, IM and MO’s but there was a trend towards enhanced outward rectification in OP (Fig. 9b). Furthermore, because rectification in AMPA-GluR has previously been demonstrated to be dependent on the presence of internal polyamines (Kamboj et al. 1995), we initially incorporated spermine (60 lM) in the internal electrode solution. However, the I–V relationships generated when spermine was incorporated in the electrode solution did not significantly differ from those recorded without spermine (data not shown), and therefore, the data were pooled. The

Fig. 9 Changes in electrophysiological characteristics of OLC during differentiation. (a) Representative current–voltage curves at each stage recorded by a ramp voltage protocol from )90 to + 80 mV during application of glutamate and cyclothiazide (100 lM each). These curves were normalized by the identical voltage protocol in control solution. (b) Rectification ratios (R/R). (c) Reversal potentials (Erev). (d) Normalized peak outward currents. Data are means ± SEM. p < 0.05 compared to OP (/), IM (*) or MO (#). See text for details of each value.


398 T. Itoh et al.

Table 3 Capacitance of PP, OP, IM and MO measured during wholecell voltage-clamp recordings Capacitance (pF) PP OP IM MO

5.3 ± 0.8a,b,c (n ¼ 6) 12.1 ± 3.5b,c (n ¼ 35) 21.3 ± 12.3 (n ¼ 35) 24.2 ± 6.9 (n ¼ 12)

p < 0.05 compared to aOP, bIM or cMO. Data are means ± SD.

Erev of glutamate-evoked current became significantly more negative as OLC matured from OP to MO (Fig. 9c). The Erev for OP was )4.3 ± 9.3 mV (n ¼ 28), which is very close to the Erev for Ca2+-permeable AMPA-GluR (Geiger et al. 1995). The Erev for MO was significantly more negative than OP [) 34.2 ± 11.6 mV (n ¼ 23)], indicating that AMPA-GluR in MO are less Ca2+-permeable. The Erev for IM was intermediate between OP and MO [)19.4 ± 10.4 mV (n ¼ 17)], and was significantly different from both. During OLC ontogeny, cellular capacitance increased significantly from 5.3 ± 0.9 pF in PP to 24.2 ± 6.9 pF in MO (Table 3). This result correlated well with the morphological change described above (see Fig. 1). As OLC morphology changed from bi- and tripolar cells to highly branched cells during development, the cellular capacitance increase paralleled the increase in the plasma membrane area. We then calculated the normalized peak outward current (outward current at + 70 mV to Erev divided by capacitance) which represents a rough estimation of glutamate-evoked Ca2+ conductance per unit membrane area. Interestingly, these values were similar in OP and IM. In contrast, MO had significantly smaller values compared to both OP and IM (Fig. 9d). These electrophysiological data indicate that the sequence of Ca2+ conductance of AMPA-GluR in OLC was OP > IM > MO > PP, which was consistent with predicted Ca2+-permeability based on the ratio of GluR2 to GluR3 and GluR4 subunit proteins at each developmental stage. Given that the normalized peak outward currents were similar between OP and IM (Fig. 9d), and that IM had approximately twice as much plasma membrane surface area as OP, as estimated from the capacitance data (Table 3), it would be reasonable to assume that Ca2+-loading in IM was almost double that in OP. This could explain why IM showed a greater [Ca2+]i response to AMPA than OP in spite of less Ca2+-permeable AMPA-GluR in IM than in OP. Contribution of other mechanisms to [Ca2+]i response in OP and IM A remaining issue was why [Ca2+]i response to AMPA-GluR activation was stronger in IM than in OP, while biomolecular

Fig. 10 Fura-2 microfluorometric analysis of AMPA-induced [Ca2+]i responses in OP and IM. AMPA was applied to OP (a,b) and IM (c,d) as indicated by the bar at the concentration shown in the figure (lM). During the experiments, SRM was replaced with Ca2+-free medium (a,c) or 5 mM Na+ medium (b,d) as indicated. OP (e) and IM (f) were depolarized by 40 mM K+ SRM for 1 min (hatched bars), and subsequently exposed to AMPA (250 lM) for comparison (shown only in IM). (g) FCCP (10 lM) and caffeine (20 mM) in SRM were applied as indicated by the bars to the cells without preceding exposure to AMPA. Only traces of IM are shown, because similar results were obtained in both OP and IM. Each figure shows the traces of all single cells examined in a representative experiment from triplicate independent experiments, and is drawn to the same scale.

and electrophysiological analyses indicated that AMPAGluR were presumably not more Ca2+-permeable in IM than in OP. Further experiments were designed to examine the hypothesis that other mechanisms than Ca2+ influx directly though Ca2+-permeable AMPA-GluR might contribute to the discrepancy. As shown in Fig. 10(a) and 10(c), replacement of the extracellular medium with calcium-free solution completely abolished the [Ca2+]i response in both OP and IM. This result ruled out a contribution of Ca2+ release from intracellular calcium pools, except for calcium-induced



calcium release (CICR), to the response and confirmed absolute dependence on Ca2+ influx in both stages. In the same experiments, we also observed a similar difference in [Ca2+]i response at an unsaturated concentration of AMPA (25 lM) in OP and IM, suggesting that the partial activation of AMPA-GluR was sufficient to elicit enhanced [Ca2+]i responses in IM (Fig. 10a,c). Na+ gradient-dependent Ca2+ entry via voltage-gated calcium channels (VGCC) and/or the reverse operation of Na+-Ca2+ exchangers might heighten [Ca2+]i response in IM (Pende et al. 1994; Quednau et al. 1997). We tested the effect of 5 mM Na+ medium, which should minimize these routes of Na+-dependent Ca2+ entry. Application of 5 mM Na+ medium reduced the peak [Ca2+]i response to 67 ± 25% (n ¼ 89) and 64 ± 20% (n ¼ 88) of control values in OP and IM, respectively (Fig. 10b,d). These results indicated that some fractions of Ca2+ entry were mediated by Na+ gradient-dependent mechanisms, but that their contribution was not significantly different between OP and IM. The application of 40 mM K+ medium elicited a small [Ca2+]i elevation in both OP and IM, confirming the presence of VGCC at these stages. However, a contribution of VGCC to enhanced [Ca2+]i responses in IM was again unlikely, because peak [Ca2+]i by depolarization were even higher in OP than IM, and much lower compared to those by AMPA in IM (Fig. 10e,f). The protonophore, FCCP, induced similar gradual [Ca2+]i elevations in both OP and IM (only IM are shown, Fig. 10g), although FCCP presumably caused not only Ca2+ release from mitochondria but also depolarization of the plasma membrane in this experimental condition (Buckler and Vaughan-Jones 1998). Given that Ca2+ release from mitochondria did not entirely account for the FCCP-induced [Ca2+]i elevations, however, it was still noteworthy that the elevations were much slower in onset than those of AMPA-induced [Ca2+]i responses, and that the plateau levels were much lower than the peak values of AMPA-induced [Ca2+]i responses. Caffeine did not elicit appreciable [Ca2+]i elevations when applied alone (data not shown). Even when mitochondrial Ca2+ uptake was blocked by FCCP, we failed to detect Ca2+ release by further application of caffeine in both groups (only IM are shown, Fig. 10g). These results suggest that a change in Ca2+ release from mitochondria and caffeine-responsive Ca2+ reservoirs did not explain the enhanced [Ca2+]i responses to AMPA after differentiation from OP to IM. Discussion

The earliest stage of OLC in this study, pre-progenitor cells (PP), is distinguished by PSA-NCAM expression which precedes and partially overlaps with the expression of A2B5 or GD3 antigens. Our prior studies have shown that immunopan-purified PSA-NCAM+ cultures progress through the oligodendroglial lineage in the presence of PDGF (Grinspan and Franceschini 1995). Immunoblotting indicates

that the AMPA-GluR of PP are assembled mostly from GluR2. According to prior studies using recombinant GluR2, if only the edited version of GluR2 is expressed, agonistinduced current is extremely small without desensitization inhibitors and no Ca2+ current is observed (Boulter et al. 1990; Hollmann et al. 1991). Our fura-2FF microfluorometry revealed a poor [Ca2+]i response of PP even in the presence of the desensitization inhibitor cyclothiazide (Fig. 3), and was in good agreement with the assumption from these electrophysiological observations that almost all AMPAGluR in PP have more than one edited GluR2 subunit and are substantially Ca2+-impermeable (Fig. 9). This implies that ionotropic glutamatergic Ca2+ signaling is not a regulatory factor at this early stage of the oligodendroglial lineage. At the stage of OP, A2B5+ and O4) OLC, GluR3 and GluR4 expression was remarkably up-regulated, and the Ca2+ response to AMPA was robust. Our electrophysiological data also demonstrated that AMPA-GluR in OP are the most Ca2+permeable of the cells we studied. An AMPA-GluR is Ca2+impermeable when it contains at least one edited GluR2 (Geiger et al. 1995). In agreement with previous studies, our results confirmed that GluR2 expressed in OLC are almost 100% edited at the Q/R site (Puchalski et al. 1994; Itoh et al. 2000). It is therefore reasonable to hypothesize that a major part of this enhanced Ca2+ response was mediated by Ca2+ influx through Ca2+-permeable AMPA-GluR assembled from only GluR3 and/or GluR4, even though significant expression of GluR2 was also observed at this stage. Meucci et al. (1996) proposed such a ÔmosaicÕ distribution of both Ca2+-permeable and Ca2+-impermeable AMPA-GluR in the same glial cell. We confirmed that the presence of such AMPA-GluR assembled without GluR2 in OP and IM by demonstrating that 26% and 33% immunoreactivities for GluR3 and GluR4, respectively, still remained in the GluR2-immunoprecipitated Triton X-100-soluble fraction of OP (Fig. 6). Inhibition by JSTx-3 also agrees with this idea, because we observed stronger inhibitory effects of JSTx-3 on cells with higher peak values of AMPA-induced [Ca2+]i response (Fig. 4). OP, often called ÔO-2A cellsÕ, are generally bipolar and tripolar, motile, and rapidly proliferating depending on the availability of extracellular signal molecules such as PDGF and basic FGF (Raff et al. 1988; Bo¨gler et al. 1990). Gallo et al. (1996) reported that proliferation and lineage progression of O-2A cells was inhibited by activation of AMPAGluR. However, this inhibitory effect was reported to be independent of [Ca2+]i. The significance of AMPA-GluRmediated Ca2+ response at this stage remains to be elucidated. The presence of O4, a specific marker for pre-committed oligodendrocytes, and the absence of MBP are generally accepted criteria for IM (Back et al. 1998; Fern and Mo¨ller 2000). More than 80% of the population of our 2-day cultures in DM satisfied these immunocytological criteria and were positive for GalC as well (Pfeiffer et al. 1993). Another


400 T. Itoh et al.

difference between IM and OP is a distinct change in cellular shape. IM bear more than four initial processes with multiple branching, whereas OP have one to three processes with little branching. As shown in Fig. 1, nearly 100% of OLC showed the morphological change in our IM cultures. Our capacitance data also well represent this change. IM correspond to the population in vivo which have just reached their destination, and begun to differentiate to oligodendrocytes but not yet commenced myelination (Warrington and Pfeiffer 1992; Levison and Goldman 1993). Moreover, the immature OLC recently described in adult CNS tissues resemble IM, because they are also labeled with O4 antigen and NG2 chondroitin sulfate proteoglycan and have a highly branched morphology (Reynolds and Hardy 1997; Ong and Levine 1999). We observed the most robust Ca2+ response at this stage. While expression of GluR4 remained high, however, GluR3 expression in IM was less than that in OP. In agreement with the immunoblots, electrophysiological analysis revealed that Ca2+ conductance of AMPA-GluR was somewhat lower in IM than in OP (Fig. 9). Although we could not provide conclusive evidence of the mechanism(s) responsible for the discrepancy between relatively reduced Ca2+ conductance of AMPA-GluR and further enhanced Ca2+ response in IM, normalizing outward currents for capacitance suggested that total Ca2+ influx via AMPA-GluR per cell was higher in IM than in OP because of their larger surface area. In addition, the immunoprecipitations demonstrated the highest remaining signals of GluR3 and GluR4 in IM, despite the higher expression of GluR3 in OP than in IM. This finding suggests that GluR2 might preferentially be assembled with GluR3 in OLC. The PDZ domain-containing protein, GRIP, recognizes a specific motif found at the C-termini of both GluR2 and GluR3 but not GluR4, and serves as an adapter protein that links AMPA-GluR to other intracellular proteins (Dong et al. 1997). In unpublished studies, we have confirmed the presence of GRIP in OLC, which might facilitate the assembly of GluR2 and GluR3 into AMPA-GluR. If this is correct, then GluR4 may be more responsible for the assembly of Ca2+-permeable AMPAGluR than GluR3. Based on our data, it was unlikely that the enhanced Ca2+ response in IM resulted either from increased Na+-dependent Ca2+ entry via VGCC and/or Na+–Ca2+ exchangers, or from increased Ca2+ release at least from mitochondria and/or caffeine-responsive Ca2+ storage. Bergles et al. (2000) identified functional glutamatergic synapses between CA3 pyramidal neurons and branched process-bearing and NG2-positive OLC, which correspond to the stage of IM, and that signaling at these synapses elicits Ca2+ currents in the OLC. Our data strongly suggest that these IM Ca2+ currents are a consequence of activation of GluR2-free AMPA-GluR expressed by these cells. In recent studies, IM were also shown to be the most vulnerable stage to excitotoxicity and ischemic insult (McDonald et al. 1998; Fern and Mo¨ller 2000; Kavanaugh et al. 2000). It is quite

likely that these GluR2-free AMPA-GluR also accounts for the high vulnerability of IM to these insults. After differentiation from IM to MO, the latter identified by the appearance of MBP and more complex process morphology, we observed a remarkable reduction in Ca2+ response as well as in expression of GluR3 and GluR4. A significant decrease in Ca2+ conductance of AMPA-GluR at this stage was also revealed by electrophysiology. These results agree with the previous reports that MO are more resistant to excitotoxicity than immature OLC (McDonald et al. 1998; Kavanaugh et al. 2000). Oligodendrocytes may not require glutamatergic Ca2+ signaling after they establish the proper anatomical relations with neuronal elements and begin myelination. We also explored the composition of AMPA-GluR splicing variants in OLC. Expression of the flip form was dominant at all stages from OP to MO, and the expression of flop was reduced as the lineage progressed. This finding is consistent with the fact that cyclothiazide remarkably enhances AMPA-GluR-mediated Ca2+ response in OLC, because the desensitization of AMPA-GluR is blocked by cyclothiazide when it contains flip variant (Partin et al. 1994). Intriguingly, we also detected the expression of GluR2 long form (Ko¨hler et al. 1994), with a slight increase during differentiation. The significance of GluR2 long form in channel gating needs to be elucidated in future studies. Compared with the changes in the composition of GluR subunits, GluR-splicing patterns were fairly constant during the lineage progression, and thus are unlikely to contribute to the dramatic changes in Ca2+ response. Our study was performed with primary OLC cultures purified by immunopanning. Several prior studies have been conducted with passaged oligodendroglial cell lines such as CG4 (Louis et al. 1992). Although they retain phenotypic features resembling those of primary OLC, we have noted incomplete differentiation by such OLC lines, particularly after serial passaging (Itoh et al. 2000). We believe that the results from our purified primary OLC cultures are closer to actual events in vivo. In conclusion, this study is the first systematic analysis of AMPA-GluR-mediated Ca2+ response and expression of Ca2+-permeable AMPA-GluR during the development of OLC. AMPA-GluR-mediated Ca2+ signaling is developmentally enhanced by increased expression of GluR3 and GluR4 subunits at the time when OLC are most susceptible to AMPA-GluR-mediated excitotoxicity, and when they become ready to receive glutamatergic input from neurons. Acknowledgements The authors thank Mr Nuri Eraydin for technical assistance. This work was supported by the National Institute of Health Grant



NS25044 to DP, NS08075 to TI, NS34017 to JG and the National Institute of Health Training Grant T32-NS07413 to JB.

References Back S. A., Gan X., Li Y., Rosenberg P. A. and Volpe J. J. (1998) Maturation-dependent vulnerability of oligodendrocytes to oxidative stress-induced death caused by glutathione depletion. J. Neurosci. 18, 6241–6253. Barres B. A., Koroshetz W. J., Swartz K. J., Chun L. L. Y. and Corey D. P. (1990) Ion channel expression by white matter glia: the O-2A glial progenitor cell. Neuron 4, 507–524. Bergles D. E., Roberts J. D. B., Somogyl P. and Jahr C. E. (2000) Glutamatergic synapses on oligodendrocyte precursor cells in the hippocampus. Nature 405, 187–191. Blaschke M., Keller B. U., Rivosecchi R., Hollmann M., Heinemann S. and Konnerth A. (1993) A single amino acid determines the subunit-specific spider toxin block of a-amino-3-hydroxy-5-methylisoxazole-4-propionate/kainate receptor channels. Proc. Natl. Acad. Sci. USA 90, 6528–6532. Bo¨gler O., Wren D., Barnett S. C., Land H. and Noble M. (1990) Cooperation between two growth factors promotes extended selfrenewal and inhibits differentiation of oligodendrocyte-type-2 astrocyte (O-2A) progenitor cells. Proc. Natl. Acad. Sci. USA 87, 6368–6372. Borges K., Ohlemeyer C., Trotter J. and Kettenmann H. (1994) AMPA/ kainate receptor activation in murine oligodendrocyte precursor cells leads to activation of a cation conductance, calcium influx and blockade of delayed rectifying K+ channels. Neuroscience 63, 135– 149. Boulter J., Hollmann M., O’Shea-Greenfield A., Hartley M., Deneris E., Maron C. and Heinemann S. (1990) Molecular cloning and functional expression of Glutamate receptor subunit genes. Science 249, 1033–1037. Buckler K. J. and Vaughan-Jones R. D. (1998) Effects of mitochondrial uncouplers on intracellular calcium, pH and membrane potential in rat carotid body type I cells. J. Physiol. 513, 819–833. Chomczynski P. and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Dong H., O’Brien R. J., Fung E. T., Lanahan A. A., Worley P. F. and Huganir R. L. (1997) GRIP: a synaptic PDZ domain-containing protein that interacts with AMPA receptors. Nature 386, 279–284. Fern R. and Mo¨ller T. (2000) Rapid ischemic cell death in immature oligodendrocytes: a fatal glutamate release feedback loop. J. Neurosci. 20, 34–42. Follett P. L., Rosenberg P. A., Volpe J. J. and Jensen F. E. (2000) NBQX attenuates excitotoxic injury in developing white matter. J. Neurosci. 20, 9235–9241. Gallo V., Upson L. M., Hayes W. P., Vyklicky L. Jr, Winters C. A. and Buonanno A. (1992) Molecular cloning and development analysis of a new glutamate receptor subunit isoform in cerebellum. J. Neurosci. 12, 1010–1023. Gallo V., Zhou J. M., McBain C. J., Wright P., Knutson P. L. and Armstrong R. C. (1996) Oligodendrocyte progenitor cell proliferation and lineage progression are regulated by glutamate receptormediated K+ channel block. J. Neurosci. 16, 2659–2670. Geiger J. R. P., Melcher T., Koh D.-S., Sakmann B., Seeburg P. H., Jonas P. and Monyer H. (1995) Relative abundance of subunit mRNAs determines gating and Ca2+ permeability of AMPA receptors in principal neurons and interneurons in rat CNS. Neuron 15, 193–204.

Grinspan J. B. and Franceschini B. (1995) Platelet-derived growth factor is a survival factor for PSA-NCAM+ oligodendrocyte pre-progenitor cells. J. Neurosci. Res. 41, 540–551. Grynkiewicz G., Poenie M. and Tsien R. Y. (1985) A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 260, 3440–3450. Hardy R. and Reynolds R. (1991) Proliferation and differentiation potential of rat forebrain oligodendroglial progenitors both in vitro and in vivo. Development 111, 1061–1080. Hollmann M., Hartley M. and Heinemann S. (1991) Ca2+ permeability of KA-AMPA-gated glutamate receptor channels depends on subunit composition. Science 252, 851–853. Holtzclaw L. A., Gallo V. and Russell J. T. (1995) AMPA receptor shape Ca2+ responses in cortical oligodendrocyte progenitors and CG-4 cells. J. Neurosci. Res. 42, 124–130. Itoh T., Niwa H., Nagamatsu M., Mitsuma T., Miyakawa A., Pleasure D. and Sobue G. (1998) Nerve growth factor maintains regulation of intracellular calcium in neonatal sympathetic neurons but not in mature or aged neurons. Neuroscience 82, 641–651. Itoh T., Reddy U. R., Stern J. L., Chen M., Itoh A. and Pleasure D. (2000) Diminished calcium homeostasis and increased susceptibility to excitotoxicity of JS 3/16 progenitor cells after differentiation to oligodendroglia. Glia 31, 165–180. Kamboj S. K., Swanson G. T. and Cull-Candy S. G. (1995) Intracellular spermine confers rectification on rat calcium-permeable AMPA and kainate receptors. J. Physiol. 486, 297–303. Kavanaugh B., Beesley J., Itoh T., Itoh A., Grinspan J. and Pleasure D. (2000) Neurotrophin-3 (NT-3) diminishes susceptibility of the oligodendroglial lineage to AMPA glutamate receptor-mediated excitotoxicity. J. Neurosci. Res. 60, 725–732. Ko¨hler M., Kornau H.-C. and Seeburg P. H. (1994) The organization of the gene for the functionally dominant a-amino-3-hydroxy-5methyl-isoxazole-4-propionic acid receptor subunit GluR-B. J. Biol. Chem. 269, 17367–17370. Levison S. W. and Goldman J. E. (1993) Both oligodendrocytes and astrocytes develop from progenitors in the subventricular zone of postnatal rat forebrain. Neuron 10, 201–212. Li S. and Stys P. K. (2000) Mechanisms of ionotropic glutamate receptor-mediated excitotoxicity in isolated spinal cord white matter. J. Neurosci. 20, 1190–1198. Louis J. C., Magal E., Muir D., Manthorpe M. and Varon S. (1992) CG-4, a new bipotential glial cell line from rat brain, is capable of differentiating in vitro into either mature oligodendrocytes or type-2 astrocytes. J. Neurosci. Res. 31, 193–204. Matute C., Alberdi E., Domercq M., Perez-Cerda F., Perez-Samartin A. and Sanchez-Gomez M. V. (2001) The link between excitotoxic oligodendroglial death and demyelinating diseases. Trends. Neurosci. 24, 224–230. McDonald J. W., Levine J. M. and Qu Y. (1998) Multiple classes of the oligodendrocyte lineage are highly vulnerable to excitotoxicity. Neuroreport 9, 2757–2762. Meucci O., Fatatis A., Hotzwarth J. A. and Miller R. J. (1996) Developmental regulation of the toxin sensitivity of Ca2+-permeable AMPA receptors in cortical glia. J. Neurosci. 16, 519–530. Ong W. Y. and Levine J. M. (1999) A light and electron microscopic study of NG2 chondroitin sulfate proteoglycan-positive oligodendrocyte precursor cells in the normal and kainate-lesioned rat hippocampus. Neuroscience 92, 83–95. Partin K. M., Patneau D. K. and Mayer M. L. (1994) Cyclothiazide differentially modulates desensitization of a-amino-3-hydroxy-5methyl-4-isoxazolepropionic acid receptor splice variants. Mol. Pharmacol. 46, 129–138.


402 T. Itoh et al.

Patneau D. K., Wright P. W., Winters C., Mayer M. L. and Gallo V. (1994) Glial cells of the oligodendrocyte lineage express both kainate- and AMPA-preferring subtypes of glutamate receptor. Neuron 12, 357–371. Pende M., Holtzclaw L. A., Curtis J. L., Russell J. T. and Gallo V. (1994) Glutamate regulates intracellular calcium and gene expression in oligodendrocyte progenitors through the activation of DL-aamino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors. Proc. Natl. Acad. Sci. USA 91, 3215–3219. Pfeiffer S. E., Warrington A. E. and Bansal R. (1993) The oligodendrocyte and its many cellular processes. Trends Cell. Biol. 3, 191–197. Pitt D., Werner P. and Raine C. S. (2000) Glutamate excitotoxicity in a model of multiple sclerosis. Nat. Med. 6, 67–70. Puchalski R. B., Louis J.-C., Brose N., Traynelis S. F., Egebjerg J., Kukekov V., Wenthold R. J., Rogers S. W., Lin R., Moran T., Morrison J. H. and Heinemann S. F. (1994) Selective RNA editing and subunit assembly of native glutamate receptors. Neuron 13, 131–147. Quednau B. D., Nicoll D. A. and Philipson K. D. (1997) Tissue specificity and alternative splicing of the Na/Ca exchanger isoforms NCX1, NCX2, and NCX3 in rat. Am. J. Physiol. 272, C1250–C1261. Raff M. C., Lillien L. E., Richardson W. D., Burne J. F. and Noble M. D. (1988) Platelet-derived growth factor from astrocytes derives the clock that times oligodendrocyte development in culture. Nature 333, 562–565. Raff M. C., Miller R. H. and Noble M. (1983) A glial progenitor cell that develops in vitro into an astrocyte or an oligodendrocyte depending on culture medium. Nature 303, 390–396.

Reynolds R. and Hardy R. (1997) Oligodendroglial progenitors labeled with the O4 antibody persist in the adult rat cerebral cortex in vivo. J. Neurosci. Res. 47, 455–470. Sommer B., Keina¨nen K., Verdoorn T. A., Wisden W., Burnashev N., Herb A., Ko¨hler M., Takagi T., Sakmann B. and Seeburg P. H. (1990) Flip and flop: a cell-specific functional switch in glutamateoperated channels of the CNS. Science 249, 1580–1585. Sommer I. and Schachner M. (1981) Monoclonal antibodies (O1 to O4) to oligodendrocyte cell surfaces: an immunocytological study in the central nervous system. Dev. Biol. 83, 311–327. Sontheimer H., Trotter J., Schachner M. and Kettenmann H. (1989) Channel expression correlates with differentiation stage during the development of oligodendrocytes from their precursor cells in culture. Neuron 2, 1135–1145. Tekkok S. B. and Goldberg M. P. (2001) AMPA/kainate receptor activation mediates hypoxic oligodendrocyte death and axonal injury in cerebral white matter. J. Neurosci. 21, 4237–4248. Verkhratsky A. and Kettenmann H. (1996) Calcium signaling in glial cells. Trends Neurosci. 19, 346–352. Warrington A. E. and Pfeiffer S. E. (1992) Proliferation and differentiation of O4+ oligodendrocytes in postnatal rat cerebellum: Analysis in unfixed tissue slices using anti-glycolipid antibodies. J. Neurosci. Res. 33, 338–353. Wenthold R. J., Petralia R. S., Blahos I. I. J. and Niedzielski A. S. (1996) Evidence for multiple AMPA receptor complexes in hippocampal CA1/CA2 neurons. J. Neurosci. 16, 1982–1989.
