amplified mitochondrial DNA - Europe PMC

Proc. Nati. Acad. Sci. USA Vol. 88, pp. 4548-4552, May 1991 Population Biology

Distinguishing African and European honeybee matrilines using amplified mitochondrial DNA (polymerase chain reaction/restriction fragment length polymorphism/maternal gene flow)

H. GLENN HALL*

AND

DEBORAH R. SMITHt

*Department of Entomology and Nematology, 0740 Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL 32611; and

tMuseum of Zoology, Insect Division and Laboratory for Molecular Systematics, University of Michigan, Ann Arbor, MI 48109

Communicated by Charles D. Michener, February 19, 1991 (received for review December 14, 1990)

feral African population represents hybrids with European bees has not been well documented and remains controversial. Resolution of questions surrounding the African bee has been hindered by a paucity of genetic markers that can distinguish the honeybee subspecies (see discussion in refs. 13 and 14). Subtle morphometric traits are primarily used to identify African bees (15) and have been claimed as evidence for some African-European hybridization (16). However, the morphometric parameters are subject to environmental effects, and their genetic basis is undefined (17). African bee introgression has been followed with some of the few allozymes available that show significant frequency differences among honeybee subspecies (18, 19). Recently, DNA polymorphisms have been effective in revealing processes involved in African bee spread. Two independent studies using mitochondrial DNA (mtDNA) demonstrated that the feral neotropical African population is comprised of unbroken African maternal lineages spreading as swarms (19, 20). Findings with nuclear DNA markers point to asymmetric paternal gene flow in favor of the African genotype (21). Feral African matrilines exhibit little hybridization with European drones, whereas European matrilines become strongly Africanized by mating with feral African drones. Despite such Africanization, the maternal contribution from European apiaries to the expanding feral population has been negligible (19-21). These findings have contradicted views that paternal introgression is primarily responsible for African bee spread and that the neotropical population represents a "hybrid swarm" (22, 23). The temporal sequence of introgression and establishment of the African population needs to be systematically studied, and a more complete view of African-European hybridization in different regions needs to be established. As African bees approach temperate environments of the United States, believed to be of greater advantage to European bees, a hybrid zone between the two may be formed (5-7). DNA analyses will be increasingly needed to follow African paternal and maternal gene flow, to determine genotype frequencies, and to recognize linkage disequilibrium patterns. Such information may reveal the nature of selective processes (24). DNA markers will also be needed for control measures: to reliably identify African bees and to certify European stock (13, 14, 25). Standard DNA restriction fragment analyses are not suited for rapid testing of large numbers of samples, but new technical advances greatly facilitate such analyses. With the asymmetries observed in levels of hybridization between African and European matrilines, use of nuclear and mtDNA together will continue to be important, and simplification of the tests for both is needed. In realizing part of that goal, we have employed the polymerase chain reaction (PCR) (26) for more rapid identification of subspecies-specific mtDNA.

Previous DNA studies have revealed that ABSTRACT feral neotropical African bees have largely retained an African genetic integrity. Additional DNA testing is needed to confirm these findings, to understand the processes responsible, and to follow African bee spread into the temperate United States. To facilitate surveys, the polymerase chain reaction was utilized. African and European honeybee mitochondrial DNA (mtDNA) was identified through ampled segments that carry informative restriction site and length polymorphisms. The ability to discriminate among honeybee subspecies was established by testing a total of 129 colonies from Africa and Europe. Matriline identities could thus be determined for imported New World bees. Among 41 managed and feral colonies in the United States and north Mexico, two European lineages (west and east) were distinguished. From neotropical regions, 72 feral colonies had African mtDNA and 4 had European mtDNA. The results support earlier conclusions that neotropical African bees have spread as unbroken African maternal lineages. Old and New World African honeybee populations exhibit different frequencies of a mtDNA length polymorphism. Through standard analyses, a north African mtDNA type that may have been imported previously from Spain or Portugal was not detected among neotropical African bees.

Since their introduction from South Africa to Brazil 34 years ago (1), African honeybees (Apis mellifera scutellata; ref. 2) have spread through most of tropical America (3) and have recently moved into Texas. Over the next several years, the bees are expected to colonize the southern United States (4-6). Because of their defensive stinging and other undesirable characteristics, African bees will adversely affect the United States beekeeping industry. Consequently, considerable economic damage is expected to segments of agriculture dependent upon commercial honeybee pollination (6-8). The processes by which African bees have come to dominate in the neotropics are poorly understood, but their success apparently reflects phenomenal differences in ecological adaptation among honeybee subspecies (7, 9). A number of European races, Apis mellifera mellifera, iberica, ligustica, carnica, caucasia (2), have been repeatedly introduced to the Americas (10-12). Early Spanish and Portuguese settlers may have also brought Apis mellifera intermissa that had introgressed from north Africa into the Iberian peninsula. Swarms that escaped from the imported European colonies established feral populations in temperate regions. However, self-sustaining feral honeybee populations were established in the neotropics only after the introduction and spread of the African A. m. scutellata. The European bees in neotropical apiaries have been largely replaced by Africanized progeny resulting from paternal introgression from feral African colonies (3, 4, 6). However, the extent to which the The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Abbreviations: IsRNA, large ribosomal; CO, cytochrome c oxidase.

4548

Population Biology: Hall and Smith

Proc. Natl. Acad. Sci. USA 88 (1991)

mtDNA restriction site and length polymorphisms identify three lineages of honeybee subspecies: an east European group including A. m. ligustica, carnica, and caucasia, a west European group consisting of A. m. mellifera and iberica with mellifera-like mtDNA (predominantly from northern Spain), and an African group including South African A. m. scutellata and A. m. capensis and north African intermissa and iberica with intermissa-like mtDNA (predominantly from southern Spain) (19, 20, 27-30). An EcoRI site in the large ribosomal (lsRNA) subunit gene and an Xba I site in the cytochrome c oxidase I (CO-I) subunit gene are found only in bees of the east European group, and a HincII site in the CO-I subunit gene is found only in bees of the west European group. Length polymorphisms between the CO-I and CO-II subunit genes are found in the mtDNA of west European and African bees. The EcoRI polymorphism in the lsRNA subunit gene was among several others used in the two previous studies of neotropical bees (19, 20). This report presents information, obtained by the PCR and by standard methods, about the mtDNA composition of several Old and New World honeybee populations. The data provide significant additional evidence that the neotropical African population is derived from unbroken A. m. scutellata matrilines.

METHODS AND MATERUILS As a source of mtDNA template for the PCR, total DNA was prepared from larvae, pupae, or adults as described (21). The adult preparations required treatment with pancreatic RNase (0.1 x volume of a 10 mg/ml stock) to allow PCR amplification. Linear cellular DNA (nuclear DNA, nicked and linearized mtDNA) was also obtained from adults by another procedure (27-29). Analysis of restriction fragment polymorphisms in isolated mtDNA was as described (27-29).

4549

Two regions of the east European honeybee mitochondrial genome have been sequenced: the lsRNA subunit gene (31) and the CO-I and CO-II subunit genes including several flanking tRNA genes and the intervening leucine tRNA gene (32). From the sequenced regions, oligonucleotide primers were synthesized (by the University of Florida Interdisciplinary Center for Biotechnology Research core facility) that enabled amplification of three polymorphic segments through the PCR. Fig. 1 shows the primers and locations of the informative restriction sites. The PCR was performed as described (26) except that reaction volumes were 25 ,ul and Taq polymerase (BRL) was at 2x concentration (1 unit). About 1 ,ug of total cellular DNA in 2 A1l was added to the reaction mixture. The reaction profile was 95°C for 1 min, followed by 35 cycles of 94°C for 1 min, 50°C for 2 min, 72°C for 3 min, and a final 72°C for 20 min using an MJ Research (Cambridge, MA) thermal controller. Ten-microliter aliquots of PCR mixture were digested with either EcoRI, HincII, orXba I (BRL). Taking the PCR buffer into consideration, an equal volume of solution was added consisting of 1 x the recommended buffer for the respective enzymes, an additional 50 mM NaCl (only for EcoRI) and 10 mM MgCI2, and 25 ,ug of bovine serum albumin, 2 mM dithiothreitol, and 3-5 units of enzyme. The total digestion volume was loaded into 2.5% agarose gels, electrophoresed with TAE buffer under standard conditions, and stained with ethidium bromide (33).

RESULTS AND DISCUSSION With the PCR method, testing of many samples was greatly facilitated, and the mtDNA composition of several Old and New World populations was determined. These data are summarized in Table 1. Fig. 2 shows the polymorphic fragment patterns from Old World samples, which clearly discriminate among the east European, west European, and

FIG. 1. Diagrams of three regions of honeybee mtDNA amplified by PCR showing the primers used, their orientation, and the positions of the Large Ribosomal Subunit informative restriction sites (5' -+ 3'). 850 Sequences for the lsRNA subunit (31) 595 113 13 and for the CO-I and CO-II subunits 5' TFITGTACC1TITGTATCAGGGTTG 3. GAATTC .............. 3' CCCTGCTATTCTGGG/ kTATC 5' (32) came from east European mtDNA. The numbered positions 251 above the sequences correspond to Eco RI those in the original sequence data. Uncut size = 738 Below the sequences are given the amplified segment sizes (in base pairs) and the double-stranded fragCytochrome C Oxidase Subunit l ment sizes resulting from restriction 1415 enzyme cleavage. In the lsRNA re1146 372 gion, the EcoRI site is present only in east European bees and is part of the ACGT 5' 3' GTTATCCACGTCATAAj 5' TTMGATCCCCAGGATCATG 3'................... GTT GAT known sequence. In the CO-I region, GTPyPuAC 777 267 | the HincIlI site is present only in west European bees; its location was Hinc II Uncut size = 1044 mapped by standard restriction fragment analysis (29). The corresponding site in east European bees differs Inter- Cytochrome C Oxidase Subunits I and ll by one nucleotide from the HincII site. In the recognition 2401 2401 CO-II amplified region, inter-CO-I/ 1748 1554 within the CO-I gene, an Xba I site is present T 3' CCAGTAGTTACTATAA(CTAG 5 only in east European races and is 5' TCTATACCACGACGTTATTC 3'..................... TCTAGA. part of the known sequence. All west 649 195 1 European and African bees lack this Xba I site and carry one of several inserts 848 Uncut size = that increase the length of this ampliinsert size = -70 -918 with inserts = fied segment (located between the po-270 -1118 sition of the Xba I site and the right -540 -1388 -810 -1658 side primer as indicated by arrow). 483

......

4

4550


Population Biology: Hall and Smith

Table 1. Summary of honeybee colonies tested and mtDNA types determined by polymorphisms in the amplified regions mtDNA type East nTotaol African West European Location Old World Italy Austria, Yugoslavia Russia France, Denmark, Norway, Sweden Spain

South Africa New World United States and northern Mexico*

Subspecies A. A. A. A. A. A. A. A.

m. m. m. m. m. m. m. m.

ligustica carnica caucasia mellifera iberica/mellifera iberica/intermissa scutellata capensis

Managed Feral

colonies

European

18 14 2 11 17 11 52 4

18 14 2

30t

28 4 3

11

70

270

540

1 1

9 13

1 3

1 3 1

70

270

540

810

8 9 1

3 35 3

6

2

1 4

5 17 32 58t Central and southern Mexico 1 9 1 11 Honduras 3 3 6 Costa Rica 8 11 19 Venezuela in the text. The summarized polymorphisms site restriction by the are distinguished groups and African west European, The east European, west European and African groups are further separated according to the inter-CO-I/CO-II length polymorphisms (given in base pairs). All central and southern Mexican samples were feral swarms sampled within a few weeks of their capture. All Central and South American samples came from managed colonies established from swarms 2-6 months before sampling. *Just south of the Texas border, still unoccupied by African bees. tTwenty were from a closed breeding population tested previously (20). tEighteen were feral swarms tested previously (20). 1 2 3 4 5 6 7 8 9 10

African subspecies. Fig. 3 shows the characteristic polymorphisms among New World samples, which identify their maternal ancestry, most importantly, as African or European. The inter-CO-I/CO-Il length polymorphisms are seen in the amplified DNA as well as in restriction digests of the entire mtDNA molecule (Fig. 4 shows a Bc! I digest). In west European and African subspecies, this region is approximately 70, 270, 540, or 810 bp larger than the corresponding region of east European bees. The 70-bp and 810-bp insert sizes were recognized or discovered in this study. Different frequencies of the length classes were found among populations (Table 1). In west European A. m. mellifera and iberica/mellifera, the 270-bp insert was most common, and the 70-bp insert was rare. In the Spanish A. m. iberical intermissa the 70-bp insert was most common, but the 11 III. (A) The 738-base-pair (bp) amplified region, within the lsRNA subunit gene, digested with EcoRI. Only the two east European types in lanes 1 and 2 are cleaved, yielding a 483-bp and a 251-bp fragment. (B) The 1044-bp amplified region, within the CO-I subunit gene, digested with HincII. Only the two west European types in lanes 5 and 6 are cleaved, yielding a 777-bp and a 267-bp fragment. (C) The inter-CO-I/CO-Il amplified region showing length polymorphisms.

FIG. 2. Samples of mtDNA from Old World honeybee subspecies amplified by PCR and digested with discriminating restriction enzymes. Lane 1, A. m. ligustica from Italy; lane 2, A. m. caucasia from Russia; lanes 3 and 4, A. m. iberica/intermissa from southern Spain; lanes 5 and 6, A. m. mellifera from France; lanes 7-10, A. m. scutellata from South Africa. The same colony samples are in each panel. Size standards in outer lanes: phage 4X174 digested with Hae

The east European types in lanes 1 and 2 have the shortest segment (848 bp) lacking inserts. The amplified segments from the A. m. iberica/intermissa samples in lanes 3 and 4 are approximately 70 bp larger (918 bp total). The west European samples in lanes 5 and 6 have amplified segments of about 1118 bp and 1388 bp, respectively (270-bp and 540-bp inserts). The South African samples in lanes 7-10 have amplified segments of about 918 bp, 1118 bp, 1388 bp, and 1658 bp, respectively (insert sizes of 70 bp, 270 bp, 510 bp, and 810 bp). The amount of the amplified product is reduced as the insert size increases. (D) The inter-CO-I/CO-Il amplified region digested with Xba I. Only the 848-bp segment of the two east European types in lanes 1 and 2 is cleaved, yielding a 195-bp and a 649-bp fiagment. In samples carrying the larger inserts within the inter-CO-I/CO-Il region, faint bands correspond to the smaller fragments found in other size classes. The cause of this is not certain, but it is not due to cross-contamination. The different size classes probably arise from tandem duplications that are suspected to cause an artifact in the PCR. Uncompleted fragments generated in the reaction could reanneal at the tandem sequences, eliminating one or more of the duplications. These would serve as primers to form shorter products that, in turn, would function as templates in subsequent cycles.

Population Biology: Hall and Smith 1 2 3 4 5 6 7 8 9 10


4551

12 3 4

FIG. 4. End-labeled Bcl I digests of honeybee mtDNA showing four size classes. Lane 1, A. * ~m. scutellata with additional 540 *e bp relative to A. m. ligustica (lane 4); lane 2, A. m. scutellata with additional 270 bp; lane 3, A. m. scutellata with additional 70 bp; lane 4, A. m. ligustica with smallest size class with no inserts. Size standard: A bacteriophage digested with HindlIll; 1% agarose

gel.

Among United States colonies, the east European mtDNA type was predominant, which reflected the preferred use of Italian and Carniolan bees (A. m. ligustica and carnica) for commercial beekeeping (10-12). The first honeybees brought

FIG. 3. mtDNA of New World honeybees identified using PCR and diagnostic restriction and length polymorphisms as described in the legend to Fig. 2. Lanes 1-5, managed colonies from Tucson, Arizona (United States). Lanes 6-10, colonies established from feral swarms in Honduras. The same colony samples are in each panel. The sizes of the fragments are given in Figs. 1 and 2. Size standards in outer lanes: phage 4X174 digested with Hae III. (A) Amplified region, within lsRNA subunit gene, digested with EcoRI. This region from United States samples in lanes 1, 2, and 5 is cleaved, characteristic of east European subspecies. (B) Amplified region, within CO-I subunit gene, digested with HincII. This region from United States samples in lanes 3 and 4 is cleaved, characteristic of west European subspecies. (C) Inter-CO-I/CO-II amplified region showing length polymorphisms. The United States samples in lanes 1, 2, and 5 have the shortest segment, lacking inserts, characteristic of east European subspecies. The United States samples in lanes 3 and 4 and the Honduran samples in lanes 8 and 9 carry 270-bp or 540-bp inserts. The Honduran samples in lanes 6, 7, and 10 carry 70-bp inserts (compare slight shift in size between lanes S and 6). The length polymorphisms are characteristic of west European and African subspecies, but their mtDNA is distinguished by the HincIl site in the CO-I region (B). (D) Inter-CO-I/CO-II amplified region digested with Xba I. This region in United States samples in lanes 1, 2, and 5 is cleaved, characteristic of east European subspecies.

colonies tested were not a sufficient number to draw strong conclusions about the mtDNA class frequencies. Among South African A. m. scutellata (obtained from five widely separated locations in the Transvaal) and A. m. capensis, the short 70-bp class was found in 18% of the colonies (n = 56). However, among neotropical African colonies, which had been imported from South Africa, the 70-bp class was found in 62% of the colonies (n = 90). The discrepancy may reflect drift due to a founder effect or population expansion. To establish the frequency of the mtDNA length polymorphisms among neotropical African colonies, feral Mexican swarms tested previously (20) were included in the PCR screening.

to the Americas by early European settlers were of the west European group (10-12), and persisting mtDNA of this type was found in a minor proportion of managed colonies. Interestingly, west European mtDNA was found in a greater proportion of feral colonies (7 of 11 colonies from Arizona and northern Mexico tested here by the PCR method and 10 of 12 colonies from Arizona tested by standard restriction fragment analysis; D.R.S. and 0. R. Taylor, unpublished results). The results obtained by PCR identification of neotropical honeybee mtDNA further strengthen the conclusions of the earlier studies: African honeybees have migrated as unbroken maternal lineages and there has been little European maternal gene flow into the feral African population (19, 20). An additional 76 neotropical colonies were analyzed, almost as many as in both previous studies together (85 colonies). These included later collections at the same locations (Venezuela and Tapachula and Las Choapas, Mexico) and at several additional locations (within Costa Rica, Honduras, and near Veracruz, Mexico). Of the new samples, only four were found to carry European mtDNA (three with the east type and one with the west type). All came from near Veracruz, in east-central Mexico, within 14 months after African bees first moved into the area. At the time the samples were collected, this region still supported large populations of managed European bees. European mtDNA was not found in the more established African honeybee populations. Honeybees of the Iberian peninsula (A. m. iberica) carry one of two mtDNA types: those of A. m. mellifera and A. m. intermissa, the latter apparently due to infiltration from north Africa (30). Therefore, the African mtDNA present in neotropical populations could include A. m. iberica/intermissa mtDNA imported previously by early Spanish and Portuguese colonists. The amplified regions of the mitochondrial genome do not contain known polymorphisms that distinguish the A. m. iberica/intermissa mtDNA from that of A. m. scutellata. However, an unmapped polymorphic Hinfl fragment does distinguish between the two (30). Of 38 Mexican, 10 Venezuelan, and 9 Brazilian colonies with African

mtDNA, all had the scutellata type, not the intermissa type (some shown in Fig. 5). Thus, it appears unlikely that a colony, identified as neotropical African on the basis of the polymorphisms utilized here, would have come from an early

4552

i|..:t*i.1

Population Biology: Hall and Smith -1

2 3 4 5

2

B

lot-*,t. t;,

't

.:3 4

5

.-::

i

.

Proc. Nad. Acad Sci. USA 88 (1991) 91 01 ; . c .3 I 4..57

6

-.0

l

a

.

t .0 0,

.f

in1.

Ifl.F"

..:

.

,I

::

&v ;1.g

.4

:*

:1 s ;.:

t

i ij

E ;',,

| i,32

r

* e A

l|'i

l *e

i

I

4

.:.'

M.

i*,

z.l

introduction of intermissa and not from the more recent introduction of scutellata. Nevertheless, it would be remarkable if, after scutellata invasion, the more closely related intermissa were found to be the only previously imported mtDNA to persist to any significant extent. Making the distinguishing Hinfl site testable by the more rapid PCR would increase the likelihood of finding rare persisting intermissa mtDNA in the Americas, if it exists. As the remainder of the mitochondrial sequence is determined and the other distinguishing polymorphisms are mapped, these will become incorporated into the PCR protocol. Other investigators have recently amplified another honeybee mtDNA region (34) carrying the polymorphic Bgl II site used in one of the previous studies of neotropical bees (20). The PCR identification of mtDNA will enable regulatory efforts to be most effective by concentrating on African maternal lineages that serve as the source offeral populations. Nuclear markers made analyzable by PCR in the future will facilitate the identification of Africanized bees, that is, the progeny of paternal introgression. Mitochondria and various nuclear markers, subject to interactions and different selective influences, may reveal independent or coordinated introgressive behavior into temperate climates. PCR identification of specific nuclear DNA alleles, along with that of mtDNA, would greatly enhance the ability to recognize and study such processes.

We thank the beekeepers of the United States, Europe, and South Africa, who allowed us to collect from their apiaries, and the following, who helped provide honeybee samples: R. Crewe, G. Pretorius, B. Buys (South Africa), B. Vaissiere, J.-M. Cornuet (France), A. Quero, F. Padilla, F. Puerta (Spain), G. Zuccoli, M. Vecchi, G. Serini (Italy), F. Ruttner, H. Pechhacker (Austria), N. Koeniger, G. Koeniger (Germany), A. Hagen (Norway), I. Fries, T. Kronestedt (Sweden), S. Toft, B. Stoklund (Denmark), F. Brizuela, J. A. Gutierrez (Mexico), H. Arce (Costa Rica), A. Suazo (Honduras), 0. Taylor, M. Spivak, W. Van der Put, J. Villa, R. Hellmich, T. Rinderer, G. Waller, E. Erickson, A. Collins, W. Rubink (United States), and members of Secretarfa de Agricultura y Recursos Hidradlicos (Mexico). We are particularly grateful to 0. R. Taylor and W. M. Brown for continued generous assistance. This work was supported by a United States Department of Agriculture Competitive Research Grant and a gift from the Florida State Beekeepers Association to H.G.H. and a National Science Foundation Grant to D.R.S. This paper is Florida Agricultural Experiment Station Journal Ser. No. R-00960. 1.

Kerr, W. E. (1967) S. Afr. Bee J. 39, 3-5.

.

FIG. 5. End-labeled Hinfl digests of honeybee mtDNA. (A) Old World samples. Lane 1, A. m. mell#era; lane 2, A. m. ligustica; lane 3, A. m. carnica; lane 4, A. m. iberica with intermissa-like mtDNA; lane 5, A. m. scutellata. (B) Neotropical African bees from Mexico and Venezuela (lanes , : *1-13) compared with A. m. iberica with intermissa-like mtDNA Qane 14) and A. m. scutellata (ane 15). s sE ~Note that, in the samples in A and B, the A. m. scutellata have a fragment not present in A. m. intermissa (arrowheads). The neo.< tropical African samples also have this fragment. Size standard: A bacteriophage digested with s ~~~HindIII. 2. Ruttner, F. (1988) Biogeography and Taxonomy ofHoney Bees (Springer,

Berlin). 3. Michener, C. D. (1975) Annu. Rev. Entomol. 2S, 399-416.

4. Taylor, 0. R. (1977) Bee World 58, 19-30. 5. Taylor, 0. R. & Spivak, M. (1984) Bee World 65, 38-47. 6. Taylor, 0. R. (1985) Bull. Entomol. Soc. Am. 31, 14-24. 7. Taylor, 0. R. (1968) in Africanized Honey Bees and Bee Mites, eds. Needham, G. R., Page, R. E., Deffinado-Baker, M. & Bowman, C. E. (Horwood, Chichester, U.K.), pp. 29-41. 8. McDowell, R. (1984) The Africanized Honey Bee in the United States: What Will Happen to the U.S. Beekeeping Industry? (U.S. Dept. of Agric., Washington), Agric. Econ. Rep. No. 519. 9. Rinderer, T. E. (1988) in Africanized Honey Bees and Bee Mites, eds. Needham, G. R., Page, R. E., Delfinado-Baker, M. & Bowman, C. E. (Horwood, Chichester, U.K.), pp. 13-28. 10. Pellett, F. C. (1938) History of American Beekeeping (Collegiate, Ames, IA). 11. Oertel, E. (1976) Am. Bee J. 116, 70, 71, 114, 128, 156, 157, 214, 215, 260, 261, 290. 12. Sheppard, W. S. (1989) Am. Bee J. 129, 617-619, 664-667. 13. Hall, H. G. (1986) Proc. Natl. Acad. Sci. USA 83, 4874-4877. 14. Hall, H. G. (1988) in Africanized Honey Bees and Bee Mites, eds. Needham, G. R., Page, R. E., Delfinado-Baker, M. & Bowman, C. E. (Horwood, Chichester, U.K.), pp. 287-293. 15. Daly, H. V. & Balling, S. S. (1978) J. Kan. Entomol. Soc. 51, 857-869. 16. Buco, S. M., Rinderer, T. E., Sylvester, H. A., Collins, A. M., Lancaster, V. A. & Crewe, R. M. (1987) Apidologie 18, 217-222. 17. Daly, H. V. (1988) in Africanized Honey Bees and Bee Mites, eds. Needham, G. R., Page, R. E., Delfmado-Baker, M. & Bowman, C. E. (Horwood, Chichester, U.K.), pp. 245-249. 18. Lobo, J. A., Del Lama, M. A. & Mestriner, M. A. (1989) Evolution 43, 794-802. 19. Smith, D. R., Taylor, 0. R. & Brown, W. M. (1989) Nature (London) 339, 213-215. 20. Hall, H. G. & Muralidharan, K. (1989) Nature (London) 339, 211-213. 21. Hall, H. G. (1990) Genetics 125, 611-621. 22. Rinderer, T. E., Hellmich, R. L., Danka, R. G. & Collins, A. M. (1985) Science 228, 1119-1121. 23. Rinderer, T. E. (1986) Bull. Entomol. Soc. Am. 32, 222-227. 24. Barton, N. H. & Hewitt, G. M. (1989) Nature (London) 341, 497-503. 25. Page, R. E. & Erickson, E. H. (1985) Ann. Entomol. Soc. Am. 78, 149-158. 26. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 239,487-491. 27. Smith, D. R. & Brown, W. M. (1988) Experientia 44, 257-260. 28. Smith, D. R. (1988) in Africanized Honey Bees and Bee Mites, eds. Needham, G. R., Page, R. E., Delfinado-Baker, M. & Bowman, C. E. (Horwood, Chichester, U.K.), pp. 303-312. 29. Smith, D. R. & Brown, W. M. (1990)Ann. Entomol. Soc. Am. 63,81-88. 30. Smith, D. R., Palopoli, M. F., Taylor, B. R., Garnery, L., Cornuet, J.-M., Solignac, M. & Brown, W. M. (1991) J. Hered., in press. 31. Vlasak, I., Burgschwaiger, S. & Kreil, G. (1987) NucleicAcidsRes. 15, 2388. 32. Crozier, R. H., Crozier, Y. C. & MacKinlay, A. G. (1989) Mol. Biol. Evol. 6, 399-411. 33. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), 2nd Ed. 34. Crozier, Y. C., Koulianos, S. & Crozier, R. H. (1991) Experientia, in press.