An Alternatively Spliced Miniexon Alters the Subcellular Fate of the

Vol. 266, No. 2, Issue of January 15, pp. 1237-1’244,1991 Printed in U.S.A.

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1991 by The American Society for Biochemistry and Molecular Biology, Inc

An Alternatively Spliced Miniexon Alters the Subcellular Fateof the Human Asialoglycoprotein Receptor H2 Subunit ENDOPLASMIC RETICULUM RETENTION AND DEGRADATION OR CELL SURFACE EXPRESSION* (Received for publication, June 4, 1990)

Gerard0 Z. LederkremerSS and Harvey F. LodishSllII From the $Whitehead Institutefor Biomedical Research, Cambridge, Massachusetts02142 and the VDepartmentof Biology, Massachusetts Instituteof Technology, Cambridge, Massachusetts02139

Two types of cDNAs encoding the HZ subunit of the human asialoglycoprotein receptor had been cloned, differing only by the presence (HZa) or absence (HZb) of a segment of 15 base pairs (bp), encoding five amino acids (Glu-Gly-His-Arg-Gly) immediately carboxylterminal (exoplasmic) to the single membrane-spanning segment. We have cloned and sequenced this region of the HZ gene and showed that the two HZ forms are alternatively spliced variants differing in the presence of a 15-bp miniexon. Both HZ messenger RNAs were found in HepGZ cells, HZb accounting for about 92% of the HZ mRNAs. When expressed in NIH 3T3 cells without the H1 receptor subunit, the two-variant polypeptides exhibit different subcellular fates. H2a is completely retained in and degraded in the endoplasmic reticulum or a related pre-Golgi compartment. In contrast a substantial amount of HZb is processed by Golgi enzymes and reaches the cell surface. Thus, the sole difference determining the subcellular localization of the two forms if the five-amino acid insert in HZa. When a virion-packaged retroviral vector containing HZa cDNA infected 3T3 cells, 70%of the resulting clones expressed HZb and 30%HZa. Thus the 15-bp HZa miniexon can be spliced out, at least during the retrovirus life cycle.

and Lodish, 1987). H2 is less abundant; theratio of H1 toH2 is 3:l or 4:l at the cell surface of the human hepatoma cell HepG2 (Henis et al., 1990). Both polypeptides span the membrane once, with a large carboxyl-terminal exoplasmic segment containing the galactose-binding sites. H1 and H2 are essential subunits of the functional receptor. Antibody-induced degradation and chemical cross-linking experiments proved that the ASGPR in HepG2 cells is a heterooligomeric complex, minimally a trimer (Bischoff et al., 1988). Murine fibroblasts normally do not express the ASGPR. When singly transfected, expressing cDNAs encoding H1 or H2, they do not produce functional receptors despite the fact that both polypeptides can bind separately to galactosyl-agarose columns and thus are galactose lectins.’ When expressed together in fibroblasts, H1 and H2 form a functional receptor on the cell surface with properties similar to the receptor in HepG2 cells (Shia andLodish, 1989).Two types of H2 cDNAs have been cloned from the human hepatoma cell line HepG2, which differ only in the presence (H2a) or absence (H2b) of a segment of 15 bp (Spiessand Lodish, 1985). We show here that the two forms are generated by alternative splicing of a single gene and that themajor form expressed in HepG2 cells is H2b. We reported recently that when H2a is expressed without H1 in NIH 3T3 cells, it is inserted normally into the endoplasmic reticulum (ER) membrane and acquires three N linked oligosaccharides but is retained in and degraded in the The human asialoglycoprotein receptor (ASGPR)’ is ex- ER or another pre-Golgi compartment without reaching the pressed exclusively in hepatocytes and binds glycoproteins cell surface (Shia and Lodish, 1989; Amara et al., 1989). The bearing terminal galactose residues (Ashwell and Harford, same novel pathway of pre-Golgi retention and nonlysosomal 1982; Breitfeld et al., 1985). It is constructed of two polypep- degradation is followed by the (Y and /3 chains of the T cell tides of related aminoacid sequence, H1 (46 kDa) and H2 (50 antigen receptor (TCR) when expressed in fibroblasts without kDa) (Spiess et al., 1985; Spiess and Lodish, 1985; Bischoff theothersubunits (Lippincott-Schwartz et al., 1988). ER degradation or Golgi maturation is dependent on the structure * This work wassupported in part by National Institutes of Health Grant GM-35012 (to H. F. L.). The costs of publication of this article of the polypeptide. When expressed without H2, theH1 were defrayed in part by the payment of page charges. This article subunit, which is highly homologous to H2, matures to the is degraded (Shia and must therefore be hereby marked “aduertisement” in accordance with cell surface; only asmallfraction 18 U.S.C. Section 1734 solelyto indicate this fact. Lodish, 1989). The nucleotide sequence(s) reported in thispaper has been submitted We show here that a substantial fraction of the alternatively totheGenBankTM/EMBLDataBankwith accession number(s) spliced form H2b, expressed without H1, is processed by Golgi M38420. enzymes and reaches the cell surface. The sole difference that Recipient of a Fogarty International Research Award. I( To whom correspondence should be sent: Whitehead Institute determines the subcellular localization of the two variants is for Biomedical Research, 9 Cambridge, Center, Cambridge, MA a five-amino acid peptide encoded by a miniexon in H2a (Glu02142. Tel.: 617-258-5216; Fax: 617-258-5061. Gly-His-Arg-Gly), immediately carboxyl-terminal (exo’ The abbreviations used are: ASGPR, asialoglycoprotein receptor; plasmic) to the single membrane-spanning domain. In the bp, base pair(s); BSA, bovine serum albumin; DMEM, Dulbecco’s case of the (Y chain of the TCR, the signal that targets its modifiedEagle’smedium; Endo H, P-N-acetylglucosidase H; ER, endoplasmic reticulum; Hepes, 4-(2-hydroxyethyl)-l-piperazineeth- retention in the ER and degradation is the transmembrane anesulfonic acid PBS, phosphate-buffered saline; PCR, polymerase domain (Bonifacino et al., 1990). Taken together, our studies chain reaction; PIPES, piperazine-N,N’-bis (2-ethanesulfonic acid); on the ASGPR and thoseon theTCR suggest that the SDS, sodium dodecyl sulfate; sulfo-SHPP, sulfosuccinimidyl-3-(4hydroxypheny1)propionate;TCR, T cell antigen receptor.

1237

J. Bischoff and M. A. Shia, unpublished observations.

Subcellular Fate of ASGPR Subunits

1238

transmembrane domain and/or its adjacent charged hydrophilic segments are signals for ER retention and degradation. Unexpectedly, when we generated a retroviral vector containing H2a cDNA and used packaged virions to transfect NIH 3T3 cells, 70% of the resulting clones expressed H2b and 30%H2a. We conclude that the 15-bp H2a miniexon can be spliced out, at least during the retroviral life cycle. EXPERIMENTALPROCEDURES

Cell Lines Expressing ASGPR Subunits-qZ packaging cells were transfected with 10 pg of a pDOL retroviral vector containing H2a cDNA (Shia and Lodish, 1989), and the transient viral supernatant was used to infect NIH 3T3 cells as described (Deitcher et al., 1986). The 3T3 cells wereselected for resistance to 1mg/ml G418 (GIBCO), for at least 2 weeks and then cloned by dilution. As explained in "Results" some of the clones express H2a (2-18 cells) whereas in others the 15 bp characteristic of H2a had been deleted, and they express H2b (2Ccells). These cells as well as other retrovirus-infected cell lines expressing only H2a, only H2b, H1 plus H2a (2-18-1, 2-1811 cells), and H1 plus H2b subunits (1-7-1 cells) (Shia and Lodish, 1989) were grown in Dulbecco's modified Eagle's medium (DMEM) plus 10% calf serum under 5% COZ. HepG2 cells weregrown in minimum Eagle's medium plus 10% fetal calf serum, 100 units/ml penicillin, and 100 pg/ml streptomycin as described (Knowles et al., 1980). Preparation of Cytoplasmic RNA-Cells were grown on 100-mm tissue culture dishes, and once confluent (-lo6 cells) they were washed with PBS, scraped off, transferred to microcentrifuge tubes, and centrifuged for 5 s at 15,000 X g at 4 "C. The supernatant was removed, andthe cells were solubilized by vortexing with 0.5% Nonidet P-40 in a buffer (TE) containing 10 mM Tris and 1 mM EDTA, pH 7.4. The nuclei were removed by centrifugation at 15,000 X g for 1 min at 4 "C, and the supernatantwas treated with 1%SDS and deproteinized by phenol extraction. The cytoplasmic RNA was precipitated with ethanol. Polymerase Chain Reaction (PCR) Amplification and SequencingCytoplasmic RNAs (1-2 pg)were reverse transcribed as described

(Ausubel et al., 1987) using 1.25 p1 of reverse transcriptase (Life Sciences, 18 units/ml) and 100 ng of an oligonucleotide primer in a reaction volume of25 pl. The antisense 34-base oligonucleotide primer hybridized to nucleotides 23-42 3' of the 15-bp miniexon in H2a. Its sequence, 3'-5', is CGCCTCGGACTTCCTTCGAATCAGCTGGACGTCC;underlined is the sequence hybridizing to H2a, and the other 14 nucleotides include added PstI and SalI sites. The samples (25 pl) were diluted to 500 pl, and 2 or 4 pl was amplified by PCR with a kit from Perkin-Elmer Cetus using the procedure provided. We used 150 ng of each oligonucleotide primer and 30 cycles, each consisting of a 1.5-min melting a t 94 "C, 2-min annealing at 50 "C, and 2-min polymerization at 72 "C. One of the oligonucleotide primers used for the PCR amplification was the same as used for the reverse transcription, the other 33 bases long, corresponded to nucleotides 38-19,5' of the 15-bp miniexon in H2a. Its sequence, 5'-3', is ACCCGGGGATCCTCCTGCTGCTGGTGGTCATCT; underlined is the sequence corresponding to H2a; the other 13 nucleotides include added SmaI and BarnHI sites. Of the reaction products 20% were run on a 3%agarose gel, transferred to nylon filters (Ausubel et al., 1987), and probed with an oligonucleotide that corresponded to the 15-base miniexon in H2a, which was 32Pend labeled with T4 polynucleotide kinase (Boehringer Mannheim) and purified on elutips (Schleicher & Schuell). PCR amplifications on genomic DNA were performed by solubilizing cells from one 100-mm tissue culture dish of HepG2 cells (previously scraped and transferred to a microcentrifuge tube) into 200 p1 of 0.45% Tween 20, 0.45% Nonidet P-40, 0.05% gelatin, 2 mM MgC12,50 mM KCl, 0.05 mg/ml proteinase K in 20 mM Tris. HCl, pH 8.3; incubation was for 1 h at 55 "C. The samples were then heated for 15 min at 95 "C, and 0.5-2 pl wasthen used for PCR amplification as described above. The PCR products were resolved on a 2% agarose gel, and the band obtained was eluted and the DNA purified with Geneclean beads (BIO 101, La Jolla, CA). The BamHI site that was included in one of the oligonucleotide primers and the SalI site included in the other were used to subclone the PCR product into M13mp18 and M13mp19. Sequencing wasby the dideoxy chain termination technique (Sanger et al., 1977). Ribonuclease Protection Assay-Riboprobes were synthesized by subcloning the segment of interest into a pBS (Bluescribe) plasmid

1 . " ' "

...UGUGUGACDGGGUCCCAAAGUGCACAGCUGCAA. ,. . . . ~ S e r G l n S e r A l a G l n L e u G l n ...

H2b

Tnnmembram

B

. . . LeuLeuLeuValValIleCysValTreGlySerGlnSerGluGlyHisArgGly

.. CCTCCTGCTGCTGGTGGTCATCTGTGTGACTGGGTCCC~TGAGGGTCACAGA~caa

60

scagggatgggcatggggtagggaaagagacatgggcagtggcgggcagcgatcggggcg . .~~

120

~

atgggaggggaagggatggaggcggggtggagcacaagctggggcaaatgcgggacattg 180 aggggccagtcacatggacagtgatgggacacggcccctctgcctcatcctgcccccact 240 accacctgacaa~TGCACAGCTGCAAGCCGAGCTGCGGAGCCTGAAGG~GCTTAGTC..2 9 9 AlaGlnLeuGlnAlaGluLeuArgSerLeuLysGluAla ...

FIG. 1. Sequence of the genomic region in DNA from HepG2 cells which gives rise to the H2a and H2b alternatively spliced variants. The region of interest in HepG2 genomic DNA was amplified by PCR using as primers the same oligonucleotides as in the amplification of reverse transcribed RNAs (Fig. 2). The PCR product was subcloned into M13 and sequenced. A, the intron amplified by PCR lies between the H2 exons that align with exons 3 and 4 of the ratASGPR RHL-1 gene. The 15-bp miniexon lies at the 5' endof this intron. The splice donor site that generates H2a has the unusual GC (circled) sequence instead of GT atits 5' end. Exons are in upper case letters, and the intron is in lower case letters. A t the protein level H2a has five extra amino acids (in bold letters), three of them charged, next to thetransmembrane region. B, complete sequence of the intron with its adjacent segments. The intron is 197 bp in length (lower case letters), and the 15-bp miniexon (in box) lies at its 5' end. The codons that are interrupted by the exon-intron junctions are serine inH2b and glycine in H2a.

"=

1239

Subcellular Fate of ASGPR Subunits A

B

1 2 3 4 5 6 7 81 92 3 4 5 6 7 8 9

i_ l-_ H2b

product

FIG. 2. Transcripts encoding both H2a and H2b are present in HepG2 cells. Cytoplasmic mRNA from HepG2 cells was reverse transcribed using as primer an antisense oligonucleotide that hybridized to nucleotides 23-42 3' of the 15-base miniexon in H2a. The cDNA obtained was then amplified by PCR using as primers oligonucleotides starting a t -20 bases on either side of the 15-base miniexon. The products were analyzed on a 3% agarose gel. A, PCR products stained with ethidium bromide and visualized by ultraviolet light. RNA from NIH 3T3 cells expressing H2a (2-18 cells; lanes 7 and 8) shows the expected product of 125 bp (thin arrow). RNA from NIH 3T3 cells expressing H2b (2C cells; lanes 4 and 5) shows the expected 110-bp product (arrowhead). RNA from HepG2 cells (lanes 1 and 2) shows both H2a (thin arrow) and H2b (arrowhead) products. The asterisk indicates the band corresponding to theprimers. Lanes 2, 5, and 8 show products from PCR amplifications performed on twice the amount of cDNAs used in lanes 1,4, and7, respectively. In lanes 3, 6, and 9 the reactions were performed in the absence of primer, revealing no nonspecific amplification. B, Southern blot of the gel in A. The probe used was a 15-base antisense oligonucleotide corresponding to the 15-base miniexon in H2a, end labeled with [y"PIATP. The H2a PCR product (thin arrow) is observed with RNA from 2-18 cells (lanes 7 and 8) and from HepG2 cells (lanes 1 and 2) and not in RNA from 2C cells (lanes 4 and 5). (Stratagene, La Jolla, CA) and transcribing with T 3 polymerase using an RNA transcription kit from Stratagene and following the manufacturer's procedure. Weused 50pCiof [cY-~*P]UTP (Amersham Corp., 400 Ci/mmol) and reduced the specific activity by the addition of 100 pmol of UTP/reaction (25 pl). The RNA probes were then treated for 15 min a t 37 "Cwith 2 units of RNase-free DNase (RQ1; Promega Biotec, Madison, WI) and 15 min a t 37 "C with 0.1 mg/ml proteinase K (U. S. Biochemical Corp.) in 0.5% SDS. RNA was then purified by centrifugation through a 3-ml Sephadex G-50 column in TE. Cytoplasmic RNAs (5-30 pg) were added to the labeled riboprobe, heated for 10 min a t 85 "C in 40 mM PIPES, pH 6.4,400 mM NaCI, 1 mM EDTA, 80% formamide and hybridized overnight a t 52"C according to the procedure described by Ausubel et al. (1987). The hybrids were then treated with a mix of 0.2 mg/ml RNase A and 0.01 mg/ml RNase T1 (U. S. Biochemical Corp.) for 30 min a t 37 'C in 300 mM NaCI, 10 mM Tris, pH 7.5,5 mM EDTA as described (Ausubel et al., 1987).They were then treated with 0.1 mg/ml proteinase K in 0.5% SDS for 15 min a t 37 "C, extracted with phenol, and precipitated with ethanol. The samples were electrophoresed on 8% polyacrylamide, 8.3 M urea gels followed by autoradiography. The molecular weight markers used were:'*Pend labeled MSP I fragments of pBR322 DNA (New England BioLabs, Beverly, MA). Immunofluorescence Microscopy-For immunofluorescence on nonpermeabilized cells, cells grown on coverslips were rinsed three times with PBS containing 2% BSA(PBS/BSA) and subjected to the following sequential incubations, all in solutions of PBS/BSA a t 4 "C ( a ) 30 min with 50 pg/ml normal goat IgG, ( b )60 min with 20 pg/ml rabbit anti-H2 COOH-terminal IgG (Bischoff et al., 1988); (c) three rinses with PBS/BSA; (d) 30 min with 50 pg/ml of tetramethylrhodamine isothiocyanate-conjugatedgoat anti-rabbit IgG (Zymed Laboratories, San Francisco, CA); (e) three rinses with PBS; V, fixation with methanol and acetone for 5 min each a t -20 "C. The coverslips were then mounted on slides and viewed on a fluorescence microscope (Carl Zeiss, Inc., Thornwood, NY). For immunofluorescence on permeabilized cells we followed the procedure of Amara et al. (1989). Cell Surface Iodination-Derivatized Bolton-Hunter reagent, sulfosuccinimidyl-3-(4-hydroxyphenyl)propionate(sulfo-SHPP) (Pierce Chemical Co.) (10 pg), was labeled with 2.5 mCi of Na1251in the presence of IODO-GEN (Pierce Chemical Co.) for 10 min a t 25 "C. The reaction was stopped by incubation with 1 mg/ml sodium metabisulfite for 5 min at 25 "C. Confluent retrovirus-infected NIH 3T3

cellllne

P

2-182c1-7-12-18-2-18-RepG2 1

~~~

DNA MARKERS

c 404 bp

6

309 bp

+242 bp

-RNA 11

~

FIG. 3. Ribonuclease protection assay on H2 mRNA. Cytoplasmic RNAs from HepG2 cells and from transfected 3T3 cell lines were hybridized overnight to an RNA probe uniformly labeled with [(u-~*P]UTP which included the region of the 15-base miniexon in H2a. The hybrids were then extensively reacted with ribonucleases A and TI, and the products were electrophoresed in a 8% polyacrylamide, 8.3 M urea gel followed by autoradiography. As shown in the diagram, H2a mRNA protectsa 300-base fragment of the probe yielding one labeled fragment, indicated by the empty arrowhead a t the left. H2b mRNA does not hybridize to the 15-bp insert; and as shown in the diagram it generates two fragments, one of 228 bases (indicated by a solid arrowhead at the left), and a small 58-base fragment not shown in the autoradiography. Lanes 1and 2.2-18 cells, expressing H2a; lanes 3 and 4, 2C cells, expressing H2b; lanes 5 and 6, 1-7-1 cells, expressing H1 plus H2b; lanes 7 and 8, 2-18-1 cells, expressing H1 plus H2a; lanes 9 and 10, 2-18-11cells, expressing H1 plus H2a; lanes 11 and 12, HepG2 cells; lanes 13 and 14, no RNA present in the reaction. In lanes 1, 3, 5, 7, and 9 are products from reactions performed on 5 pgof RNA; lanes 2, 4, 6, 8, and 10 show products from 10 pg of RNA. From HepG2 cells 15 pg of RNA (lane 11) and 30 pg (lane 12)were used. cells grown on 60-mm tissue culture dishes were washed with PBS, incubated for 30 min a t 4 "C with 1pg (250 pCi) of the labeled sulfoSHPP in Hanks' balanced salt solution plus 20 mM Hepes, pH 7.4 (H/H),as described (Thompson et al., 1987). The reaction was stopped by washing with 1 mg/ml lysine in H/H. Some samples were trypsinized by incubating with 3 ml of trypsin (0.5 mg/ml, GIBCO) in H/H/dish a t 4 "C for 30 min. Trypsinization was stopped by washing with 6 ml of0.5 mg/ml soybean trypsin inhibitor (Calbiochem) in PBS/dish. The cells were then solubilized with Triton X100 and sodium deoxycholate in PBS in the presence of 2 mM phenylmethylsulfonyl fluoride (Sigma) and 0.5 mg/ml soybean trypsin inhibitor. Samples were immunoprecipitated with the anti-H2 COOH-terminal antibody and subjected to SDS-polyacrylamide gel electrophoresis as described (Amara et al., 1989).As molecular weight markers we used "C-methylated proteins from Amersham Corp. Metabolic Labeling-Confluent monolayers of retrovirus-infected NIH 3T3cells were rinsed and preincubated for 30 min a t 37 "C with cysteine-free DMEM plus 10% dialyzed calf serum. They were then pulse labeled in the same medium containing [35S]cysteine(ICN Radiochemicals, Irvine, CA;>800 Ci/mmol) and then rinsed and chased for different periods of time with normal DMEM plus 10% calf serum as described (Amara et al., 1989). Cells were then rinsed with PBS, solubilized, immunoprecipitated, and subjected to SDSpolyacrylamide gel electrophoresis, as described above for iodinated cells. Fusion to COS Cells: "Rescue"of the Integrated Retrovirus-Equal numbers of COS-1 cells and cells containing the integrated retrovirus were grown together on a 100-mm tissue culture dish until confluent (-48 hr). They were then rinsed three times with DMEM and 2 ml of a 50% polyethylene glycol solution (polyethylene glycol1500, Boehringer Mannheim) was added. After 60 s the cells were rinsed with DMEM and then twice with DMEM plus 10% calf serum and 10% fetal calf serum. They were then incubated for 3 days at 37 "C


1240

1

2

3

4

5

6

7

8

9101112

-

69 kD

*

46 kD

30 kD

chase(hr.) cell

o 1 -2-18-

2

4

o

1 2 2C-

4

o I-

1 2 o 1-7-1" 0-1

FIG. 6. Pulse-chase labelingof H2 polypeptide.Cells expressing H2a (2-18 cells; lanes 1-4), H2b (2C cells;lanes 5-8). H1 and H2b together (1-7-1 cells; lunes 9-21), or no ASGPR subunit (0-1 cells; lane 12) were pulse labeled for 30 min at 37 "C with [3sS]cysteineand then washed and chased at 37 "C with unlabeled complete medium for the times indicated in the figure. The cells were then washed, solubilized with detergent,and immunoprecipitated with the H2 COOH-terminal antibody. They were then subjected to SDS-polyacrylamide gel electrophoresis (10%) followed by fluorography. The solid arrowhead denotes the probable H1 polypeptide in the H2 immunoprecipitate in pulse-labeled 1-7-1 cells; the open arrowhead, the position of H1 in the pulse-chase samples (lanes 9 and 11).

L

RESULTS

PCR Amplification and Sequence of the Genomic Sequence I

FIG. 4. Cell surface expression of H2 variants H2a and i n cloned, transfected NIH 3T3 cell lines. Cloned lines of NIH 3T3 fibroblasts grown on coverslips were reacted with an antipeptide antibody directed against the COOH-terminal (exoplasmic) segment ofH2followedby a tetramethylrhodamine isothiocyanate-labeled goat anti-rabbit antibody. They were visualized by phase-contrast microscopy (A, C, E, and G ) or tetramethylrhodamine isothiocyanate fluorescence (B, D,F, and H). In panels A-F, cells were reacted with antibodies without permeabilization a t 4 "C and then fixed prior to mounting and visualizing. In panels G and H,cells were fixed and permeabilized prior to the immunochemical reactions. Bar = 20 pm. A and B, 2C cells, expressing only the H2b subunit; C and D, 1.-7-1 cells, expressing H2b and H1; E and F, 2-18 cells, expressing only H2a; G and H,permeabilized 2-18 cells.

That Encodes the 15-bp Insert in H2a mRNA-Two types of ASGPR H2 cDNAs were cloned from HepG2 cells: H2a and H2b

H2b. The former contains an extra15-bp insert encoding five amino acids (Glu-Gly-His-Arg-Gly)just carboxyl-terminal to the membrane-spanning region, in the exoplasmic domain (Spiess and Lodish, 1985). The gene encoding H2 has not been cloned. When H2a and H2b cDNAs are aligned with the gene encoding subunit 1 of the ratASGPR (RHL-1; Leung et al., 1985; McPhaul and Berg, 1987), the extra 15 bp in H2a would fall at the junction between exons 3 and 4. This suggests that the two H2 variants arise from differential splicing. To prove this hypothesis, the relevant genomic segment was cloned by PCR amplification of HepG2 genomic DNA. The two oligonucleotide primers used contained sequences that start in the cDNA -20 bp on either side of the extra 15-bp 1 2 3 4 5 6 7 8 insert of H2a (see "Experimental Procedures"). The PCR product was subcloned into M13 and sequenced (Fig. 1).The H2a-specific 15-bp insert is located at the5' end of this 197bp intron, thusleading to a mechanism of alternative splicing with two donor and one acceptor site (Fig. 1).It is noteworthy that the donor site in the intron which gives rise to H2a has 30 kD - + - + - + - + the unusual sequence GC instead of GT (Jacob and Gallinaro, trypsin 1-7-1 0-1 2-18 2C cell 1989). FIG. 5. Surface iodination of transfected3T3 cells. The cell Both H2 Variants Are Expressed in HepG2 Cells-Both H2a lines described in Fig. 4 were iodinated a t 4 "C by means of the and H2b cDNAs were cloned from HepG2 RNA. To confirm soluble, membrane-impermeant reagent sulfo-SHPP. Some of the cell the expression of the two variants in this cell line, RNA was samples were then treated with trypsin a t 4 "C prior to solubilization with detergent. This was followed by immunoprecipitation with the reverse transcribed using an oligonucleotide primer that hysame H2 COOH-terminal antipeptide antibody used in the immuno- bridizes from 23 bp downstream (3') of the extra 15-bp insert fluorescence (Fig. 4). The analysis was by SDS-polyacrylamide gel in H2a. Cytoplasmic RNA was used in order to avoid contamelectrophosesis (PAGE) (10%) analysis and autoradiography. Sam- ination with precursor hnRNA. Polymerase chain reaction ples treated (+) with trypsin or untreated (-) are indicated. amplifications were then performed on these cDNAs using two oligonucleotide primers, the sequences of which start under 5% CO,. The cells were solubilized with 2 ml of 2% SDS, 10 20 bp on either side of the 15-bp insert in H2a. These are the mM Tris, pH7.4,lO mM EDTA. The chromosomal DNA was removed same primers used to amplify the genomic sequence, and one by the addition of NaCl to a concentration of 1.25 M, incubation a t of these oligonucleotides was the primer for reverse transcrip4 "Cfor 6 h, and centrifugation a t 18,000 rpm for 45min. The tion. We expected as PCR products a 125-bp fragment from supernatant was extracted with phenol/chloroform, the plasmids were H2a cDNA and a 110-bp fragment from H2b cDNA. As precipitated with ethanol, purified with Geneclean glass beads, and detailed later, each of the two forms can be expressed in used to transform Escherichia coli MC1061. The amplified plasmids transfected NIH 3T3cells: H2a in the 2-18 cell line and H2b in the 2C cell line. As seen in Fig. 2A, lanes 7 and 8, mRNA were purified and subjected to restriction mapping and sequencing.

L

1-

-

Subcellular Fate of ASGPR Subunits H2a (2-18 cells)

1241

H2b (2C cells) H2a cDNA (2-18 Cells)

-

+ +

v

..~SerGlnSerGluGlyEiaArgGlyAlaGlnLeuGln.. TGTGTGACTGGGTCCCAAAGTGAGGGTCACAGAGGTGCACAGCTGCAA...

..

...TGTGTGACTGGGTCCCAAAGTGCACAGCTGCAA...

...-

SerGlnSerAlaGlnLeuGln...

Transmembrane

H2b cDNA (2C cells)

G A GT AC T C

FIG.7. The 15-bp miniexon from H2a canbe “spliced”out yielding H2b when infecting cells witha retroviral vector containing H2a cDNA. NIH 3T3cells were infected with a pDOL retroviral vector containing H2a cDNA and a neomycin resistance gene (Shia and Lodish, 1989).The cells were selected for 2 weeks in medium containing 1 mg/ml G418. About 70% of the cells expressed H2 on their surface. Cells that expressed H2 on their surface or not were cloned. The clones were fused independently to COS cells with polyethylene glycol as detailed under “Experimental Procedures.” The plasmids produced by the COS cells were amplified by transforming E. coli MC1061 and thensequenced. Cells not expressing H2 on the surface (2-18)showed no change in the H2a sequence. Cells expressing H2 on the surface (2C) showed only one change: a 15-bp deletion corresponding to the extra miniexon in H2a (in bold letters). The region of interest in the sequencing gel is illustrated.

from2-18cellsindeed exhibited the expected 125-bp H2a fragment and 2C cells the expected110-bpH2b fragment (lanes 4 and 5).HepG2 cells showed mainlythe H2b product (lanes 1 and 2 ) , but the H2a product was also present as evidenced by hybridization of a Southern blot with the 32P end-labeled 15-bp insert unique to H2a (Fig. 2B, lanes 1 and 2). The latterhybridized, as expected, to theH2a PCR product (Fig. 2B, lanes 7 and 8) but not to the H2b product (lanes 4 and 5). To deduce the ratio of H2a to H2b mRNAs we performed RNase protection assays on cytoplasmic RNAs. RNAs were hybridized to a riboprobe uniformly labeled with [cP~’P]UTP. The probe (344bases) spanned the 15 bases that differentiate H2a from H2b. The hybrids were then digested with RNases A and T1, which would result in a protected fragment of 300 bases from H2aRNA or fragments of 228 and 58 bases from H2b RNA. These could be differentiated from the original probe of 344bases, whichcontained nonhybridizingsequences a t the ends. As seen in Fig. 3,2-18 cells showedexpression of H2a RNA (lanes I and 2) and 2C cells of H2b (lanes3 and 4 ) , as expected. In one line of 3T3 cells expressing H1 plus H2 (1-7-1),only expressionof H2b was seen (lanes5 and 6 ) .This cell line wasprepared from a vector that carried the H2a form of H2 cDNA; evidentlyit had suffered a deletion of the extra 15 bp, as will be described later. 2-18-1 and 2-18-11 are two cell lines that were made by transfecting 2-18 cells with an expressionvector containing H1 cDNA. These cell lines showed expressionof H2a RNA and not H2b (lanes 7 and 8, lanes 9 and 10). Smaller protected RNAs observed in these lanes as well as in lane 2 are probably products of premature transcription termination of the RNA probe;however, we cannot exclude a small expression of H2b that is a product of a deletion of the extra 15 bp from H2a cDNA, as in 1-7-1 cells. HepG2, the cell line fromwhich H1 and H2 had been originally cloned(Spiesset al., 1985;Spiess and Lodish, 1985), exhibited both H2a and H2b RNAs. As determined by microdensitometry the former is present in a much lower amount

(7.7%) than is thelatter (92.3%) (lanes 11 and 12). This indicates that both H2 variants exist as alternatively spliced forms in HepG2 cells and thatthe major form is H2b. Expression of H2a and H2b in NIH 3T3 Cells-In order to express either the H2a or the H2b polypeptide in cells that normally do not express the ASGPR, NIH 3T3 cells were infected with a retroviral vector (pDOL) containing the appropriate cDNA. The vectors contained a gene encoding neomycin resistance; infected cells were selected forresistance to the neomycin analogue G418 and cloned. Two stable representative cloned lines, 2-18, expressing H2a,and 2C, expressing H2b,were examined forsurface immunofluorescence. We used an antipeptide antibody prepared against the carboxylterminal exoplasmic domain of H2whichrecognized both H2a and H2b variants (Fig. 4). The 2C cells (panels A and B) showed surface fluorescence similar to that of a cell line (1-71;panels C and D)that expresses both H1 and H2b and which exhibits a functional ASGP receptor (Shia and Lodish, 1989). In contrast, 2-18 cells, expressing H2a, showed no surface fluorescence (panels E and F ) . The 2-18 cells did show H2 fluorescence upon permeabilization(Fig. 1, panels G and H ) ; H2 was localizedto the endoplasmic reticulumas we reported recently (Amara et al., 1989). The difference in cell surface expression was confirmed by surface iodination of the H2a- and H2b-expressing cell lines. Iodination was done with the selective membrane-impermeable reagent sulfosuccinimidyl-3-(4-hydroxyphenyl)propi0nate (sulfo-SHPP) (derivatized Bolton-Hunter; Thompson et al., 1987)(Fig. 5). The 2C cell line exhibited cellsurface expression of H2b, as seen by immunoprecipitation of an extract of iodinated cells with an anti-COOH-terminal peptide antibody (lane 1). Trypsin treatment at 4 “Cof the intact cells after radioiodination digested all the labeled H2b (lane 2),proving that itwas onthe cell surface.No surface labeling of H2a was observed in 2-18 cells(lanes 3 and 4), corroborating the result from the immunofluorescence studies.As a positive control, we labeled the 1-7-1 cell line, which expresses both H1 and H2b; the amount of labeled H2b was 2.5 times that

1242


of the 2C cells (lanes 5 and 6). The molecular mass of-46 kDa for the cell surface H2b is the same as observed for the mature form of H2 in HepG2 cells. The 1-7-1 cells show a double band, possibly due to partial coimmunoprecipitation of the faster migrating H1 subunit complexed with H2b. No labeling was observed in a negative control, the 0-1 cell line, that had been transfected with the vector without an H2 cDNA insert (lane 7). In order to determine whether the two H2 isoforms mature through the Golgi complex, 2C and 2-18 cells were metabolically labeled with [”Slcysteine for 30 min followed by a chase with medium containing unlabeled cysteine. In 2-18 cells the -42-kDa precursor of H2a retains itsendo-@-N-acetylglycosidase H (Endo-H)-sensitive oligosaccharides, and it is completelydegraded within 4h of chase, as reported recently (Amara et al., 1989) (Fig. 6, lunes 1-4). In contrast,in 2C cells some of the -42-kDa H2b precursor acquires complex oligosaccharides that cause the H2b to migrate at-46 kDa (lunes 5-8), similar to the mature form of H2 produced in HepG2 cells (Bischoff and Lodish, 1987).Both in2C and HepG2cells this form of H2 is resistant to treatment with EndoH (data not shown). However, in 2C cells after 4 h of chase (lane 8 ) there is still 27% of the amount of Endo H-sensitive 42-kDa form existent after a 1-h chase. As there is a slight increase in the amountof labeled protein after a 1-h chase,relative to that after the pulse, allthecomparisonsaredonetothe former value. In 2C cells about 40% of the pulse-labeled H2b is processed to the matureform (Fig. 6, lune 8 ) ; the remaining 33% is degraded. The amount of H2b processed to a mature form after 4 h of chase varied in different experiments, from 17 to 40%, averaging 29%. As in the cell surface iodination experiment (Fig.2) in 1-7-1 cells the double band seen is probably due to partial coimmunoprecipitation of H 1 with H2b, both as an Endo H-sensitive precursor (lane 9) and asa mature species (lane 1I ) . Heterogeneity of Cells Infected withapDOL Vector Containing H2a cDNA: H2a Can Lose the 15-Base Pair “Miniexon” during RetrouiralReplication-All NIH3T3 cellsinfected with the pDOLvector containing H2bcDNA and selected for of the H2b neomycin resistance showed surface expression polypeptide. In contrast, of the cellsinfected with a virus containing H2a cDNAand selected for G418 resistance, about 70% showed surface fluorescence, and 30% did not. This 30% didexhibitH2 fluorescence uponpermeabilization(not shown).This puzzlingheterogeneity indicatedthatsome changehad occurred intheintegratedH2acDNA which affected the subcellular localization of the H2 polypeptide. In order to find out whether there was a change in the sequence of the integrated H2acDNA, the cells were cloned. A “surface-positive” clone and a “surface-negative’’ one were fused with COS cells, causing the vectors integrated in the chromosomal DNA to bereplicated as double-stranded DNA plasmids. Theseplasmids were then amplified in E. coli, purified, and analyzed by extensive restriction mapping and sequencing. The H2a DNA in the cell line negative for H2 surface immunofluorescence was unchanged. But in the surface-positive cell line a deletion of 15 bp hadoccurred in the segment of DNA encoding a part of the polypeptide immediatelycarboxyl-terminaltothemembrane-spanning region 15 bpthatdifferentiatethe (Fig. 7). Thesearetheexact hepatoma cDNAclones H2a from H2b and was the only change found in the H2cDNA. Thus, in these cells H2a had been converted to H2b, and apparently such a deletion occurs in 70% of the H2a transfectants. In the RNase protection assay itcould be seen thata 3T3 transfectedcell line expressing both H1 and H2 (1-7-1), which was generated using a

vector that contained H2a cDNA, had undergone the same 15-bp deletion, producing H2b (Fig. 5 , lanes 5 and 6). The biological and kinetic propertiesof the ASGPR in1-7-1 cells, composed of subunits H2b and H1, were the same as in the ASGPR in HepG2 cells (Shia and Lodish, 1989). The surface-negative cell lines expressing H2a (for example, 2-18) haveremained stable aftermultiple passages. When this cell line was transfected with an expression vector carrying H1, the resulting lines (2-18-12-18-11) and showed expression of H2a RNA and not H2b, again showing the stabilityof H2a expression in a cloned cell line. This indicates that the 15-bp deletion musthave occurred prior to the infection of 3T3 cells with the retroviral particles containing H2a. The vector pDOL containing H2a cDNA is a replication-defective retrovirus (Mann et ul., 1983). As detailed under “Experimental Procedures’’ the first step in obtaining stably expressing cell lines is to transfect 9 2 cells with the pDOL-H2a construct. 9 2 cells can replicate and package the defective vectorand release virions into the medium. Medium containing the retroviral particles was used to infect the 3T3cells and obtain the stable cell lines expressing H2a. Therefore thedeletion of the 15 bp, which generated H2b, most likely occurred during the replication of the retrovirus in the9 2 cells. DISCUSSION

Two forms of the H2 subunit of the human ASGPR exist which differ only by the presence (H2a) or absence (H2b) of a 15-bp miniexon; this encodes a positively charged five-amino acid segment immediately carboxyl-terminaltothe membrane-spanning segment, in the exoplasmic domain. We have sequenced the corresponding intron and proved that H2a and H2b are generated by alternative splicing of a single gene HepG2 (Fig. 1). Transcripts for both H2 variants exist in cells, as seen byPCR amplification (Fig. 2) and a ribonuclease protection assay (Fig. 3). H2a is the minor H2 form in HepG2 cells, accounting for 7.7% of H2 mRNAs (Fig. 3). It remains to be determined if this is true in normal human liver. The lower level of H2a mRNA may result from a less efficient splicing reaction than thatwhich generates H2bmRNA. This may be causedby theunusual splice donorsite GC that generatesH2a (Fig. 1). GC may functionas a donorsite although it is rare; only 19 of 3,294 introns studied had this sequence (Jacob and Gallinaro, 1989). The efficiency of splicing with a GC donor site must be low as illustrated by the case of a mutation from GT to GC in a collagen gene that causes exon skipping (Weil et ul., 1988). A striking outcome of this study is the conversion of H2a cDNA to H2b when infecting NIH 3T3 cells by means of a retroviral (pDOL) vector (Fig. 7). This vector, carrying H2a cDNA, was transfected into a packaging 3T3 cell line, q 2 . The viral particles released into the medium were used to infect NIH 3T3 cells and obtain stably expressing cell lines. The excision of the 15-base miniexon could have occurred during replication of the retroviralvector, as suggested by the stability of the 3T3 cell lines expressing H2a. No excision or very little of the 15 bp occurs in these cells (Fig. 3; cells 2-18, 2-18-1,2-18-11) so the appearanceof DNAs lacking the 15 bp should have taken place during the production of retroviral particles in the packaging 9 2 cell line. These retroviral particles, used then to infect 3T3cells, produced stable cell lines expressing H2a or, asa result of the 15-bpexcision, H2b. By what mechanism has a segment of only 15 bp been excised? The segment possesses the GT . . . AG donor and acceptor sites, but it is extremely short and lacks any obvious branch point for splicing (Fig. 1; Ruskin et al., 1984; Wieringa et al., 1984). Retrovirusesarereportedto producedeletions, re-


1243

arrangements, and other mutations in their genes (Varmus, maturation of proteins in the cell,one that has generated 1982), but it is curious that this could have happened with much recent attention is the retention of certain proteins the resultof changing one naturally occurring mRNA species, withinthe endoplasmic reticulum(Roseand Doms, 1988; H2a, into the major form, H2b. How splicing of the 15-base Pelham, 1989; Lodish, 1988). Several proteins that remain in the ER lumen have the COOH-terminal sequence Lys-Aspfragment occurs deserves further investigation, particularly since in HepG2 cells H2b mRNAs could arise by a two-step Glu-Leu (Pelham, 1989). Some membrane polypeptides resplicing reaction; H2a mRNA could be formed first, and then main in and are degraded in the ER or a related pre-Golgi 5’ end of the intron could be spliced out (Fig. compartment, possibly the so-called transitional elements of the 15 bp at the the ER (Lippincott-Schwartzet al., 1988; Amara et al., 1989). 1). We have studied the maturation and subcellular localization In the case of the TCR a chain, in vitro mutagenesis studies of H2a and H2b polypeptides expressed in NIH 3T3 cells. indicated that the transmembrane domainis responsible for retention and degradation in the ER (Bonifacino et al., 1990). Without coexpression of theH1subunit,H2aisinserted The differences in behavior of the two human ASGPR H2 normally into the ER membrane and acquires the normal three N-linkedoligosaccharides. The H2apolypeptide is then variants, H2a and H2b,show that thepresence of five amino cleaved just exoplasmic to the membrane-spanning segment, acids (Glu-Gly-His-Arg-Gly) in H2a, in the ectodomain adregion, is responsible for its in the region of the five extra amino acids. The intraluminal jacent to the transmembrane portion is released as asoluble, Endo H-sensitive peptide. complete retention in and degradation in the ER. The existWithin 2-4 h all of the H2a polypeptide is degraded within ence of transcripts for the two alternatively spliced variants, H2a and HZb, in HepG2 cells favors the concept that this the ER or in a closely related pre-Golgi, nonlysosomal comsegment isa signal for ER retention and degradation and does partment (Amara et al., 1989)(Fig. 6, lanes 1-4). No H2a not causenonspecificmisfolding of HZa, as do artificially reaches the Golgi complex or the cell surface; no Endo Hresistant H2a is seen, and no H2a can be radioiodinated in introduced mutations in the ectodomains of other proteins (Gething et al., 1986; Rose and Doms, 1988). intact cells(Figs. 4-6). Similarly, H2b inserts in the ER How can the extrafive amino acids in H2a cause retention membrane and receives three N-linked oligosaccharides. In contrast to H2a,a substantial fractionof H2b isprocessed by and degradation of the polypeptide in the endoplasmic reticGolgi enzymes and reaches the cell surface (Figs. 4-6). H2b ulum? One possibility is that the insert is a signal for the is processed by Golgi enzymes to asialicacid containing action of signal peptidase. As a first step in degradation in species of a molecular mass of -46 kDa, similar to the maturethe ER, H2a is cleaved in the region of the five-amino acid species produced in HepG2 cells (Bischoff and Lodish, 1987) insert, just carboxyl-terminal to the membrane-spanningdo(Fig. 6).The amountof H2b that reachesa mature form after main (Amara et al., 1989). The transmembrane domains of sequences 4 h of chase (-29%) is less than that incells coexpressing H1 H1andH2functionasinternalsignal-anchor with its and H2b (50-60%) (Shia and Lodish, 1989). As judged by (Spiess and Lodish, 1986); an H1 mutant subunit amino-terminal (cytoplasmic) domain deleted was cleaved in quantitative surface iodination, therewas a lower level of cell by signal peptidase surface H2b in2C cells than in 1-7-1cells that coexpress H2b thesame region asH2a,apparently and H1 (Fig. 5). Taking into account that the cell lines that (Schmid and Spiess, 1988). However, calculations using the express only H2b (2C) and H2b plus H1 (1-7-1) synthesize algorithm of von Heijne (von Heijne, 1986) showed that the similar amounts of precursor H2b (Fig. 6), we conclude that probability of action of signal peptidase on H2a is no higher the cell surface expressionof H2b is stabilized by the presence than on H2b. In anycase, the protein isclipped in this region of the H1 subunit. Clearly coexpression of H1 rescues addi- as an initial step in its degradation. Combining our results on H2awith those obtained for the tional H2b polypeptide; H1 and H2b may form a complex a chain, anotherpossibility is that the importantsignal TCR within the ER and mature together to the cell surface where for ER retention and degradation is the transmembrane dothey form a functional receptor. The studies in Figs. 4-6, performed oncells expressing only main and its immediate flankingsegments. The determinant H2b, utilized the 2C cell line in which H2b was generated might not be the primary but rather thesecondary structure from a vector containing H2acDNA by excision of the 15-bp in thisregion. A computer analysisof the secondary structure of H2a, according to the Chou and Fasman algorithm (Chou insert during retroviralreplication. All were confirmed incell and Fasman, 1978), shows an extra p turn induced by the lines infected directly witha vector originally containing H2b five-amino acid insert immediately exoplasmic to the memcDNA (3-8 and 3-9 cell lines); these lines showed the same brane spanning domain. phenotype as 2C (data not shown). When coexpressed with H1, cells expressing H2a showed Acknowledgments-We thank Michael Shia for transfected fibrosome surface H2 (data not shown). Thus, H1 might be resblasts and plasmids; Raul Andino for technical advice and helpful cuing H2a to some degree and allowing it to mature to the discussion; and Hagop Youssoufian, Michael Shia, and Maureen cell surface. The two lines studied (2-18-1 and 2-18-11) ex- Charron for their suggestions on the manuscript. pressed low levels of H1, relative to 1-7-1 cells, and these REFERENCES studies need to be repeated with lines that express equal molar Amara, J. F., Lederkremer, G., and Lodish, H. F. (1989) J. Cell Biol. amounts of H1 and H2a. The question also remains as to 109, 3315-3324 whetherin HepG2 cells, Hl/H2aandHl/H2bform two Ashwell, G., and Harford, J. (1982) Annu. Reu.Biochem. 51, 531different receptor speciesthat may have different a subcellular 554 localization or even possess different properties or specifici- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. ties. The predicted extrap turn in the H2a proteinmay have A., Seidman, J. G., andStruhl, K. (1987) Current Protocols in important consequences for the function of the receptor asMolecular Biology, pp. 471-476, Wiley Interscience, New York sembled in the presenceof H1, perhaps conferring a different Bischoff, J., and Lodish, H. F. (1987) J . Biol. Chern. 262, 1182511832 binding specificity. T o study H2a and H2b polypeptides in Bischoff, J., Libresco, S., Shia, M. A., and Lodish, H. F. (1988) J . HepG2cells and liver sections we areraisingantipeptide Cell Biol. 106, 1067-1074 antibodies specific for each variant. Bonifacino, J. S., Suzuki, C. K., and Klausner, R. D. (1990) Science Among themanysortingstepsinthebiosynthesisand 247, 79-82

1244


Breitfeld, P. P., Simmons, C. F., Jr., Strous, G. J. A. M., Geuze, H. J., and Schwartz, A. L. (1985) Znt. Reu. Cytol. 97,47-95 Chou, P. Y., and Fasman, G. D. (1978) Adu. Enzymol. 47,45-148 Deitcher, D. L., Neutra, M. R., and Mostov, K. E. (1986) J. Cell Biol. 102,911-919 Gething, M. J., McCammon, K., and Sambrook, J. (1986) Cell 4 6 , 939-950 Henis, Y. I., Katzir, Z., Shia, M. A., and Lodish, H. F. (1990) J. Cell B i d . 111, 1409-1418 Jacob, M., and Gallinaro, H. (1989) Nucleic Acids Res. 17,2159-2180 Knowles, B.B., Howe, C. C., and Aden, D. P. T. I. (1980) Science 209,497-499 Leung, H. O.,Holland, E. C., and Drickamer, K. (1985) J. Biol. Chem. 260,12523-12527 Lippincott-Schwartz, J., Bonifacino, J . S., Yuan, L. C., and Klausner, R. D. (1988) Cell 5 4 , 209-220 Lodish, H.F. (1988) J . Biol. Chem. 2 6 3 , 2107-2110 Mann, R., Mulligan, R.C., and Baltimore, D. (1983) Cell 3 3 , 153159 McPhaul, M., and Berg, P. (1987) Mol. Cell. Biol. 7, 1841-1847 Pelham, H. R. B. (1989) Annu. Reu. Cell Biol. 5 , 1-24

Rose, J. K., and Doms, R. W. (1988) Annu. Reu. Cell Biol. 4,258-289 Ruskin, B., Krainer, A. R., Maniatis, T., and Green, M. R. (1984) Cell 38,317-331 Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A . 74,5463-5467 Schmid, S. R., and Spiess, M. (1988) J. Biol. Chem. 2 6 3 , 1688616891 Shia, M. A.. and Lodish, H. F. (1989) . . Proc. Natl. Acad. Sci. U. S. A. 86,1158-1162 Spiess. M.. and Lodish. H. F. (1985) . . Proc. Natl. Acad. Sci. U. S. A. -82,6465-6469 Spiess, M., and Lodish, H. F. (1986) Cell 44, 177-185 Spiess, M., Schwartz, A. L., and Lodish, H. F. (1985) J. Biol. Chem. 2 6 0 , 1979-1982 Thompson, J. A., Lau, A. L., and Cunningham, D. D. (1987) Biochemistry 26,743-750 Varmus, H. E. (1982) Science 216, 812-820 von Heijne, G. (1986) Nucleic Acids Res. 1 4 , 4683-4690 Weil, D., Bernard, M., Combates, N., Wirtz, M. K., Hollister, D. W., Steinmann, B., and Ramirez, F. (1988) J. Biol. Chem. 2 6 3 , 85618564 Wieringa, B., Hofer, E., and Weissmann, C. (1984) Cell 37,915-925