An association study of single nucleotide polymorphisms of ... - NOPR

Indian Journal of Biochemistry & Biophysics Vol. 49, February 2012, pp. 25-35

An association study of single nucleotide polymorphisms of the FOXP3 intron-1 and the risk of Psoriasis vulgaris Qiu-he Songa, #, Zhu Shena, #, Xiao-jing Xinga, Rui Yina,Ya-zhou Wub, Yi Youa, Hong Guoc, Ling Chend, Fei Haoa,* and Yun Baic,* a

Department of Dermatology, Southwest Hospital, bDepartment of Health Statistics, cDepartment of Medical Genetics, College of Basic Medical Science, Third Military Medical University, Chongqing, 400038, China d Department of Dermatology, Institute of Battle Surgery, Daping Hospital, Third Military Medical University, Chongqing, 400042, China Received 07 May 2011; revised 01 November 2011

Psoriasis vulgaris (PV) is a common autoimmune disease that involves the dysfunction of CD4+CD25+ regulatory T cells. FOXP3 is a key transcription factor in the development and function of CD4+CD25+ regulatory T cells. Previous studies have demonstrated a genetic association between the FOXP3 gene and some autoimmune diseases. To elucidate the association between the FOXP3 gene and the risk of PV, 408 patients diagnosed with PV and 363 age and sex-matched healthy controls from a cohort of the Chinese majority Han population were recruited. Four single nucleotide polymorphisms (rs2232365, rs3761547, rs3761548 and rs3761549) of the FOXP3 gene were analyzed using the polymerase chain reaction and ligase detection reaction. The major allele of three single nucleotide polymorphisms (SNPs — rs2232365 A, rs3761547 A and rs3761549 C) were associated with an increased risk of PV in a clinical subgroup of female patients, who were less than 40 yrs of age, had a family history of the disease and did not have disease complications (p < 0.05 for all parameters). The haplotype was structured between rs3761547 and rs3761549. An increased risk of PV was observed in haplotype A/A-T/T (p = 0.0055; adjusted OR = 3.188; 95% CI = 0.4354-23.34) and A/G-C/C (p = 0.0082; adjusted OR = 1.288; 95% CI = 0.1529-10.85) between rs3761547 and rs3761549. A synergistic effect was found among the three SNPs. Subjects with the rs2232365AA- rs3761547 AG + GG genotype were more susceptible to PV (p = 0.0393; OR = 2.90; 95% CI = 1.05-7.97). No correlation was found between rs3761548 and the onset of PV. Therefore, the FOXP3 polymorphisms appear to contribute to the risk of psoriasis among the Chinese majority Han population. These findings may aid in our understanding of the pathogenesis of psoriasis. Keywords:

Psoriasis vulgaris, Single nucleotide polymorphisms, Susceptibility, FOXP3 gene, FOX3 mRNA

Psoriasis is a common skin disease characterized by patches of raised, reddish and itching skin that is covered with silvery-white scales and can symmetrically occur anywhere on the body1. There are four clinical patterns of manifestation of psoriasis, of which Psoriasis vulgaris (PV) is the main type. The disease affects approximately 1-3% of the general population throughout the world2 and an increase in the prevalence among the Chinese population has ______________ *Corresponding authors: E-mail:[email protected]; E-mail: [email protected] Abbreviations: HWE, Hardy-Weinberg equilibration; IL-2, interleukin-2; LDR, ligase detection reaction; PV, psoriasis vugaris; SNPs, single-nucleotide polymorphisms; T-regs, regulatory T cells. #Co-first authors (Qiu-he Song and Zhu Shen) contributed equally to this work.

attracted the attention of dermatologists in China. The pathogenesis of psoriasis is currently unclear, although it is believed that immunological and genetic as well as other mechanisms are involved. PV is not only a deep skin disease, but is also associated with other systemic autoimmune disorders3-5. It has been shown that PV is a common immune-mediated autoinflammatory disease and activated T cells play an important role6,7. Regulatory T cells (T-regs) are a well-characterized subpopulation of T cells that exert immunosuppressive effect in order to control the immune response. In addition to FOXP3, IL-2 and IL-2 receptor, a deficiency or functional alteration in other molecules expressed by T cells or non-T cells may affect the development or function of T-regs or self-reactive T cells, which can result in the induction of autoimmune disorders8,9.

26

INDIAN J. BIOCHEM. BIOPHYS., VOL. 49, FEBRUARY 2012

The FOXP3 gene family is located on the X chromosome and encodes a cluster of transcription regulation factors. The predominant characteristic of this protein is a highly conserved forkhead box (FKH) structural domain, which is located at the C-terminus and is considered to be the key motif for DNA binding10. The FOXP3 not only plays an important role during the development of T-reg cells, but also has a role in the expression of cytokines and regulation of other T cell subsets through the NF-AT/NF-κB and Smad7 pathways11,12. Therefore, the dysfunction of FOXP3 has been shown to lead to certain autoimmune diseases4,13-16. Moreover, treatment interventions that directly target the FOXP3 expression in some related diseases have been remarkably effective. A polymorphism in the FOXP3 gene can change the function of FOXP3, which may subsequently lead to an impairment in the number and function of CD4+ CD25+ T-regs and induce certain autoimmune diseases18-20. It is possible that polymorphisms in the FOXP3 gene may be associated with the development of psoriasis, since a marked decrease in the number and function of CD4+ CD25+ T-regs has been observed in patients with psoriasis21,22. Four singlenucleotide polymorphisms (SNPs), especially rs223236 A/G, rs3761547 A/G, rs3761548 C/A and rs3761549 C/T with high minor allele frequency (39.7%, 18.3%, 21.4% and 18.3%, respectively) have been shown to be closely linked to some autoimmune diseases19,23-25. Recently, a CPG T-cell receptorresponsive enhancer has been found in the FOXP3 gene, which has been shown to play a major role in the transcriptional regulation of the gene26. In a population study in northwest China, Gao et al.27 have found that one SNP (rs3761548) is associated with a risk of developing psoriasis. In this study, we have examined the four SNPs (rs2232365, rs3761547, rs3761548 and rs3761549) within the FOXP3 gene in patients from the Southwest region of China. Our results suggest that three of the four SNPs appear to contribute to the risk of psoriasis among the Chinese majority Han population. Materials and Methods Patient demographics

In this study, 408 psoriatic patients (249 male and 159 female; mean age 40.16 ± 14.99 yrs) who were admitted to the South-west Hospital, Third Military Medical University, from January 2008 to May 2009 were analyzed. All patients were diagnosed with PV

by at least two independent dermatologists. The age, sex, age of morbidity and family history of PV as well as any complications were recorded. In addition, 363 healthy controls (219 male and 143 female; mean age 43.74 ± 19.38 yrs) were also recruited. The patients and controls that were enrolled were matched by age and sex (p ≥ 0.05). Since genotype frequencies can vary among different ethnic groups, only the Chinese Han patients and controls were included in the study. Written consent forms were provided to all subjects and signed approvals were collected. Peripheral blood was collected from each subject for genomic DNA extraction. Four loci of FOXP3 obtained from a female reference in the control group were used to maintain the Hardy-Weinberg Equilibration (HWE) balance (p>0.05). The study was approved by the Ethics Review Board of the Southwest Hospital, Third Military Medical University. Genotyping patient samples

Genomic DNA was extracted from whole blood using a genomic DNA Purification Kit (Promega, USA). Genotyping for polymorphisms was conducted using the polymerase chain reaction (PCR), followed by the ligase detection reaction (LDR) method. Four reactions were carried out in order to amplify the fragments of FOXP3 that contained each of the following four SNPs: rs223236 A/G, rs3761547 A/G, rs3761548 C/A and rs3761549 C/T. The four SNPs were located on chromosome X at 49002830, 49004289, 49005185 and 49005405, respectively. The farthest distance between any 2 loci of these SNPs was 2575 bp, which was found between rs2232365 and rs3761547, while the closest distance was 220 bp, which was found between rs3765148 and rs3761547. The sequences of the primers used in the PCR reactions are shown in Table 1. All primers were synthesized by Generay Biotech Co. Ltd. (Shanghai, China). The PCR was performed at 94°C for 2 min, followed by 35 cycles of 30 s at 94°C, 20 s at 60°C and 40 s at 72°C. The reaction was completed with a final extension at 72°C for 3 min. The LDR was performed in a multiplex fashion using three probes (Generay Biotech Co. Ltd.). Probe sequences and conjunctive productions are listed in Table 1. A previously reported method was used28, where the PCR products were pre-heated for 2 min at 94°C, centrifuged for 1 min and then incubated with 0.25 µl of 40 U/µL Taq DNA ligase (New England Biolabs, USA). The LDR consisted of 20 cycles of 30 s at 94°C, followed by 3 min at 60°C in a thermal

27

SONG et al.: SNPs OF FOXP3 INTRON-1 AND PSORIASIS VULGARIS

Table 1—PCR primer sequences and ligase detection reaction probe sequences for the genotyping of FOXP3 gene polymorphisms Polymorphism position

Primer sequence

PCR product (bp)

Probe sequence

rs2232365 A > G S1-F:GAGGGCTTTCAAGGTGAGGAC 460 bp S1-R:GGGCAAGAGGGAGAGTCAAAG Includes site S1 424 bp s3761547 A > G S2-F:CTTGTTCTCTCTTGCTCGCTC S2-R:ATCGTGGATCGTCCAACCTGT Includes site S2 and S3

S1-A:ACAGGCCCCAGCTCAAGAGAGCCCA S1-G:tttACAGGCCCCAGCTCAAGAGAGCCCG S1-R:-P-TCTCTCCTCCTCTCTGTCACTTGCC-FAMS2-A:ttttGCCAGTCCCCTGGATAGAGCGGCAA S2-G:tttttttGCCAGTCCCCTGGATAGAGCGGCAG

rs3761548 C > A

S2-F:CTTGTTCTCTCTTGCTCGCTC S2-R:ATCGTGGATCGTCCAACCTGT

424 bp Includes site S2 and S3

S3-A:ttttttttTGGTTCTGGCTCTCTCCCCTACTGA S3-C:tttttttttttTGGTTCTGGCTCTCTCCCCTACTGC S3-R-P-AGGCCTCAGTTTACCCCTCAGCACCtttttt-FAM-

rs3761549 C > T

S4-F:TCCTCTCCACAACCCAAGAAG S4-R:CCAGATTTTTCCGCCATTGAC

250 bp Includes site S4

S4-C:ttttttttttttAAGCCTGCTGCAGGACAGGCCAGCC S4-T:tttttttttttttttAAGCCTGCTGCAGGACAGGCCAGCT S4-R-P-AGTTCTCGGAACGAAACCTGTGGGGttttttttt-FAM-

S2-R-P-TTGTCAACTTGAAGCCCTGCAGACAttt-FAM-

Results of conjunction S1:50/A, 53/G S2:57/A, 60/G S3:64/A, 67/C

S4:71/C, 74/T

cycler (ABI 9600，Applied Biosystems, USA). The fluorescent signal was detected with an ABI 377 (ABI, Applied Biosystems USA).

were carried out using Statistical Analysis System (version 9.0, SAS Institute Inc, Cary NC).

Statistical analysis

The analyzing tools used were MAPPER31, PROMO32 and Searching Transcription Factor Binding Sites (TFSEARCH)33.

The Chi-square test (χ2-test) was used to evaluate differences in frequency distributions for the selected demographic variables and for genotype of the FOXP3 polymorphisms between the PV cases and the controls. Unconditional univariate and multivariate logistic regression analyses were performed to obtain the adjusted odds ratios (OR) for the risk of PV as well as the 95% confidence interval (CI). The multivariate adjustment consisted of age and sex. The genotype data for each polymorphism were further divided by subgroups of sex, onset age, family history status and disease complications. The associations between the combined genotypes and the haplotypes of FOXP3 polymorphisms and the risk of PV were evaluated by multivariate logistic regression analyses. We further evaluated the interaction between FOXP3 polymorphisms by using logistic regression models. Hardy-Weinberg equilibrium was tested by comparing expected and observed genotype frequencies by the chi-square test only for females in the control group. Linkage disequilibrium coefficients were calculated among the four loci and the LD plot was drawn with Haploview v4.229. The ORs and 95% CI for the haplotypes structured between rs3761547 and rs37611548 were calculated using unphased 3.1.430 with adjustments for age, smoking, alcohol consumption, company diseases and sleeping status. All statistical tests were two-sided and p < 0.05 was considered statistically significant. All calculations

Analysis of candidate transcription factor (TF) binding elements disrupted by SNP site alteration

Results Demographic and clinical data of the patients and controls

The demographic characteristics of the patients are presented in Table 2. As a result of frequency matching, the cases and controls were statistically matched based on age and sex. The mean age was 40.19 ± 14.93 yrs for the PV patients and 41.41 ± 17.1 yrs for the controls (p = 0.125). These were grouped according to the same composition of sex (male vs. female, 0.610 vs. 0.389 for PV patients and 0.603 vs. 0.397 for the controls, respectively, p = 0.843). Disease onset before the age of 40 was considered as early onset psoriasis (onset age 60

9 (2.21) 24 (5.88) 58 (14.22) 106 (25.98) 103 (25.24) 108 (26.47) 40.19 ± 14.93

21 (5.78) 17 (4.68) 37 (10.19) 85 (23.42) 58 (15.98) 145 (39.95) 41.41 ± 17.10

p

χ2

0.580

0．307

Mean age 0.125 Sex M 249 (61.03) 219 (60.33) 0.939 0.039 F 159 (38.97) 144 (39.67) 0.843 As a result of frequency matching, the cases and controls were statistically matched based on age and sex. The mean age was 40.19 ± 14.93 yrs for the PV patients and 41.41 ± 17.1 yrs for the controls (p = 0.125). These were grouped according to the same composition of sex (male vs. female, 0.610 vs. 0.389 for PV patients and 0.603 vs. 0.397 for the controls, respectively, p = 0.843).

Table 3—Stratification analysis of the rs2232365, rs3761547, and rs3761549 genotypes and PV risk by selected variables a

Variable

rs2232365

sex

AA AG GG AG + GG AA AG GG AG + GG rs3761547

M

AA AG GG AG + GG AA AG GG AG + GG

M

0.5036

F

0.0042

Loci

rs3761549 CC CT TT CT + TT CC CT TT CT + TT rs2232365 AA AG GG AG+GG AA AG GG AG+GG rs3761547 AA AG

F

M

F

Onset age < 40

≥ 40

< 40

Pb 0.2888

0.0296

0.3772

0.0046

0.0016

0.6723

0.0043

N case/control (%) 176/149 (70.68/66.82) 39/35 (15.66/15.70) 34/39 (13.65/17.49) 73/74 (29.32/33.18) 123/84 (77.36/60.00) 21/29 (13.21/20.71) 15/27 (9.43/19.29) 36/56 (22.64/40.00) 176/149 (70.68/66.82) 39/35 (15.66/15.70) 34/39 (13.65/17.49) 73/74 (29.32/33.18) 68/74 (27.31/33.18) 123/84 (77.36/60.00) 18/27 (11.32/19.29) 15/26 (9.43/18.57) 33/53 (20.75/37.86) 181/149 (72.69/66.82) 33/35 (13.25/15.70) 35/39 (14.06/17.49) 68/74 (27.31/33.18) 126/87 (79.25/62.14) 18/27 (11.32/19.29) 15/26 (9.43/18.57) 33/53 (20.75/37.86) 77/118 ( 48.13/59.90) 28/44 ( 17.50/22.34) 55/35 ( 34.38/17.77) 83/79 ( 51.88/40.10) 97/110 ( 47.78/52.13) 48/45 ( 23.65/21.33) 58/56 (28.57/26.54) 106/101 (52.22/47.87) 98/146 (61.25/74.11) 27/32 (16.88/16.24)

Pc

0.8212 0.2422 0.3654 0.0276 0.0059 0.0013 0.8212 0.2422 0.3654 0.1652

Adjusted OR ( 95% CI)c 1.00 (reference) 0.94 (0.57-1.56) 0.74 (0.44-1.23) 0.84 (0.57-1.23) 1.00 (reference) 0.50 (0.26-0.93) 0.38 (0.19-0.76) 0.44 (0.27-0.73) 1.00 (reference)

0.0276 0.0059 0.0013

0.94 (0.57-1.56) 0.74 (0.44-1.23) 0.84 (0.57-1.23) 0.76 (0.51-1.12) 1.00 (reference) 0.50 (0.26-0.93) 0.380 (0.190-0.76) 0.440 (0.27-0.73)

0.3420 0.2402 0.1652

1.00 (reference) 0.78 (0.46-1.31) 0.74 (0.45-1.22) 0.76 (0.51-1.12)

0.0204 0.0091 0.0013

0.46 (0.24-0.89) 0.40 (0.20-0.80) 0.43 (0.26-0.72)

0.929 0.415 0.0267

1.00 (reference) 1.03 (0.59-1.78) 0.42 (0.25-0.69 ) 0.62 (0.41-0.95)

0.4466 0.0013 0.0097

0.83 (0.51-1.35) 0.36 (0.20-0.67) 0.55 (0.35-0.87)

0.4336

1.00 (reference) 0.80 (0.45-1.41)

Contd.

29


Table 3—Stratification analysis of the rs2232365, rs3761547, and rs3761549 genotypes and PV risk by selected variables—Contd Locia rs2232365 GG AG+GG AA AG GG AG+GG rs3761549 CC CT TT CT + TT CC CT TT CT + TT rs2232365 AA AG GG AG + GG AA AG GG AG + GG rs3761547 AA AG GG AG + GG AA AG GG AG + GG rs3761549 CC CT TT CT + TT CC CT TT CT + TT

Variable sex

≥ 40

< 40

≥ 40

family history Y

N

Y

N

Y

N

Pb

0.3267

0.0046

0.1692

0.0027

0.5176

0.0013

0.6683

0.0013

0.6985

N case/control (%) 35/19 (21.88/9.64) 62/51 (38.75/25.89) 135/153 (66.50/72.51) 37/28 (18.23/13.27) 31/30 (15.27/14.22) 68/58 (33.50/27.49) 100/151( 62.50/76.65) 25/26 ( 15.63/13.20) 35/20 ( 21.88/10.15) 60/46 (37.50/23.35) 136/156 (67.00/73.93) 37/25 (18.23/11.85) 30/30 (14.78/14.22) 67/55 (33.00/26.07) 173/177 (47.79/57.28) 76/71 (20.99/22.98) 113/61 (31.22/19.74) 189/132 (52.21/42.72) 51 (51.52) 18 (18.18) 30 (30.30) 48 (48.48) 232/233 (64.09/75.40) 64/47 (17.68/15.21) 66/29 (18.23/9.39) 130/76 (35.91/24.60) 66 (66.67) 13 (13.13) 20 (20.20) 33 (33.33) 235/238 (64.29/77.02) 62/41 (17.13/13.27) 65/30 (17.96/9.71) 127/71 (35.08/22.98) 69 (69.70) 10 (10.10) 20 (20.20) 30 (30.30)

Pc

Adjusted OR ( 95% CI)c

0.0013 0.0097

0.36 (0.20-0.67) 0.55 (0.35-0.87)

0.1447 0.5754 0.1846

0.67 (0.39-1.15 ) 0.85 (0.49-1.48) 0.75 (0.50-1.15)

0.2266 0.0016 0.0039

1.00 (reference) 0.69 (0.38-1.26) 0.38 (0.21-0.69) 0.51 (0.32-0.80)

0.0626 0.6285 0.1223

0.59 (0.34-1.03) 0.87 (0.50-1.52) 0.72 (0.47-1.09)

0.6439 0.0008 0.0143

0.91 (0.62-1.34 ) 0.53 (0.36-0.77) 0.68 (0.50-0.98 )

0.9637 0.9532 0.9604 0.1422 0.0006 0.0016

0.73 (0.48-1.11 ) 0.44 (0.27-0.70) 0.58 (0.42-0.82)

0.9700 0.9628 0.3693 0.0541 0.0010 0.0007

0.65 (0.42-1.01) 0.46 (0.29-0.73) 0.55 (0.39-0.78)

0.9733 0.9630 0.9546

a

The observed genotype frequencies in the controls for female patients were in agreement with the Hardy-Weinberg equilibrium. Two-sided Chi-square test for distribution of genotype frequencies between the cases and controls. c Two-sided Chi-square test for distribution of genotypes frequencies among genotypes. Odds ratios (OR) were obtained from a multivariate logistic regression model with adjustment for age and sex; 95% CI, 95% confidence interval. b

control group fitted the Hardy-Weinberg equilibrium (rs2232365: p = 0.0035; rs3761547: p = 0.3884; rs3761548: p = 0.1118; rs3761549: p = 0.1503). To further assess the association between the three SNPs of the FOXP3 gene (rs2232365, rs3761547, and rs3761549) and PV, the patients were divided into subgroups according to age, sex, or family history. As shown in Table 3, the risk of PV was associated with

a major allele of these three SNPs in the group with an age of onset under 40 in the female group or in the group with a family history of the disease. In patients without complications, the minor alleles of these three SNPs were associated with a low risk of PV (Table 4). Therefore, the homozygotes for major alleles of the three SNPs (rs2232365, rs3761547 and rs3761549) had a high susceptibility to PV.

30


Table 4—Genotype frequencies of the four loci of FOXP3 polymorphisms in psoriatic patients with or without complication and their associations with psoriasis risk Complication

Site/Genotype

Case (408) N (%)

Control (363) N (%)

P

Adjusted OR (95% CI)

rs2232365 0.1360 GG 83 (20.54) 106 (29.20) AG 81 (20.05) 69 (19.01) 0.0655 1.50 (0.97-2.31) N AA 214 (52.97) 164 (45.18) 0.0045 1.67 (1.17-2.37) AA 214 (52.97) 164 (45.18) 0.1733 AG+GG 164 (40.59) 175 (48.21) 0.0276 0.72 (0.54-0.96) GG 7 (1.73) 7 (1.93) 0.6590 1.28 (0.43-3.79) AG 7 (1.73) 7 (1.93) 0.6590 1.28 (0.43-3.79) Y AA 12 (2.97) 10 (2.75) 0.3455 1.53 (0.63-3.72) AA 12 (2.97) 10 (2.75) 0.8492 0.92 (0.39-2.18) AG+GG 14 (3.47) 14 (3.86) 0.4972 0.77 (0.36-1.65) rs3761547A/C 0.0537 GG 44 (10.89) 64 (17.63) 1.00 AG 55 (13.61) 60 (16.53) 0.2876 1.33 (0.79-2.27) N AA 279 (69.06) 215 (59.23) 0.032 1.89 (1.24-2.88) AA 279 (69.06) 215 (29.23) 0.0227 1.00 AG + GG 99 (24.50) 124 (34.16) 0.0028 0.62 (0.45-0.85) GG 4 (0.99) 2 (0.55) 0.2291 2.91 (0.51-16.58) AG 5 (1.24) 4 (1.10) 0.3023 1.82 (0.46-7.15) Y AA 17 (4.21) 18 (4.96) 0.4165 1.37 (0.64-2.96) AA 17 (4.21) 18 (4.96) 0.3642 0.73 (0.37-1.45) AG + GG 9 (2.23) 6 (1.65) 0.7865 1.16 (0.41-3.30) rs3761549C/T 0.0287 TT 45 (11.41) 63 (17.36) 1.00 CT 46 (11.39) 58 (15.98) 0.7062 1.11 (0.64-1.91) N CC 287 (71.04) 218 (60.06) 0.0044 1.84 (1.21-2.81) CC 287 (71.04) 218 (60.06) 0.0069 1.00 CT + TT 91 (22.52) 121 (33.33) 0.0007 0.57 (0.41-0.79) TT 4 (0.99) 2 (0.55) 0.2462 2.800 (0.49-15.95) CT 5 (1.24) 4 (1.10) 0.4231 1.75 (0.45-1.88) Y CC 17 (4.21) 18 (4.96) 0.4744 1.32 (0.62-2.84) CC 17 (4.21) 18 (4.96) 0.3425 0.72 (0.36-1.42) CT + TT 9 (2.23) 6 (1.65) 0.8072 1.14 (0.40-3.25) P value was calculated by two-sided Chi-square test for distribution of genotype frequencies between the cases and controls. Odds ratios (OR) were obtained from a multivariate logistic regression model with adjustment for age and sex; 95% CI, 95% confidence interval.

Fig. 1—Schematic diagram of linkage disequilibrium for the four SNP loci of the FOXP3 gene in this study from the Chinese Han population

Two SNPs rs3761547 and rs3761549 showed linkage disequilibrium (D' = 0.96, r2 = 0.853; Fig. 1) and seven haplotypes were constructed between them

(Table 5). Because psoriasis is always induced by infection35, the risks were evaluated by ORs adjusted for age, smoking, alcohol consumption and sleeping status as well as accompanying diseases, which included chronic gastritis, urinary tract infection and chronic oral or upper respiratory tract infections.An increased risk of PV was observed for haplotype A/A-T/T (p = 0.0055; adjusted OR = 3.188; 95% CI = 0.4354-23.34) and A/G-C/C (p = 0.0082; adjusted OR = 1.288; 95% CI = 0.1529-10.85) compared to A/A-C/C (Table 5). Based on the results from the haplotype analysis, which indicated that variations in these SNPs might alter the risk of developing psoriasis, we further evaluated their polymorphisms and association between the combined genotypes of FOXP3 (rs2232365, rs3761547 and rs3761549) and risk of PV. We first analyzed any two of the three

31


Table 5—Association between haplotype of rs3761547 and rs3761549 and psoriatic disease in a Chinese population. Haplotypes

Case (%) (N = 408)

Control (%) (N = 363)

A/A-C/C A/A-T/T A/G-C/C A/G-C/T G/G-C/G G/G-C/T G/G-T/T

321 (78.67) 5 (1.23) 3 (0.73) 18 (4.41) 5 (1.23) 0 (0) 56 (13.73)

245 (67.49) 2 (0.55) 3 (0.83) 26 (7.16) 9 (2.48) 1 (0.28) 77 (21.21)

P*

Adjusted OR (95% CI)

0.6749 0.0055 0.0082 0.0716 0.0247 0.0027 0.2121

1.00 (reference) 3.188 (0.4354-23.34) 1.288 (0.1529-10.85) 0.4337 (0.1689-1.114) 0.2615 (0.05287-1.293) 2.966e-007 0.3983 (0.2328-0.6815)

P value was calculated by two-sided Chi-square test for distribution of genotype frequencies between the cases and controls. *The ORs were adjusted for age, smoking, alcohol drinking, company diseases and sleep status.

Table 6—Association risk analysis of psoriasis infection by the combined genotypes among the cases and controls constituted with polymorphisms of the FOXP3 gene Site/Combined genotype rs2232356 AA AA AG+GG AG+GG rs2232356 AA AA A G + GG AG + GG rs3761547 AA AA A G + GG AG + GG

rs3761547 AA AG+GG AA AG+GG rs3761549 CC CT+TT CC CT+TT rs3761549 CC CT + TT CC CT+TT

Case (408) N (%)

Control (363) N (%)

210（51.47） 18 (4.41) 89 (21.81) 91 (22.30)

169 (46.56) 5 (1.38) 64 (17.63) 125 (34.44)

218 (53.43) 10 (2.45) 89 (21.81) 91 (22.30)

172 (47.38) 2 (0.55) 64 (17.63) 125 (34.44)

299 (73.28) 0 8 (1.96) 101 (24.75)

233 (64.19) 0 3 (0.83) 127 (34.99)

Pa

Pb

Adjusted OR (95% CI)c

0.0393 0.5613 0.0019

1.00 (reference) 1.00 (reference) 2.897 (1.054-7.965) 1.119 (0.766-1.636) 0.586 (0.418-0.821)

0.0790 0.6309 0.0012

1.00 (reference) 3.944 (0.853-18.238) 1.097 (0.752-1.602) 0.574 (0.410-0.804)

0.2845 0.0027

1.00 (reference) NA 2.076 (0.545-7.909) 0.620 (0.453-0.847)

0.0356

0.0004

0.0043

polymorphisms. As shown in Table 6, the evident interactions were between each other among these three loci. When the combined genotype rs2232365AA-rs3761547AA was used as the reference, an increased risk of PV was observed in those who carried the genotypes rs2232365AArs3761547 AG and GG (p = 0.0393; OR = 2.897; 95% CI: 1.054-7.965). A decreased risk of PV was observed in patients who carried rs2232365AG + GGrs3761547 AG + GG (p = 0.0019; adjusted OR = 0.586; 95% CI = 0.418-0.821), rs3761547AG + GGrs3761549 CT + TT (p = 0.0027; adjusted OR = 0.62; 95% CI = 0.453-0.847) and rs2232365 AG + GGrs3761549 CT + TT (p = 0.0012; adjusted OR = 0.574; 95% CI = 0.41-0.804), when the high frequency homozygote of each site was used as the reference.

Discussion It is well-known that the etiology and mechanisms of psoriasis involve multiple factors. Previous studies have revealed that the pathogenesis and clinical manifestation of psoriasis vary according to differences in the age of first onset, gender, environmental factors and psychological states36. It is now believed that psoriasis is a chronic inflammatory hyperplastic dermatoses with immune disorder that is determined by multiple genes and can be induced by environmental factors37. A series of transcription factors encoded by the FOXP3 gene play a critical role in maintaining the quantity and quality of T-regs in the peripheral blood, which are crucial for the stabilization of milieu interne8,11,14. Using a calculation method based on fuzzy matching and online searching, we respectively

32


predicted the binding sites of the transcription factors that are located in or close to the FOXP3 intron-1 (Gene ID: 50943 in GenBankTM). The T cell receptor-responsive enhancer in the FOXP3 intron-1 increases the duplicating function up to 10-1000 times26. From this analysis, we concluded that the intervening sequence, which functions as a promoter or enhancer can affect transcription, a finding which was contrary to the traditional understanding of transcriptional regulation38-40. Moreover, we found that SNP occurrence can affect both the combination and function of the transcription factors of the gene (detailed in the Supplementary Table). Therefore, the variation of transcription factors would affect the subsequent FOXP3 duplication and translation26. The occurrence of SNPs induced by various types of factors leads to an imbalance of T-regs and subsequently resulting to psoriasis23, 41. The associations between four SNPs in the FOXP3 gene and PV were also investigated in this study. The results demonstrated that the major alleles of the three FOXP3 SNPs (rs2232365AA, rs3761547AA and rs3761549 CC) were associated with a significantly increased risk of PV. Stratified analysis of clinical outcomes revealed that the homozygotes of major alleles of these three SNPs increased the risk of PV in early-onset psoriatic patients. This result was in agreement with the hypothesis that polymorphisms may have a higher heritability in early-onset psoriasis than in late-onset psoriasis. The same result was also found in patients with a family history of the disease, which was consistent with previous studies34, indicating that the genetic mode plays an important role in the PV paroxysm mechanism. Since the FOXP3 gene is located on the X chromosome, the morbidity of PV (1.23%) was associated with the gene. Although randomized grouping can affect the results, studies have confirmed that gender plays an important role in the recurrence of psoriasis42. Our results also showed that the high frequency homozygote increased the risk of PV in females. Li et al.2 found an association between the risk of psoriasis and specific SNPs among the Chinese population. It is also reported that the NFKB1-94 ins/delATTG WW genotype has a high susceptibility to PV among males less than 40 yrs-old with a psoriasis area and severity index (PASI) > 20 and without a family history of the disease2. Gao et al.27 examined the association between the four FOXP3 SNPs (-6054, deletion/ ATT; -3279, A/C; - 924, A/G;

and IVS9+459, A/G) and the risk of PV using PCR-SSP gene sorting. Their results have shown that FOXP3-3279AC and FOXP3-IVS9+459GG are associated with the risk of psoriasis among Han Chinese, while FOXP3-6054 deletion ATT and FOXP3-924A/G have a protective effect against PV. In their study, stratified assessment of clinical subgroups, which was the result of an association between combined genotypes in the FOXP3 rs3761548 A/C and rs2280883A/G polymorphisms with clinical characteristics of psoriasis, has shown that these genotypes are associated with serious cases of psoriasis (PASI>20), as well as with male patients. Based on LDR gene classification, which differs from Gao et al.27, three FOXP3 SNPs (rs2232365, rs3761547 and rs3761549) were linked to PV among clinical subgroups of Chinese patients originating from Southwest China, including the age at initial onset, sex, family history, lack of complications and the interaction of the loci. Therefore, although previous studies have shown a link between FOX3P genotypes and the severity of psoriasis, our results from three specific SNPs within the loci may better explain the clinical manifestations of the disease. The discrepancy between our findings and those by Gao et al.27 might be explained by the region from which they were obtained and the limited number of cases analyzed43,44, since both studies were performed in a single hospital with local patients and different geographical environments and climates. A precise genetic association study involving multiple centers and regions may provide a sound foundation for further research into the involvement of the FOXP3 gene with autoimmune diseases. Acknowledgements We would like to extend our gratitude to all of the patients and healthy volunteers who assisted in this study. This research was supported by the National Natural Science Foundation of China (No. 30801013 and 30901242), Innovation Project of an Outstanding Young Scholar of the Third Military Medical University, and the Natural Science Foundation Project of CQ CSTC (No. CSTC 2009BA5010). References 1 Lowes M A, Bowcock A M & Krueger J G (2007) Nature 445, 866-873 2 Li H, Gao L, Shen Z, Li C Y， Li K , Li M, L Y J, Li C X, Li, Gao T W & Liu Y F (2008) Arch Dermatol Res 300, 425-433

SONG et al.: SNPs OF FOXP3 INTRON-1 AND PSORIASIS VULGARIS 3 Jin Y, Mailloux C M, Gowan K, Riccardi S L, LaBerge G, Bennett D C, Fain P R & Spritz R A (2007) N Engl J Med 356, 1216-1225 4 Najarian D J & Gottlieb A B (2003) J Am Acad Dermatol 48, 805-821 5 Rosenber P, Johannesson U A, Ros A, Lindholm J, Kinnman N & Hultcrantz R (2007) J Hepatol 46, 1111-1118 6 Conrad B C, Tonel G, Gilliet M & Nestle F O (2007) Trends Immunol 28, 51-57 7 Griffiths C E M & Barker J N W N (2007) Lancet 370, 263-271 8 Sakaguchi S, Ono M, Setoguchi R, Yagi H,Hori S, Fehervari Z, Shimizu J, Takahashi T & Nomura T (2006) Immunol Rev 212, 8-27 9 Pérez-Lorenzo R, Núñez-Oreza L A, Garma-Quen P M, López-Pacheco E & Bricaire-Bricaire G (2004) Int J Dermatol 45, 547–553 10 Kaestner K H, KnÖchel W & Martinez D E (2000) Genes Dev 14, 142-146 11 Fontenot J D, Gavin M A & Rudensky AY (2003) Nat Immunol 4, 330-336 12 Dai X, Yamasaki K, Shirakata Y, Sayama K & Hashimoto K (2004) J Invest Dermatol 123, 1078-1085 13 Kasprowicz D J, Smallwood P S, Tyznik A J & Ziegler S F (2003) J Immunol 171, 1216-1223 14 Venken K, Hellings N, Hensen K, Rummens J, Medaer R, D'hooghe M B, Dubois B, Raus J & Stinissen P (2006) J Neurosci Res 83, 1432-1446 15 Jaeckel E, von Boehmer H & Manns M P (2005) Diabetes 54, 306-310 16 Alvarado-Sanchez B, Hernandez-Castro B, Portales-Perez D, Baranda L, Layseca-Espinosaa E, Abud-Mendozac C, Cubillas-Tejedab A C & Onzález-Amaro R (2006) J Autoimmun 27, 110-118 17 Karagiannidis C, Akdis M, Holopainen P, Woolley N J, Hense G,Rűckert B, Mantel P, Menz G,Akdis C A, Blaser K & Schmidt-weber (2004) Allergy Clin Immunol 114, 1425-1433 18 Ban Y, Tozaki T, Tobe T, Ban Y, Jacobson E M, Concepcion E S & Tomer Y (2007) J Autoimmun 28, 201-207 19 Bassuny W M, Ihara K, Sasaki Y, Kuromaru R , Kohno H, Matsuura N & Hara T (2003) Immunogenetics 55, 149-156 20 Oertelt S, Kenny T P, Selmi C, Invernizzi P, Podda M & Gershwin M E (2005) Clin Develop Immunol 12, 259–263 21 Kagen M H, McCormick T S & Cooper K D (2006) Ernst Schering Res Found Workshop 56, 193–209 22 Verhagen J, Akdis M, Traidl-Hoffmann C, SchmidGrendelmeier P, Hijnen D J,Knol E F, Behrendt H, Blaser K & Akdis C A (2006) J Allergy Clin Immunol 117, 176–183

33

23 Owen C J, Eden J A, Jennings C E, Wilson V, Cheetham T D & Pearce S H S (2006) J Mol Endocrinol 37, 97-104. 24 Zhang L, Zhang Y, Desrosiers M, Wang C S,Zhao Y& Han D M (2009) Hum Immunol 70, 930–934 25 Hashimura Y, Nozu K, Kanegane H, Miyawaki T, Hayakawa A , Yoshikawa Ne , Nakanishi K , Takemoto M , Iijima K & Matsuo M (2009) Pediatr Nephrol 24, 1181-1186 26 Kim H P & Leonard W J (2007) J Exp Med 204, 1543-51. 27 Gao L, Li K, Li F, et al (2009) J Dermatol Sci 57, 51-56 28 Consolandi C, Busti E, Pera C, Delfino L, Ferrara G B, Bordoni R, Castiglioni B, Bernardi L R, Battaglia C & Bellis G D (2003) Human Immunol 64, 168-178 29 Barrent J C, Fry B, Maller J & Daly M J (2005) Bioinformatics 21, 263-265 30 Dudbridge F (2008) Human Heredity 66, 87-98 31 Marinescu V D, Kohane I S & Riva A (2005) BMC Bioinformatics 6, 79 32 Messeguer X, Escudero R, Farré D, Núñez O, Martínez J & Albà M M (2002) Bioinformatics 18, 333-334 33 Kel A E, Gößling E, Reuter I, Cheremushkin E, Kel-Margoulis O V & Wingender E (2003) Nucleic Acids Res 31, 3576 -3579 34 Henseler T & Christophers E (1985) J Am Acad Dermatol 13, 450-456 35 Lindegard B. (1986) Dermatologica;172, 298-304 36 Griffiths C E (2003) J Eur Acad Dermatol Venereol 17, 1-5 37 Sugiyama H, Gyulai R, Toichi E,Garaczi E, Shimada S, Stevens S R, Mccormick T S & Cooper K D (2005) J Immunol 174, 164-73 38 Schjerven H, Brandtzaeg P & Johansen F E (2001) J Immunol 167, 6412-20 39 Minekura H, Kang M J, Inagaki Y, Cho Y, Suzuki H, Fujino T & Yamamoto T T (2001) Biochem Biophys Res Commun 286, 80-86 40 Seth P, Mahajan V S & Chauhan S S (2003) Gene 321, 83-91 41 Bjørnvold M, Amundsen S S, Stene L C, J oner G, Dahl-Jørgensen K, Njølstad P R, E K J, Ascher H & GudjÒnsdòlti A H (2006) J Autoimmun 27, 140-144 42 Capon F,Helms C, Veal CD, Tillman D, Burden A D, Barker J N, Bowcock A M & Trembath R C(2004) J Med Genet; 41, 459-460 43 Goldenkova-Pavlova I V, Piruzyan A L, Abdeev R M, Khripach L V, Radzhabov M O & Piruzyan L A (2006), Genetika 42, 1137-1142 44 Zhukova O V, Shneider Iu V, Morozova I Iu, Shil’nokova I N, Semikov A V & Goldenkova I V (2005) Genetika 41, 1702–1706

34


Supplementary Table —Candidate TF binding elements disrupted by rs2232365, rs3761547, rs3761548 and rs3761549 sites variation analyzed with PROMO, TFSEARCH, and MAPPER database Database PROMO

locus 2232365

Transcription factors Allele: A Allele: G c-Jun TFII-I

YYI

c-Jun

TFII-I

YYI

TFSEARCH

edxA Ap-1 NKX-2 GATA-1

MAPPER

Androgen C/EBPalpha

Brief comment c-Jun, a human proto-oncogene, has specific DNA binding activity; encode proteins together with c-fos proto-oncogenes that form a complex which regulates transcription from promoters containing AP-1 activation elements YY1, a ubiquitous nuclear transcription factor with a cis-regulatory sequence, and also an inhibitor of serum response factor effects TFII-I, a transcription initiation factor that activates core promoters through an initiator element (Inr).

C/EBPalpha and their regulated genes are highly correlated with cell proliferation, cell differentiation, cell apoptosis, inflammation, stress response, lipids metabolism and changes in the extracellular matrix. Myc-Max

PROMO

3761547

A C/EBPalpha

G

FOXP3 C-Myb

AP-2-alphaA

EBF

AP-1 GATA-3

TFSEARCH

GATA-3 C/EBPalpha Oct-1

-------

MAPPER

C/EBPalpha Sp2 RREB-1

--RREB-1: detected positively in heart and kidney, enhances calcitonin and represses angiotensinogen expression.

staf 3761548 PROMO

C AP-2- alpha A

TFSEARCH

c-Myb c-Myb

A factor which is crucial for normal hematopoiesis; activates the M-CSF receptor promoter in a synergistic manner. In this article c-Myb: a member of Myb proto-oncogene family, playing specific roles in hematopoietic cell and T cell function. There is likely a human c-Myb binding site change when allele C is changed to A, although the c-Myb (T00138, M00004) element was from species of Mus musculus in this algorithm. The dissimilarity of c-Myb binding site (8.4439%) was more near the dissimilarity margin (15%) of FOXP3 An inhibitor of nuclear receptors which regulate gene expression, encoded by the human proto-oncogene c-jun,,and their binding protien could be enhanced by the phorbol ester-inducible. The zinc-finger transcription factor GATA-3 is expressed in haematopoietic cells and in the developing kidney and nervous system. Within the haematopoietic lineages, expression of GATA-3 is restricted to thymocytes and T cells. Functionally important GATA-3 binding sites have been identified in multiple T-cell-specific genes. GATA-3 is an essential and specific regulator of early thymocyte development.

RXR-VDR A AP-2-alpha A -----

35

SONG et al.: SNPs OF FOXP3 INTRON-1 AND PSORIASIS VULGARIS HEN1

MAPPER

--RREB-1 PPARgamma

PROMO

TFSEARCH

MAPPER

3761549

Allele: C

Allele: T

ENKTF-1

---

AML-1a

---

SREBP C/EBPalpha

-----

C/EBPalpha AML-1a E47s c-REL

HEN1: an E-box binding factor, having important roles in the development of nervous system. PPAR-gamma: modulating adipocyte homeostasis and the activity of T cells.

differentiation,

glucose

The promoter distal element, in the presence of a functional ENKCRE-2 element, this element synergistically augments cAMlP and neuropeptide inducible transcription. The AML-1-encoded transcription factor, an transcription factor that affects the timing of the mammalian cell cycle, regulates numerous hematopoietic-specific genes. Inappropriate expression of AML-1family proteins is oncogenic in cell culture systems. The DNA binding and transactivation domains of AML-1A were required for altering the cell cycle.