An ATR- and Cdc7-Dependent DNA Damage Checkpoint ... - Cell Press

Download PDF
26 downloads 1429 Views 361KB Size Report
Comment
U of -PPase (NEB) in a reaction buffer containing 50 mM Tris-HCl chromatin was .... ATM and ATR: networking cellular responses to on licensing but not on ...
Molecular Cell, Vol. 11, 203–213, January, 2003, Copyright 2003 by Cell Press

An ATR- and Cdc7-Dependent DNA Damage Checkpoint that Inhibits Initiation of DNA Replication Vincenzo Costanzo,1 David Shechter,1,2 Patrick J. Lupardus,4 Karlene A. Cimprich,4 Max Gottesman,3 and Jean Gautier1,* 1 Department of Genetics and Development 2 Integrated Program in Cellular, Molecular and Biophysical Studies 3 Institute of Cancer Research Columbia University New York, New York 10032 4 Department of Molecular Pharmacology Stanford University Stanford, California 94305

Summary We have analyzed how single-strand DNA gaps affect DNA replication in Xenopus egg extracts. DNA lesions generated by etoposide, a DNA topoisomerase II inhibitor, or by exonuclease treatment activate a DNA damage checkpoint that blocks initiation of plasmid and chromosomal DNA replication. The checkpoint is abrogated by caffeine and requires ATR, but not ATM, protein kinase. The block to DNA synthesis is due to inhibition of Cdc7/Dbf4 protein kinase activity and the subsequent failure of Cdc45 to bind to chromatin. The checkpoint does not require pre-RC assembly but requires loading of the single-strand binding protein, RPA, on chromatin. This is the biochemical demonstration of a DNA damage checkpoint that targets Cdc7/Dbf4 protein kinase.

Introduction DNA damage activates a variety of physiological responses, including cell cycle arrest and activation of DNA repair (Zhou and Elledge, 2000). Signal transduction pathways called DNA damage checkpoints mediate cell cycle arrest. The best-characterized damage checkpoints are the ATM-dependent checkpoints that block G1-S transition (Khanna et al., 2001). ATM is a member of the DNA damage-activated protein kinase family that includes ATR and DNA-PK (Durocher and Jackson, 2001; Shiloh, 2001). DNA double-strand breaks (DSBs) trigger ATM activation and downstream signaling that induce p53-dependent and p53-independent responses. The p53-dependent cell cycle checkpoint entails p21mediated inactivation of Cdk2/Cyclin E. The p53-independent checkpoint downregulates Cdk2/Cyclin E activity by phosphorylation of Cdk2 at Tyr15 (Costanzo et al., 2000; Falck et al., 2001). Cdk2 protein kinase activity is required for Cdc45 binding to the prereplicative complex (pre-RC) and subsequent origin firing (Costanzo et al., 2000; Jares and Blow, 2000; Walter, 2000). ATR is a chromatin binding protein kinase (HekmatNejad et al., 2000) that is activated by UV irradiation and *Correspondence: [email protected]

by DNA replication block induced by aphidicolin (Cliby et al., 1998; Guo et al., 2000; Liu et al., 2000; Wright et al., 1998). ATR activation by aphidicolin during S phase downregulates Cdc2/Cyclin B and inhibits mitosis entry. Protein kinases of the Chk family act downstream of ATM and ATR. ATM activates Cds1/Chk2, whereas ATR activates Chk1. In turn, Chk2 and Chk1 phosphorylate Cdc25A and Cdc25C, thus inhibiting Cdk2 and Cdc2, respectively (Zhou and Elledge, 2000). This ATM-Chk2Cdc25A-Cdk2 signal transduction pathway is the paradigm for DNA damage checkpoint signaling. Cdc7 protein kinase binds to and is activated by the cell cycle-dependent Dbf4 protein. Cdc7 is required for initiation of DNA replication (Jares et al., 2000; Sclafani, 2000). In combination with Cdk2 protein kinase, Cdc7 promotes binding of Cdc45 to the pre-RC (Jares and Blow, 2000; Mimura and Takisawa, 1998; Walter, 2000; Zou and Stillman, 1998). The Cdc7 target is MCM complex bound at the preRC. Of the various MCM proteins, Cdc7/Dbf4 preferentially phosphorylates MCM2 protein in vitro (Brown and Kelly, 1998; Lei et al., 1997; Masai et al., 2000). Deletions of either Cdc7 or Dbf4 are bypassed in mcm5-bob1 mutants (Sclafani, 2000). Finally, Cdc7 binds to MCM protein complex in a cell cycledependent manner (Roberts et al., 1999). Taken together, these data suggest that Cdc7-dependent phosphorylation of MCM at the pre-RC promotes efficient loading of Cdc45 and subsequent origin firing. Genetic analysis suggests that Cdc7/Dbf4 could be a target for the HU-induced, intra-S phase checkpoint in yeast (Jares et al., 2000). In S. pombe, Hsk1 (Cdc7) is phosphorylated in a Cds1-dependent manner in response to HU (Brown and Kelly, 1999; Snaith et al., 2000). Similarly, S. cerevisiae and S. pombe Rad53/Cds1 phosphorylate Dbf4/Dfp1 following HU treatment (Weinreich and Stillman, 1999; Snaith et al., 2000). However, the intra-S phase checkpoint is still operational in yeast strains that bypass the requirement for Cdc7/Dbf4 kinase (cdc7ts/mcm5-bob1), arguing against Cdc7/Dbf4 being an essential target for the intra-S phase checkpoint (Jares et al., 2000). To date, there is no evidence for the participation of Cdc7 in the DNA damage response. DNA topoisomerase II (TopII) is an essential enzyme that plays a role in many aspects of DNA metabolism (Larsen et al., 1996; Osheroff et al., 1991; Warburton and Earnshaw, 1997). TopII interconverts topological isomers of DNA by passing DNA segments through a transient DSB generated in a second segment. TopII regulates the extent of DNA winding and resolves DNA knots. Etoposide, an inhibitor of TopII enzymes, is an effective agent in cancer therapy (Fortune and Osheroff, 2000; Kellner et al., 2002; Pommier, 1993). Etoposide acts after TopII cleaves DNA, leaving a lesion in which TopII is covalently linked to DNA 5⬘ termini, whereas the 3⬘ termini are free. These lesions likely develop into single-strand DNA gaps and double-strand breaks. Etoposide inhibits S phase progression in mammalian cells (Lallev et al., 1993) by an as yet unknown mechanism. Here, we have explored how single-strand DNA gaps generated following etoposide or exonuclease treat-

Molecular Cell 204

Figure 1. Inhibition of Chromosomal DNA Replication by Etoposide (A) Genomic DNA replication was monitored by 30 min pulses of ␣-32P-dATP. Time course of incorporation into sperm chromatin incubated with untreated extracts (Control), extracts supplemented with 30 ␮M etoposide (Etoposide), or extracts supplemented with 30 ␮M etoposide and 5 mM caffeine (Etoposide ⫹ caffeine) are shown. (B) pBluescript (pBS) replication was monitored by incorporation of ␣-32P-dATP. pBS was incubated in HSS at 50 ng/ul for 1 hr at 23⬚C. NPE containing ␣-32P-dATP was added in a 2:1 ratio with respect to HSS-assembled pBS for an additional 30 min either alone (Control), in the presence of 30 ␮M etoposide (Etoposide), or in the presence of 30 ␮M etoposide and 5 mM caffeine (Etoposide ⫹ caffeine).

ment affect DNA replication in Xenopus egg extracts. We find that RPA binding to single-strand DNA in these gaps induces an ATR-dependent checkpoint that inhibits origin firing by downregulating Cdc7-Dbf4 protein kinase activity. Results Etoposide Induces a DNA Damage Checkpoint Exposure to etoposide rapidly inhibits DNA synthesis in mammalian cells (Lallev et al., 1993). We have investigated the mechanism of this reaction in cell-free extracts derived from Xenopus eggs. DNA replication was monitored by incorporation of ␣ 32 P-dATP into genomic DNA followed by isolation of the reaction products by agarose gel electrophoresis (Figure 1A). Replication was initiated by addition of demembranated sperm nuclei (5,000 nuclei/␮l) to the extracts, and followed in 30 min pulses for 90 min, at which time genomic DNA replication was complete (Figure 1A, lanes 1–3). Addition of etoposide (30 ␮M) with nuclei completely blocked DNA replication; 32P-dATP incorporation was reduced to background levels (Figure 1A, lanes 4–6). Addition of 5 mM caffeine along with etoposide restored 32P-dATP incorporation to control levels (Figure 1A, lanes 7–9). The full recovery of DNA replication indicates that topological constraints introduced by etoposide/TopII complexes do not per se block DNA synthesis. The ability of caffeine to rescue DNA replication suggests that etoposide elicits a true checkpoint that operates through activation of protein kinase(s) of the ATM/ATR family. Sperm nuclei undergo decondensation and chromatin remodeling prior to DNA replication. We wished to determine if the checkpoint exclusively blocked replication of chromatin-assembled DNA. Chromatin-free plasmid DNA replicates in a membrane-free high-speed supernantant (HSS) supplemented with nucleoplasmic extract (NPE) (Walter and Newport, 2000; Walter et al., 1998). Under these conditions, most replication products are supercoiled DNA molecules with a small frac-

tion of nicked circular molecules (Figure 1B, lane 1). Addition of etoposide to NPE completely inhibited 32PdATP incorporation into supercoiled DNA molecules (Figure 1B, lane 2). As was the case for DNA in complex with chromatin, synthesis of supercoiled plasmid DNA was restored by addition of 5 mM caffeine (Figure 1B, lane 3). Labeling of nicked circular and linear DNA molecules, generated by etoposide, is likely due to originindependent DNA repair synthesis. Note that repair synthesis was not affected by caffeine (compare Figure 1B, lanes 2 and 3). Thus caffeine does not block DNA damage induced by etoposide, but rather, the checkpoint activated by this damage. Checkpoint Signaling Is ATR Dependent Proteins of the ATM/ATR family are critical to checkpoint pathways activated by DNA damage. A role for ATM and/or ATR in the etoposide-induced checkpoint was suggested by the sensitivity of the checkpoint to caffeine. Addition of ATR-neutralizing antibodies (Lupardus et al., 2002) to etoposide-treated extracts restored DNA replication, demonstrating that signaling was ATR dependent (Figure 2A, lane 5). In contrast, ATM-neutralizing antibodies (Costanzo et al., 2000) did not stimulate DNA synthesis (Figure 2A, lane 4), indicating that the etoposide checkpoint is ATM independent. The requirement for ATR was confirmed by depleting X-ATR from the extract, using an X-ATR antibody different from the above (Hekmat-Nejad et al., 2000). Etoposide treatment of mock-depleted extracts inhibited DNA replication (Figure 2B, lane 3), whereas X-ATR depletion restored DNA replication in etoposide-treated extracts (Figure 2B, lane 4). The DNA replication inhibitor aphidicolin activates ATR and enhances its binding to chromatin (You et al., 2002). To determine whether ATR was recruited to etoposide-damaged DNA, we measured chromatin-bound ATR in chromatin purified from control or etoposidetreated extracts. Etoposide induced a dramatic increase of ATR associated with chromatin (Figure 2C, lane 3). This association was not reversed by caffeine (Figure

ATR-and Cdc7-Dependent Checkpoint 205

Figure 2. Inhibition of DNA Replication Is Dependent on X-ATR Genomic DNA replication was monitored by incorporation of ␣-32P-dATP. (A) Sperm chromatin was incubated with untreated extracts (Control) or extracts containing etoposide (Etoposide). In etoposidetreated extracts, replication was monitored in the presence of buffer (No addition), 5 mM caffeine (Caffeine), Xenopus ATM neutralizing antibodies (X-ATM Abs), or Xenopus ATR neutralizing antibodies (X-ATR Abs). (B) Sperm chromatin was incubated in membrane-free egg cytosol in the absence of purified membranes (No Memb) or following addition of membranes (all other lanes). Chromatin was incubated in untreated extract (Control), or extracts containing etoposide (Etoposide). Replication was monitored in presence of etoposide (No addition), in extracts depleted from ATR (X-ATR Dep), or in extracts subjected to mock depletion (Mock Dep). The levels of X-ATR protein were determined by Western blot in untreated extracts (No addition), X-ATR-depleted extracts (X-ATR Dep), and mock-depleted extracts (Mock Dep). (C) ATR binding to chromatin was measured by Western blot on chromatin incubated and purified from an interphase extract or an extract treated with 30 ␮M etoposide or 50 mg/ ml aphidicolin, as indicated.

2C, lane 4), demonstrating that ATR activity is not required for its association with chromatin. To determine whether ATR recruitment required the single-strand DNA binding protein RPA, we monitored chromatinbound ATR in mock-depleted or RPA-depleted extracts. The association of ATR required RPA and was completely inhibited in RPA-depleted extracts (Figure 2C, lane 6). We conclude that caffeine abrogates signaling by blocking activation of chromatin-associated ATR. The Etoposide Checkpoint Downregulates Cdc7/Dbf4 Kinase Activity Initiation of DNA replication requires the activity of both Cdk2/CycE and Cdc7/Dbf4 protein kinases (Kelly and Brown, 2000). Cdk2 is the target of the ATM-dependent checkpoint activated by DSBs (Costanzo et al., 2000). We asked if the etoposide checkpoint inhibited Cdk2/ CycE, Cdc7/Dbf4, or both. We measured Cdc7-associated kinase activity using recombinant MCM2 as substrate. Cdc7 was immunoprecipitated from nuclei assembled in untreated or etoposide-treated extracts. As shown in Figure 3A, nuclear Cdc7 kinase activity was dramatically reduced by exposure to etoposide (Figure 3A, top, lane 2). Downregulation of Cdc7 was ATR dependent, since blocking ATR signaling with caffeine or neutralizing antibodies specific to ATR restored Cdc7 kinase activity (Figure 3A, top, lanes 3 and 4). Interestingly, addition of DSBs to the extract at a concentration known to activate the ATM-dependent checkpoint (Costanzo et al., 2000) did not inhibit Cdc7 kinase (Figure 3A, top, lane 5). To determine if the etoposide checkpoint inhibited Cdk2, we immunoprecipitated Cdk2 from nuclei and assayed kinase activity with histone H1 as substrate. In contrast to the DSB checkpoint, activation of the

etoposide-dependent checkpoint did not downregulate Cdk2/CycE kinase activity (Figure 3A, bottom, lane 2). We then asked if excess Cdc7-Dbf4 suppressed the etoposide checkpoint. Increasing amounts of recombinant Cdc7-Dbf4 complex were added to etoposidetreated extracts and the extent of DNA synthesis determined (Figure 3B). Cdc7/Dbf4 restored DNA synthesis in a dose-dependent manner (Figure 3B, lanes 5 and 6), whereas excess recombinant wild-type Cdk2/CycE or nonphosphorylatable Cdk2AF/CycE complexes did not (Figure 3B, lanes 3 and 4). Taken together, these data establish that Cdc7 is the critical target of the etoposide checkpoint. The kinase activity of Cdc7 depends upon its association with the cell cycle-regulated Dbf4 protein. A Xenopus homolog of Dbf4 was recently cloned and specific antibodies raised against the protein (Dr. S. Waga, personal communication). We first compared the levels of Dbf4 protein in etoposide-treated and control extracts. No difference in the concentrations of Cdc7 (Figure 3C, top panel) or Dbf4 (Figure 3C, middle panel) was detected by Western blot analysis. However, the amount of Dbf4 that coimmunoprecipitated with Cdc7 was significantly reduced in extracts exposed to etoposide (Figure 3C, bottom panel, lanes 1 and 2). Treatment of the extract with ATR-neutralizing antibodies restored association of Cdc7 and Dbf4 (Figure 3C, bottom panel, lane 3). We conclude that the etoposide checkpoint downregulates Cdc7 kinase by impeding association of Cdc7 with Dbf4. Checkpoint Activation Inhibits Pre-RC Activity In the process of pre-RC assembly, MCM proteins, Cdc7Dbf4 complex, and Cdc45 are loaded onto chroma-

Molecular Cell 206

Figure 3. Checkpoint Activation Downregulates Cdc7/Dbf4 Activity (A) Nuclear Cdc7-associated and Cdk2-associated protein kinase activities were measured with antibodies specific for Xenopus Cdc7 and Cdk2, respectively. We used X-MCM2 as substrate for immunoprecipitated Cdc7 (top panel). Histone H1 served as substrate for Cdk2 (bottom panel). Chromatin was allowed to assemble in extracts for 45 min. Nuclei were then purified and kinase activities assessed following immunoprecipitation. Cdc7 (top panel) and Cdk2 (bottom panel) were immunoprecipitated from nuclei assembled in untreated extracts (Control), extracts treated with etoposide (Etoposide), or extracts supplemented with DNA containing double-strand breaks (DSBs). Where indicated, extracts treated with etoposide were supplemented with caffeine (Caffeine) or X-ATR neutralizing antibodies (X-ATR Abs). (B) Genomic DNA replication was monitored by incorporation of ␣-32P-dATP into chromatin incubated in untreated extracts (Control) or extracts containing etoposide (Etoposide). Etoposide-treated extracts were supplemented with buffer (Buffer), recombinant wild-type Cdk2/CycE (Cdk2 WT), recombinant Cdk2AF/Cyc E (Cdk2AF), or increasing amounts of recombinant Cdc7/Dbf4 protein complex (Cdc7/Dbf4). (C) Total nuclear Cdc7 (top panel), Dbf4 (middle panel), and Cdc7-associated Dbf4 (bottom panel) protein levels were monitored from nuclei assembled in untreated extracts (Control), extracts treated with etoposide (Etoposide), or extracts treated with etoposide and neutralizing ATR antibodies (Etoposide ⫹ ATR Abs). The antibodies used for Western blotting are indicated on the right side of the panels.

tin. Binding of Cdc45 to the pre-RC requires the sequential activity of Cdc7/Dbf4 and Cdk2/CycE protein kinases. We predicted that inhibition of Cdc7 by the etoposide checkpoint would prevent Cdc45 association with chromatin. Accordingly, chromatin binding of Cdc45, MCM, and Cdc7 was monitored in control extracts, etoposide-treated extracts, or extracts treated with etoposide and caffeine (Figure 4A). Binding of MCM complex, as detected by chromatin-associated MCM3, was unaffected by etoposide (Figure 4A, top panel). Downregulation of Cdc7/Dbf4 kinase activity only partially reduced Cdc7 binding to chromatin (Figure 4A, second panel). However, in agreement with the coimmunoprecipitation experiments (Figure 3C), etoposide completely inhibited Dbf4 association to chromatin (Figure 4A, third panel) indicating that Cdc7 chromatin binding did not require Dbf4. Similarly, Cdc45 binding was entirely inhibited following checkpoint activation (Figure 4A, fourth panel). Abrogating the checkpoint with caffeine restored Dbf4 and Cdc45 binding (Figure 4A, third and fourth panel). From the experiments on DNA synthesis presented above, we reasoned that Cdc45 binding to chromatin would be restored in etoposide-treated extracts by augmenting Cdc7 activity or by inhibiting ATR. As shown in Figure 4B, addition of recombinant Cdc7/Dbf4, in fact, rescued Cdc45 binding (Figure 4B, lane 3) whereas addition of recombinant Cdk2/CycE did not (Figure 4B, lane

4). Inhibition of ATR, which we showed permitted DNA replication in the presence of etoposide, also restored Cdc45 binding to chromatin (Figure 4B, lane 5). To confirm that the checkpoint acts at an early step of pre-RC activation and is DNA replication independent, we monitored the effect of etoposide on MCMdependent plasmid DNA unwinding. Unwinding was monitored in extracts treated with aphidicolin to block DNA replication (Walter and Newport, 2000). As shown in Figure 4C, plasmid DNA incubated in NPE in the presence of aphidicolin was converted to the unwound “U” topoisomer (compare lanes 1 and 2). Etoposide completely blocked “U” formation (Figure 4C, lane 4) and was reversed by caffeine (Figure 4C, lane 5). Thus, origin firing and DNA unwinding are downregulated by the etoposide checkpoint. In budding yeast, hydroxyurea triggers an ATR/mec1dependent checkpoint that inhibits late-firing origins (Santocanale and Diffley, 1998). We wished, therefore, to determine if the etoposide checkpoint required initial firing at a few origins. To completely block any origin activation, we depleted Cdc6 from the extracts (Coleman et al., 1996). Alternatively, we treated extracts with geminin, which prevents MCM loading on the pre-RC (Tada et al., 2001; Wohlschlegel et al., 2000). The etoposide checkpoint was monitored by nuclear Cdc7 kinase activity. As described above (Figure 3A), Cdc7 phos-

ATR-and Cdc7-Dependent Checkpoint 207

Figure 4. Checkpoint Activation Inhibits Pre-RC Formation (A and B) Chromosomal DNA was purified following incubation in extracts and chromatin-bound protein fractions were analyzed by Western blotting. (A) Chromatin was purified from an untreated extract (Control), or extracts treated with etoposide (Etoposide), or etoposide and caffeine (Etoposide ⫹ caffeine). The corresponding fractions were probed with specific antibodies against Xenopus MCM3, Cdc7, Dbf4, and Cdc45, as indicated. (B) Chromatin-bound Cdc45 was determined in nuclei incubated in untreated extracts (Control) or extracts treated with etoposide (Etoposide). Etoposide-treated extracts were supplemented, where indicated, with buffer (Buffer), recombinant Cdk2/CycE complex (Cdk2/CycE), recombinant Cdc7/Dbf4 complex (Cdc7/Dbf4), or X-ATR neutralizing antibodies (X-ATR Abs). (C) pBS was incubated in HSS at 50 ng/ul for 1 hr at 23⬚C either in the absence (lanes 1–2) or presence of 30 ␮M etoposide (lanes 3–5) and 5 mM caffeine (lane 5). NPE containing 50 mg/ml aphidicolin was added in a 2:1 ratio over HSS-assembled pBS for an additional 30 min (⫹: lanes 2, 4, and 5). Lanes 1 and 3 are in the absence of NPE (⫺). Arrowhead indicates the “U” form of plasmid DNA. (D) Nuclear Cdc7-associated protein kinase activity was measured using X-MCM2 as substrate for immunoprecipitated Cdc7. Chromatin was allowed to assemble in extracts for 45 min. Nuclei were then purified and kinase activities measured in nuclei assembled in untreated extracts (Control), or extracts treated with etoposide (Etoposide). Etoposide-treated extracts were used with no addition (No addition) or were supplemented with caffeine (Caffeine), X-ATR neutralizing antibodies (X-ATR Abs), or geminin (Geminin). In addition, Cdc6-depleted extracts were treated with etoposide (Cdc6 depletion).

phorylation of MCM2 was downregulated by etoposide (Figure 4D, lane 2). Inhibition of Cdc7 was reversed by caffeine or by neutralizing X-ATR antibodies (Figure 4D, lanes 3 and 4), but neither Cdc6 depletion nor geminin addition abrogated the checkpoint (Figure 4D, lanes 5 and 6). Geminin alone did not inhibit Cdc7 activity in the absence of etoposide (data not shown). Thus, the ATRdependent checkpoint induced by etoposide does not require origin firing. Taken together, our results indicate that etoposide damages DNA, generating a signal that downregulates Cdc7 activity. Without Cdc7 kinase activity, Cdc45 cannot bind and activate the pre-RC. Etoposide Generates Single-Strand DNA Gaps Prior to Double-Strand Breaks We wished to define the etoposide-induced DNA lesion that activates ATR and initiates the checkpoint pathway. ATR signaling is triggered by single-strand DNA regions that arise during abortive replication in the presence of aphidicolin, following UV irradiation, or after treatment with alkylating agents. To determine if single-strand DNA gaps are generated by etoposide, we monitored chromatin association of RPA, a single-strand DNA binding protein. Chromatin was incubated for 15, 30,

and 45 min in extracts, purified, and assayed for RPA content by Western blotting, using a specific antibody against the 70 kDa RPA subunit. Little RPA was associated with chromatin isolated from control extracts (Figure 5A, lanes 1–3). As previously reported (Michael et al., 2000; You et al., 2002), aphidicolin promoted extensive RPA binding (Figure 5A, lane 4–6). Etoposide likewise induced RPA binding to chromatin, indicating the formation of single-strand DNA regions (Figure 5A, lane 7–9). Importantly, geminin did not prevent etoposidestimulated RPA binding (Figure 5A, lane 10), demonstrating that generation of single-strand DNA gaps by etoposide was replication independent. Loading of RPA to etoposide-damaged DNA is required for ATR association to chromatin (Figure 2C, lane 6) and activation. Finally, the RPA requirement for the etoposide checkpoint was demonstrated by assaying Cdc7 kinase activity. As shown in Figure 5B, lane 3, RPA depletion eliminated etoposide-dependent downregulation of Cdc7. We conclude that etoposide generates a DNA lesion that recruits RPA. ATR then associates with RPA-DNA and is activated to generate a checkpoint signal. Treatment of mammalian cells with etoposide ultimately generates DNA double-strand breaks (DSBs). We asked whether etoposide induced DSB formation in

Molecular Cell 208

Figure 5. Etoposide Promotes Chromatin Binding of RPA Prior to Occurrence of DSBs (A) Chromatin-bound RPA was measured by Western blot of chromatin incubated for 45 min in an interphase extract, an extract treated with 30 ␮M etoposide, 50 mg/ml aphidicolin, or etoposide plus geminin, as indicated. (B) Nuclear Cdc7-associated protein kinase activity was measured using X-MCM2 as substrate for immunoprecipitated Cdc7. Chromatin was allowed to assemble in extracts for 45 min. Nuclei were then purified and kinase activities measured in nuclei assembled in untreated extracts (Control), or extracts treated with etoposide (Etoposide). Etoposide-treated extracts were no further treated (No addition), depleted of RPA (RPA depletion), or subjected to mock depletion (Mock depletion). The levels of RPA (p70) protein were determined by Western blot in untreated extracts (No addition), RPA-depleted extracts (RPA depletion), and mock depleted extracts (Mock depletion). (C) Formation of double-strand breaks in sperm chromatin incubated in extracts containing 30 ␮M etoposide was monitored by reactivity to ␥-H2AX antibodies on Western blots. Sperm nuclei and 30 ␮M etoposide were added at t0; chromatin was isolated and processed for Western blotting at the times indicated.

Xenopus extracts by monitoring chromatin binding of phosphorylated histone H2AX (Costanzo et al., 2001). ␥-H2AX reactivity was detected only 60 min after etoposide addition (Figure 5B, lane 3). This is significantly later than the time of RPA association with chromatin (Figure 5A, lane 7) and total inhibition of DNA replication (Figure 1A, lane 5). The results obtained with H2AX antibodies were confirmed by TUNEL assay for DSBs (data not shown). This kinetic data, along with the ATM independence of the pathway, indicate that the etoposide checkpoint is induced by single-strand DNA gaps that form prior to the generation of DSBs. Activation of the Checkpoint by Single-Strand DNA Gaps in the Absence of Etoposide From the RPA experiments described above, we hypothesized that checkpoint signaling was triggered by sin-

gle-strand DNA resulting from processing of etoposideinduced lesions. We wanted to demonstrate that the only role of etoposide in the checkpoint pathway was to create single-strand DNA. We therefore decided to mimic etoposide-induced lesions by creating singlestrand DNA gaps on chromatin prior to nuclear assembly. Chromatin was treated briefly with DNA exonuclease III (ExoIII chromatin) to generate gaps from preexisting DNA nicks. ExoIII chromatin behaved exactly like etoposide-damaged chromatin in all checkpoint-relevant assays. We monitored genomic DNA replication and found that it was inhibited in ExoIII chromatin (Figure 6, lane 2). DNA replication inhibition was reversed by addition of 5 mM caffeine or by addition of neutralizing X-ATR antibodies (Figure 6A, lanes 3 and 5) and was unaffected by treatment with neutralizing X-ATM antibodies (Figure 6A, lane 6). We also observed that replication of ExoIII chromatin was restored in X-ATR-depleted extracts (data not shown). ExoIII treatment dramatically increased the binding of ATR and RPA to chromatin in the presence or absence of geminin (Figure 6B). Finally, we measured Cdc7-associated kinase activity in control nuclei or in nuclei assembled from chromatin incubated with ExoIII. Cdc7 was downregulated in ExoIII chromatin (Figure 6C, lane 2). Downregulation was blocked by neutralizing X-ATR (Figure 6C, lane 3) or depletion of X-ATR (data not shown). Taken together, these data indicate that the checkpoint is induced by single-stranded DNA whether generated by etoposide or by another agent. Discussion DNA Lesions that Trigger Checkpoint Signaling Consistent with the observation that etoposide inhibits DNA replication in mammalian cells (Lallev et al., 1993), we have shown that etoposide blocks origin activation in Xenopus egg extracts. The block results from an ATRdependent checkpoint induced by DNA damage, and the most probable DNA lesion is a single-strand gap. Etoposide traps TopII/DNA intermediates after DNA cleavage. In these structures, TopII is covalently bound to the 5⬘ termini of DNA, whereas the 3⬘ termini are free. This conformation is not equivalent to a DSB, which has both free 5⬘ and 3⬘ termini. TopII is a critical enzyme involved in several aspects of chromatin dynamics. However, sperm nuclei support membrane assembly in the presence of etoposide (Lucas et al., 2001; Takasuga et al., 1995). Moreover, TopII is not directly required for DNA replication since caffeine suppresses the replication block induced by etoposide. We propose that the nicked etoposide-DNA intermediate is processed into a single-strand structure that loads RPA and activates an ATR checkpoint (Figure 7). We used two different approaches to confirm this hypothesis. First, we generated single-strand DNA gaps in the absence of etoposide by treating chromatin with ExoIII. The ExoIII chromatin faithfully recapitulated the etoposide phenotype. Second, we tested TopII inhibitors that do not generate a TopII-DNA covalent intermediate, but instead prevent binding of TopII to DNA or block TopII-dependent DNA religation. As expected, these reagents inhibited genomic DNA replication. However, this inhibition was not reversed by caffeine and

ATR-and Cdc7-Dependent Checkpoint 209

Figure 6. Single-Strand DNA Gaps Trigger the ATR-Dependent Checkpoint (A) Genomic DNA replication of untreated sperm chromatin (Control), or sperm chromatin treated with exonuclease III (ExoIII) was monitored by incorporation of ␣-32P-dATP. In the case of ExoIII-treated chromatin, replication was monitored in the presence of buffer (No addition), 5 mM caffeine (Caffeine), nonspecific IgGs (IgG), Xenopus ATR neutralizing antibodies (X-ATR Abs), or Xenopus ATM neutralizing antibodies (X-ATM Abs). (B) ATR and RPA binding to untreated sperm chromatin (Control) or sperm chromatin treated with ExoIII was monitored by Western blot. ATR and RPA was measured in total extract (Extract), or the chromatin-bound fraction was purified from interphase extract supplemented with control chromatin (Control), ExoIII chromatin (ExoIII), or ExoIII chromatin in presence of geminin (ExoIII ⫹ Geminin). (C) Nuclear Cdc7-associated protein kinase activity was measured using X-MCM2 as substrate for immunoprecipitated Cdc7. Chromatin was allowed to assemble in extracts for 45 min. Nuclei were then purified and kinase activities measured in control nuclei (Control) or in nuclei assembled from ExoIII-treated chromatin (ExoIII). ExoIII chromatin was used with no addition (No addition) or was supplemented with X-ATR neutralizing antibodies (X-ATR Abs).

was therefore unrelated to an ATR (or ATM) checkpoint (data not shown). A fraction of the supercoiled plasmid DNA molecules that replicate in the presence of etoposide are converted into linear and nicked circular molecules. These forms presumably reflect etoposide inhibition of TopII. However, a significant fraction of plasmid molecules remain supercoiled. This suggests that plasmid DNA is in excess to TopII and that only a portion is bound to the enzyme under our experimental conditions. That the replication of all supercoiled plasmid is nevertheless inhibited by etoposide strongly suggests that the ATR signal operates in trans. The generation of single-strand DNA in our checkpoint system is shown by the time-dependent increase in RPA associated with chromatin in etoposide-treated extracts or with ExoIII chromatin. In the case of etoposide treatment, RPA association suggests that nicked 3⬘ DNA ends are converted into single-strand gaps by DNA helicase or 3⬘-5⬘ exonuclease activity. In budding yeast, RPA is critical for the proper G2 arrest following DSB (Lee et al., 1998). Here we demonstrate that RPA is required for a checkpoint that blocks replication initiation in the presence of single-strand DNA. Our demonstration that RPA depletion prevents downregulation of Cdc7 activity biochemically demonstrates RPA checkpoint function. Interestingly, RPA becomes phosphorylated upon etoposide treatment in mammalian cells (Shao et al., 1999). Whether checkpoint activation triggers RPA phosphorylation in Xenopus extracts has not been determined. RPA bound to the gaps recruits ATR, which is then activated. Aphidicolin, alkylating agents, or UV damage also generate single-strand DNA intermediates that activate an ATR-dependent checkpoint (Guo

et al., 2000; Liu et al., 2000; Lupardus et al., 2002; Wright et al., 1998). Etoposide and its derivative teniposide are used extensively in cancer therapy, initially for small cell lung cancer (SCLC) and testicular carcinoma treatment and more recently in various combination therapies for retinoblastomas, soft tissue sarcomas, lymphomas, prostate cancer, and metastatic pancreatic tumors. The ability of etoposide to generate DNA DSBs and subsequent apoptosis is thought to explain its therapeutic value (Stewart and Ratain, 1997). Our results suggest that etoposide-induced inhibition of DNA replication could also contribute to its anticancer efficacy. Alternatively, sensitivity to etoposide could reflect the loss of the ATRdependent checkpoint in some tumors. Interestingly, etoposide is the only DNA TopII inhibitor with good therapeutic value, possibly reflecting a unique ability to activate an ATR checkpoint. Two Independent Checkpoint Pathways Regulate Cdc45 Loading to the Chromatin We previously showed that addition of DSBs to Xenopus extracts triggers a checkpoint that activates ATM and downregulates Cdk2/CycE protein kinase (Costanzo et al., 2000). Inhibition of Cdk2/CycE prevents chromatin loading of Cdc45 and origin firing (Walter, 2000). Similar observations have since been reported in mammalian cells (Falck et al., 2001). Strikingly, we find that etoposide also prevents Cdc45 binding to chromatin, indicating that the etoposide-ATR and the DSB-ATM pathways converge. However, the upstream components of the two DNA damage-induced pathways are distinct. The etoposide-ATR pathway downregulates Cdc7/Dbf4 protein kinase. DNA replica-

Molecular Cell 210

Figure 7. Distinct ATM- and ATR-Dependent DNA Damage Checkpoint Pathways Left: DSBs arising prior to initiation of DNA replication and pre-RC assembly trigger ATM-dependent checkpoints. These p53dependent and p53-independent checkpoints both lead to the inhibition of Cdk2/ CycE protein kinase activity, thus preventing the loading of Cdc45 and origin firing. Right: generation of single-strand DNA gaps following etoposide inhibition of TopII or exonucleolytic processing prior to pre-RC assembly or to initiation of DNA replication triggers RPA binding and ATR binding and signaling. ATR signaling is replication independent and leads to the inhibition of Cdc7/ Dbf4 protein kinase activity, in turn preventing the loading of Cdc45 and origin firing.

tion is restored to control levels by addition of recombinant Cdc7-Dbf4, suggesting that Cdc7 inhibition is the critical target of the pathway. Unlike the DSB-ATM checkpoint, wild-type Cdk2 or Cdk2 AF fail to rescue DNA replication. Finally, DSBs do not reduce Cdc7 activity. Taken together, these observations establish that DSBs and etoposide activate two independent checkpoint pathways (Figure 7). DSBs trigger ATM activation followed by Cdk2 downregulation, whereas etoposide induces ATR activation followed by Cdc7 downregulation. The end point of the two pathways is the same— inhibition of Cdc45 loading and origin firing. ATR Signaling Does Not Require Genomic DNA Replication ATR activation in response to DNA replication block and to DNA damage following UV irradiation or alkylating agents has been reported (Guo et al., 2000; Liu et al., 2000; Lupardus et al., 2002; Wright et al., 1998). As discussed above, these treatments might generate single-strand DNA regions in a DNA replication-dependent manner. In contrast, the etoposide-induced checkpoint blocks Cdc45 loading on chromatin, an event that is

required prior to origin firing. Depletion of Cdc6, an essential component of the pre-RC or addition of geminin, which prevents the functional assembly of MCM proteins at the origin, and completely inhibits firing, do not reverse Cdc7 downregulation induced by etoposide or ExoIII treatment of chromatin. This rules out the possibility that a small number of origins escape inhibition and generate a DNA replication-dependent signal that would in turn inhibit further origin firing. Finally, we show that geminin does not prevent the checkpoint-dependent RPA loading. A Checkpoint Function for Cdc7 Our studies indicate that the ATR-dependent checkpoint pathway inactivates Cdc7 kinase by preventing its association with Dbf4 activator. This is reminiscent of the downregulation of Cdc7/Dbf4 activity observed upon activation of the intra-S phase checkpoint by HU in budding yeast (Weinreich and Stillman, 1999). Studies in other species suggest that ATR homologs regulate Cdc7 activity through the action of protein kinases of the Chk family. In yeast, Cdc7 and Dbf4 are phosphorylated by rad53/chk kinases in response to replication

ATR-and Cdc7-Dependent Checkpoint 211

inhibitors (Brown and Kelly, 1999; Snaith et al., 2000; Takeda et al., 1999; Weinreich and Stillman, 1999). Although we failed to detect changes in the electrophoretic mobility of Cdc7 and Dbf4 after etoposide exposure (data not shown), we cannot yet rule out the possibility that they are phosphorylated during the checkpoint. Interestingly, hydroxyurea treatment weakens the association between Cdc7 and Dbf4 in budding yeast (Pasero et al., 1999). We observed an analogous reduction in Dbf4 association with Cdc7 after etoposide treatment. Checkpoint activation thus results in the assembly of Cdc7 in the absence of Dbf4 onto the pre-RC. In summary, our work provides insights into two DNA damage checkpoint pathways. DSBs activate an ATMCdk2 pathway, whereas single-strand DNA gaps activate an ATR-Cdc7 pathway. Both checkpoints inhibit the binding of Cdc45 to chromatin (Figure 7). Activation of ATR prior to the assembly of a functional pre-RC triggers Cdc7 downregulation thus inhibiting pre-RC assembly and origin firing (Figure 7). In contrast, activation of ATR in S phase results in Cdc2 inhibition at the G2-M transition. Distinct ATR binding proteins (Cortez et al., 2001) might account for the phase-dependent specificity of ATR-dependent signaling. Experimental Procedures Extract Preparation Interphase extracts were prepared as described previously (Costanzo et al. 2001). High-speed supernatant (HSS) and membrane fractions were prepared as described by Walter et al. (1998). Chromatin Templates Demembranated sperm nuclei were prepared according to standard protocols. For DNA exonuclease III treatment (ExoIII chromatin), sperm nuclei (100,000/␮l) were vortexed for 30 s. 106 sperm nuclei were incubated with 100 U ExoIII (Roche) for 10 min at 37⬚C in 60 mM Tris-HCl (pH 8.0) and 0.6 mM MgCl2. The reaction was stopped by addition of 1 ml of NPB (250 mM sucrose, 15 mM HEPES-KOH [pH 7.4], 1 mM EDTA, 0.5 mM spermidine, 0.2 mM spermine, 1 mM DTT). Control sperm nuclei were processed similarly with omission of ExoIII. DNA Replication Replication in Interphase Extracts Interphase extracts were prepared as described previously (Costanzo et al., 2001). DNA replication was performed according to Costanzo et al. (1999). Briefly, nuclei were assembled for 15 min in interphase extracts at concentrations ranging from 2,000 to 10,000 nuclei/␮l. Aliquots of the reaction were pulsed labeled with ␣-32PdATP from 0–30, 30–60, and 60–90 min or for 0–90 min at 20⬚C. For checkpoint activation, 30 ␮M etoposide was added to interphase extracts at the time of nuclei addition. 5 mM caffeine, affinity-purified polyclonal antibodies against X-ATR (Lupardus et al., 2002), or recombinant Cdc7/Dbf4 complexes (150–600 nM) were added as indicated. In the case of X-ATR antibodies, the extracts were preincubated for 30 min with the antibodies prior to etoposide and nuclei addition. For checkpoint activation by exonuclease III, ExoIII-treated chromatin was assembled in interphase extracts and replication monitored as described above. Replication reactions were stopped with 5% SDS, 80 mM Tris (pH 8.0), and 8 mM EDTA; genomic DNA was digested with 1 mg/ml proteinase K for 30 min; and the DNA was extracted with phenol/chloroform and electrophoresed on 0.8% agarose gel. Replication in HSS HSS or ATR-depleted HSS (see below) were incubated with 5,000 nuclei/␮l for 30 min in presence or not of etoposide, then 0.1 volume of membrane fraction washed in XB buffer (100 mM KCl, 1 mM MgCl2, 0.1 mM CaCl2, 10 mM HEPES-KOH [pH 7.8], 50 mM sucrose)

containing 500 mM NaCl was added. Replication assays were performed as described above for interphase extracts. Plasmid Replication and Unwinding assays HSS and NPE (nucleoplasmic extract) were prepared as described (Walter et al., 1998). NPE was supplemented with recombinant cdk2/ cyclin E to enhance origin firing efficiency (Wohlschlegel et al., 2002). For replication and unwinding assays, plasmid DNA (pBluescriptII) was initially incubated in HSS for 1 hr at 23⬚C followed by addition of a 2-fold volume of NPE. DNA replication in NPE was assayed by incorporation of ␣-32P-dATP as described (Walter et al., 1998). Unwinding assays were as described (Walter and Newport, 2000), except that the gels were run in TPE (89 mM Tris-phosphate, 2 mM EDTA) and 22.5 ␮M chloroquine, stained with SybrGold, and visualized on a Molecular Dynamics FluorImager. Chromatin Binding Assays Chromatin was assembled in 50 ␮l of interphase extracts in which checkpoint has been activated or not. 10,000 nuclei/␮l were incubated for various times (as indicated), and the extract were diluted up to 800 ␮l in chromatin isolation buffer (50 mM KCl, 5 mM MgCl2, 2 mM DTT, 50 mM HEPES [pH 7.6], 0.5 mM spermine 3HCl, 0.15 mM spermidine 4HCl, and 1 ␮g/␮l aprotinin, pepstatin, and leupeptin) supplemented with 0.125% Triton X-100 and underlayered with the same buffer containing 30% sucrose. The chromatin was pelleted at 6,000 ⫻ g for 15 min at 4⬚C. The pellet was resuspended in Laemmli loading buffer. The samples were run on 10% SDS-PAGE and analyzed by Western blotting with specific polyclonal antibodies against Xenopus ATR (Lupardus et al., 2002), MCM3 (Costanzo et al. 2000), Cdc7 (Costanzo et al., 2000), Cdc45 (Costanzo et al., 2000), Dbf4 (a generous gift from Dr. Waga), and RPA (Furstenthal et al., 2001). X-ATR bound to chromatin was detected using 6% SDSPAGE. Cdk2 and Cdc 7 Immunoprecipitations and Kinase Assays Immunoprecipitation of nuclear Cdk2 or Cdc7 was performed as follows: 50 ␮l of interphase extracts were incubated with 30 ␮M etoposide alone, etoposide with caffeine, or etoposide with X-ATR antibodies and 10,000 nuclei/␮l. ATM-dependent checkpoint was activated in presence of 10 ng/␮l of DSB-containing DNA (Costanzo et al., 2000). Nuclei were prepared as described above for chromatin except that Triton X-100 was omitted. The pellets containing nuclei were diluted in PBS supplemented with protease inhibitors and 0.2% Triton X-100 buffer to a final volume of 250 ␮l. The samples were precleared with protein A-Sepharose, incubated with affinity-purified Cdk2 (Costanzo et al., 2000) or Cdc7 antibody (Walter, 2000) on ice for 1 hr, mixed with 25 ␮l of 50% protein A-Sepharose for 1 hr, washed with low- and high-salt buffers, and washed with EB buffer. Immunoprecipitates were incubated with EB buffer containing 50 ␮M ATP and 1 ␮l of ␥-32P-ATP, 10 mCi/ml (⬎3000 mC/ ␮l) and supplemented with 0.5 mg/ml histone H1 for Cdk2 assays and recombinant MCM2 for Cdc7 kinase assays. Samples were incubated at 30⬚C for 20 min and reaction stopped by the addition of 25 ␮l of 2⫻ Laemmli buffer. The reaction mixtures were then boiled and electrophoresed on 10% SDS-PAGE. For coimmunoprecipitation assays, Cdc7 was immunoprecipitated from extract supplemented with 10,000 nuclei with or without etoposide and X-ATR antibodies. Extracts were diluted in 250 ␮l PBS with 0.2% Triton X-100 and protease inhibitors. Cdc7 antibodies and protein A beads were added and incubated for 2 hr at 4⬚C. Protein A beads were then collected and washed with high- and low-salt buffers. Protein A beads were incubated for 30 min at 30⬚C with 100 U of ␭-PPase (NEB) in a reaction buffer containing 50 mM Tris-HCl (pH 7.5), 0.1 mM Na2EDTA, 5 mM dithiothreitol, and 0.01% Brij 35 supplemented with 2 mM MnCl2. Laemmli buffer was added and the sample were boiled and processed for SDS-PAGE. Western blot was performed using specific polyclonal antibodies against Xenopus Dbf4. ATR Depletion Protein A-Sepharose beads (20 ␮l) were washed three times in PBS and XB, coupled with 35 ␮l of preimmune serum or 35 ␮l of ATR antiserum (Hekmat-Nejad et al., 2000), then incubated with 50 ␮l of

Molecular Cell 212

HSS three times. The antiserum used for depletion was different to that used for neutralizing studies. RPA Depletion 50 ␮l of interphase extract were incubated twice with 25 ␮l protein A-Sepharose beads coupled to 50 ␮l of preimmune serum or with 50 ␮l of RPA antiserum (Furstenthal et al., 2001) for 30 min at 4⬚C. Depleted extract were used to probe the binding of X-ATR and Cdc7-associated kinase activity in the presence of etoposide (see above). Cdc6 Depletion 50 ␮l of interphase extract were incubated two times with 20 ␮l protein A-Sepharose beads (Pharmacia) coupled to 20 ␮l of preimmune serum or with 20 ␮l of Cdc6 antiserum (Costanzo et al., 1999) for 30 min at 4⬚C. Phospho-H2AX Detection For detection of phosphorylated histone H2AX on the chromatin, 50 ␮l of interphase extracts were incubated with 10,000 nuclei/␮l and 30 ␮M etoposide for 30, 60, and 90 min at 23⬚C. Postreplicative chromatin was isolated by diluting the extracts in chromatin isolation buffer containing 1 mM NaF, 1 mM Na vanadate, and 0.125% Triton X-100. Samples were layered onto a sucrose cushion in chromatin isolation buffer lacking Triton X-100, then spun at 6000 ⫻ g for 20 min at 4⬚C. Chromatin was boiled in Laemmli buffer and processed for SDSPAGE electrophoresis. Anti-phosphorylated H2AX antibody (Costanzo et al., 2000) was used for Western blot. Production of Recombinant Proteins Cdc7/Dbf4 Hexahistidine-tagged hDbf4 was generated by PCR using primer complementary to the 5⬘ region of human-Dbf4 containing a restriction site for EcoRI: 5⬘-gcgcgaattcatgaactccggagccatgaggatc and a primer complementary to the 3⬘ region of the full-length of humanDbf4 including an XhoI restriction site and a hexahistidine tag: 5⬘-gcgcctcgagctagtgatggtgatggtgatgaaagccagtaaatgtagaag. The hDbf4 clone was gift from Dr. E. Lees. The PCR product was sequenced and subcloned into pFastBac1 (GIBCO) using the EcoRI and XhoI sites. The Baculovirus expression system BacToBac (GIBCO) was then used to generate viral genomic DNA encoding for His-hDbf4. Sf9 cells were transfected with viral genomic DNA carrying His6-hDbf4, and viruses were harvested from the medium and used for subsequent infections. Virus encoding for Xenopus Cdc7 was described previously (Roberts et al., 1999). MCM2 Histidine-tagged Xenopus MCM2 was generated by PCR using a primer complementary to the 5⬘ region of Xenopus MCM2 containing a restriction site for EcoRI and a 6⫻His tag: 5⬘-cccgaattcaaacct ataaatatgcatcaccatcaccatcacgcggattcttcagagtcatttaatattgc and a primer complementary to the 3⬘ region of the full-length of Xenopus MCM2 including an StuI restriction site: 5⬘ ggggaggcctcttctcatac ggccaagc. Xenopus MCM2 clone was a gift from Dr. M. Madine. The PCR product was sequenced and subcloned into pFastBac (GIBCO) using the EcoRI and StuI sites. Baculovirus expression system BacToBac (GIBCO) was then used to generate viral genomic DNA encoding XMCM2. Sf9 cells were transfected with viral genomic DNA carrying His-MCM2, and virus were harvested from the medium and used for subsequent infection. Expression and Purification of Proteins from Insect Cells Active histidine-tagged Cdc7/hDbf4 complexes were purified from Sf9 cells. 150 ml of Sf9 cells (1 ⫻ 106 cells/ml) were infected with Cdc7 virus and His-hDbf4 virus. After 48 hr, cells were harvested and lysed in buffer containing 20 mM Tris-HCl (pH 8.0), 2 mM EDTA, 100 mM NaCl, 5 mM NaF, 30 mM p-nitrophenylphosphate, 1 mM PMSF, and 0.5% Nonidet P-40 (Harper et al., 1995). The lysate was diluted 4-fold with 20 mM HEPES (pH 7.5), 15 mM MgCl2, 1 mM EGTA, 1 mM DTT, 1 mM ATP, and protease/phosphatase inhibitors. It was then incubated with 1 ml of nickel-Agarose (Qiagen) for 60 min. The resin was extensively washed, and His-hDbf4/Cdc7 com-

plex was eluted with 2 ml of buffer containing 50 mM Tris-HCL (pH 8.0), 200 mM imidazole (pH 7.8), 120 mM NaCl plus protease, and phosphatase inhibitors. Recombinant GST-CyclinE/Cdk2 WT and AF mutant were prepared as described (Costanzo et al., 2000). His-MCM2 was purified from Sf9 cells. Briefly, 100 ml of sf9 cells (1 ⫻ 106 cells/ml) were infected with His-MCM2 containing virus at MOI ⫽ 5. After 72 hr, cells were harvested and lysed according to “Xpress System protein-purification” protocol (Invitrogen) under native conditions. The protein was then dialyzed in a dialysis buffer containing 20 mM HEPES (pH 7.4), 80 mM NaCl, 1 mM DTT, and 10% glycerol. Expression and Purification of Geminin Xenopus geminin was expressed in BL21(DE3) cells from a pET28A plasmid (gift of Dr. M. Michael) according to standard protocols. The protein was purified on an FPLC, first on a nickel-NTA column and followed by a MonoQ column in ELB buffer according to standard protocols. Acknowledgments We would like to thank Dr. J. Walter for help and advice setting up the NPE system and for Cdc7 antiserum. We would like to thank Dr. S. Waga for Dbf4 antiserum, Dr. P. Jackson for RPA antiserum, Dr. E. Lees for Dbf4 cDNA, Dr. M. Madine for MCM2 cDNA, and Dr. M. Michael for the geminin plasmid. This work is supported by ACS grant RSG CCG-103367, NIH grants (GM56781 and CA92245) to J.G, and NIH grant (GM062193) to K.A.C. Received: July 29, 2002 Revised: October 22, 2002 References Brown, G.W., and Kelly, T.J. (1998). Purification of Hsk1, a minichromosome maintenance protein kinase from fission yeast. J. Biol. Chem. 273, 22083–22090. Brown, G.W., and Kelly, T.J. (1999). Cell cycle regulation of Dfp1, an activator of the Hsk1 protein kinase. Proc. Natl. Acad. Sci. USA 96, 8443–8448. Cliby, W.A., Roberts, C.J., Cimprich, K.A., Stringer, C.M., Lamb, J.R., Schreiber, S.L., and Friend, S.H. (1998). Overexpression of a kinaseinactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints. EMBO J. 17, 159–169. Coleman, T.R., Carpenter, P.B., and Dunphy, W.B. (1996). The Xenopus Cdc6 protein is essential for the initiation of a single round of DNA replication in cell-free extracts. Cell 87, 53–63. Cortez, D., Guntuku, S., Qin, J., and Elledge, S.J. (2001). ATR and ATRIP: partners in checkpoint signaling. Science 294, 1713–1716. Costanzo, V., Avvedimento, E.V., Gottesman, M.E., Gautier, J., and Grieco, D. (1999). Protein kinase A is required for chromosomal DNA replication. Curr. Biol. 9, 903–906. Costanzo, V., Robertson, K., Ying, C.Y., Kim, E., Avvedimento, E., Gottesman, M., Grieco, D., and Gautier, J. (2000). Reconstitution of an ATM-dependent checkpoint that inhibits chromosomal DNA replication following DNA damage. Mol. Cell 6, 649–659. Costanzo, V., Robertson, K., Bibikova, M., Kim, E., Grieco, D., Gottesman, M., Carroll, D., and Gautier, J. (2001). Mre11 protein complex prevents double-strand break accumulation during chromosomal DNA replication. Mol. Cell 8, 137–147. Durocher, D., and Jackson, S.P. (2001). DNA-PK, ATM and ATR as sensors of DNA damage: variations on a theme? Curr. Opin. Cell Biol. 13, 225–231. Falck, J., Mailand, N., Syljuasen, R.G., Bartek, J., and Lukas, J. (2001). The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 410, 842–847. Fortune, J.M., and Osheroff, N. (2000). Topoisomerase II as a target for anticancer drugs: when enzymes stop being nice. Prog. Nucleic Acid Res. Mol. Biol. 64, 221–253. Furstenthal, L., Kaiser, B.K., Swanson, C., and Jackson, P.K. (2001).

ATR-and Cdc7-Dependent Checkpoint 213

Cyclin E uses Cdc6 as a chromatin-associated receptor required for DNA replication. J. Cell Biol. 152, 1267–1278.

therapy: update and perspectives. Cancer Chemother. Pharmacol. 32, 103–108.

Guo, Z., Kumagai, A., Wang, S.X., and Dunphy, W.G. (2000). Requirement for Atr in phosphorylation of Chk1 and cell cycle regulation in response to DNA replication blocks and UV-damaged DNA in Xenopus egg extracts. Genes Dev. 14, 2745–2756.

Roberts, B.T., Ying, C.Y., Gautier, J., and Maller, J.L. (1999). DNA replication in vertebrates requires a homolog of the Cdc7 protein kinase. Proc. Natl. Acad. Sci. USA 96, 2800–2804.

Harper, J.W., Elledge, S.J., Keyomarsi, K., Dynlacht, B., Tsai, L.H., Zhang, P., Dobrowolski, S., Bai, C., Connell-Crowley, L., Swindell, E., et al. (1995). Inhibition of cyclin-dependent kinases by p21. Mol. Biol. Cell 6, 387–400.

Santocanale, C., and Diffley, J.F. (1998). A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication. Nature 395, 615–618. Sclafani, R.A. (2000). Cdc7p-Dbf4p becomes famous in the cell cycle. J. Cell Sci. 113, 2111–2117.

Hekmat-Nejad, M., You, Z., Yee, M.C., Newport, J.W., and Cimprich, K.A. (2000). Xenopus ATR is a replication-dependent chromatinbinding protein required for the DNA replication checkpoint. Curr. Biol. 10, 1565–1573.

Shao, R.G., Cao, C.X., Zhang, H., Kohn, K.W., Wold, M.S., and Pommier, Y. (1999). Replication-mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-dependent protein kinase and dissociates RPA:DNA-PK complexes. EMBO J. 18, 1397–1406.

Jares, P., and Blow, J.J. (2000). Xenopus cdc7 function is dependent on licensing but not on XORC, XCdc6, or CDK activity and is required for XCdc45 loading. Genes Dev. 14, 1528–1540.

Shiloh, Y. (2001). ATM and ATR: networking cellular responses to DNA damage. Curr. Opin. Genet. Dev. 11, 71–77.

Jares, P., Donaldson, A., and Blow, J.J. (2000). The Cdc7/Dbf4 protein kinase: target of the S phase checkpoint? EMBO Rep. 1, 319–322. Kellner, U., Sehested, M., Jensen, P.B., Gieseler, F., and Rudolph, P. (2002). Culprit and victim–DNA topoisomerase II. Lancet Oncol. 3, 235–243. Kelly, T.J., and Brown, G.W. (2000). Regulation of chromosome replication. Annu. Rev. Biochem. 69, 829–880. Khanna, K.K., Lavin, M.F., Jackson, S.P., and Mulhern, T.D. (2001). ATM, a central controller of cellular responses to DNA damage. Cell Death Differ. 8, 1052–1065. Lallev, A., Anachkova, B., and Russev, G. (1993). Effect of ionizing radiation and topoisomerase II inhibitors on DNA synthesis in mammalian cells. Eur. J. Biochem. 216, 177–181. Larsen, A.K., Skladanowski, A., and Bojanowski, K. (1996). The roles of DNA topoisomerase II during the cell cycle. Prog. Cell Cycle Res. 2, 229–239. Lee, S.E., Moore, J.K., Holmes, A., Umezu, K., Kolodner, R.D., and Haber, J.E. (1998). Saccharomyces Ku70, mre11/rad50 and RPA proteins regulate adaptation to G2/M arrest after DNA damage. Cell 94, 399–409. Lei, M., Kawasaki, Y., Young, M.R., Kihara, M., Sugino, A., and Tye, B.K. (1997). Mcm2 is a target of regulation by Cdc7-Dbf4 during the initiation of DNA synthesis. Genes Dev. 11, 3365–3374. Liu, Q., Guntuku, S., Cui, X.S., Matsuoka, S., Cortez, D., Tamai, K., Luo, G., Carattini-Rivera, S., DeMayo, F., Bradley, A., et al. (2000). Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes Dev. 14, 1448–1459. Lucas, I., Germe, T., Chevrier-Miller, M., and Hyrien, O. (2001). Topoisomerase II can unlink replicating DNA by precatenane removal. EMBO J. 20, 6509–6519. Lupardus, P., Byun, T., Hekmat-Nejad, M., and Cimprich, K. (2002). A requirement for replication in activation of the ATR-dependent DNA damage checkpoint. Genes Dev. 16, 2327–2332. Masai, H., Matsui, E., You, Z., Ishimi, Y., Tamai, K., and Arai, K. (2000). Human Cdc7-related kinase complex. In vitro phosphorylation of MCM by concerted actions of Cdks and Cdc7 and that of a criticial threonine residue of Cdc7 bY Cdks. J. Biol. Chem. 275, 29042– 29052. Michael, W.M., Ott, R., Fanning, E., and Newport, J. (2000). Activation of the DNA replication checkpoint through RNA synthesis by primase. Science 289, 2133–2137. Mimura, S., and Takisawa, H. (1998). Xenopus Cdc45-dependent loading of DNA polymerase alpha onto chromatin under the control of S-phase Cdk. EMBO J. 17, 5699–5707. Osheroff, N., Zechiedrich, E.L., and Gale, K.C. (1991). Catalytic function of DNA topoisomerase II. Bioessays 13, 269–273. Pasero, P., Duncker, B.P., Schwob, E., and Gasser, S.M. (1999). A role for the Cdc7 kinase regulatory subunit Dbf4p in the formation of initiation-competent origins of replication. Genes Dev. 13, 2159– 2176. Pommier, Y. (1993). DNA topoisomerase I and II in cancer chemo-

Snaith, H.A., Brown, G.W., and Forsburg, S.L. (2000). Schizosaccharomyces pombe Hsk1p is a potential cds1p target required for genome integrity. Mol. Cell. Biol. 20, 7922–7932. Stewart, C.F., and Ratain, M.J. (1997). Topoisomerase interactive agents. In Cancer Principles and Practice of Oncology, Fifth Edition, V.T. DeVita, S. Hollmann, and S.A. Rosenberg, eds. (Philadelphia, PA: Lippencott), pp. 452–467. Tada, S., Li, A., Maiorano, D., Mechali, M., and Blow, J.J. (2001). Repression of origin assembly in metaphase depends on inhibition of RLF- B/Cdt1 by geminin. Nat. Cell Biol. 3, 107–113. Takasuga, Y., Andoh, T., Yamashita, J., and Yagura, T. (1995). ICRF193, an inhibitor of topoisomerase II, demonstrates that DNA replication in sperm nuclei reconstituted in Xenopus egg extracts does not require chromatin decondensation. Exp. Cell Res. 217, 378–384. Takeda, T., Ogino, K., Matsui, E., Cho, M.K., Kumagai, H., Miyake, T., Arai, K., and Masai, H. (1999). A fission yeast gene, him1(⫹)/ dfp1(⫹), encoding a regulatory subunit for Hsk1 kinase, plays essential roles in S-phase initiation as well as in S-phase checkpoint control and recovery from DNA damage. Mol. Cell. Biol. 19, 5535– 5547. Walter, J.C. (2000). Evidence for sequential action of cdc7 and cdk2 protein kinases during initiation of DNA replication in Xenopus egg extracts. J. Biol. Chem. 275, 39773–39778. Walter, J., and Newport, J. (2000). Initiation of eukaryotic DNA replication: origin unwinding and sequential chromatin association of Cdc45, RPA, and DNA polymerase alpha. Mol. Cell 5, 617–627. Walter, J., Sun, L., and Newport, J. (1998). Regulated chromosomal DNA replication in the absence of a nucleus. Mol. Cell 1, 519–529. Warburton, P.E., and Earnshaw, W.C. (1997). Untangling the role of DNA topoisomerase II in mitotic chromosome structure and function. Bioessays 19, 97–99. Weinreich, M., and Stillman, B. (1999). Cdc7p-Dbf4p kinase binds to chromatin during S phase and is regulated by both the APC and the RAD53 checkpoint pathway. EMBO J. 18, 5334–5346. Wohlschlegel, J.A., Dwyer, B.T., Dhar, S.K., Cvetic, C., Walter, J.C., and Dutta, A. (2000). Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science 290, 2309–2312. Wohlschlegel, J.A., Dhar, S.K., Prokhorova, T.A., Dutta, A., and Walter, J.C. (2002). Xenopus Mcm10 binds to origins of DNA replication after Mcm2–7 and stimulates origin binding of Cdc45. Mol. Cell 9, 233–240. Wright, J.A., Keegan, K.S., Herendeen, D.R., Bentley, N.J., Carr, A.M., Hoekstra, M.F., and Concannon, P. (1998). Protein kinase mutants of human ATR increase sensitivity to UV and ionizing radiation and abrogate cell cycle checkpoint control. Proc. Natl. Acad. Sci. USA 95, 7445–7450. You, Z., Kong, L., and Newport, J. (2002). The role of single-stranded DNA and Pol a in establishing the ATR, Hus1 DNA replication checkpoint. J. Biol. Chem. 15, 27088–27093. Zhou, B.B., and Elledge, S.J. (2000). The DNA damage response: putting checkpoints in perspective. Nature 408, 433–439. Zou, L., and Stillman, B. (1998). Formation of a preinitiation complex by S-phase cyclin CDK-dependent loading of Cdc45p onto chromatin. Science 280, 593–596.