Abstract. A simple, inexpensive and efficient method was developed for rapid isolation of total genomic DNA from 15 red algal species. It resulted in 0.1 µg high ...
Journal of Applied Phycology 16: 161–166, 2004. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.
161
An efficient method for DNA isolation from red algae Zimin Hu1,2 , Xiaoqi Zeng1 , Aihua Wang2 , Cuijuan Shi2 & Delin Duan2,∗ 1 Fisheries 2 Institute ∗ Author
College, Ocean University of China, Qingdao, 266003, P.R. China of Oceanology, The Chinese Academy of Sciences, Qingdao, 266071, P.R. China
for correspondence; fax +86 532 2898556; e-mail dlduan@ms.qdio.ac.cn
Received 12 August 2003; revised and accepted 12 October 2003
Key words: DNA isolation, genetic manipulation, PCR amplification, polysaccharides, red algae
Abstract A simple, inexpensive and efficient method was developed for rapid isolation of total genomic DNA from 15 red algal species. It resulted in 0.1 µg high quality DNA from 1 mg fresh algal material, with an A260/A280 ratio of 1.68–1.90. Using this rapidly isolated DNA, the 18S ribosomal RNA genes (rDNA) and the nuclear ribosomal DNA of the internal transcribed spacer (ITS) regions were amplified. The tested DNA was suitable for restriction endonuclease digestion, genetic marker analysis and polymerase chain reaction (PCR) amplification, and may be valid for other genetic manipulation.
Abbreviations: rDNA – ribosomal DNA; ITS – internal transcribed spacer; PCR – polymerase chain reaction
Introduction Molecular biological investigation of marine macroalgae has been hindered by considerable difficulties in acquiring usable DNA from these organisms (Mayes & Saunders, 1991). In particular, the copious amounts and acidic structure of polysaccharides of taxa of Phaeophyta and Rhodophyta have presented researchers with a formidable obstacle to DNA isolation (Do & Adams, 1991). Standard DNA extraction protocols have been time-consuming and labor-costly, because the techniques usually involved extensive purification procedures incorporating the process of caesium chloride gradient ultracentrifuge (Goff & Coleman, 1988; Rice & Bird, 1990; Roell & Morse, 1991), hydroxyapatite column purification (Dutcher et al., 1990), and agarose gel-electrophoresis purification (Saunders, 1993). Recent modified new protocols were utilized for the DNA isolation from Rhodophyta (Shivji et al., 1992; Hong et al., 1995, 1997; Wattier et al., 2000), a series of purification procedures including CTAB protocols, Lithium chloride softing tissue
and DNA isolation kit were developed, however these techniques still have limitations in yield and success rate, and need more improvements. This study set out to develop a relatively rapid and efficient procedure for genomic DNA extraction from red algae, with a procedure which is rapid, economical, does not require caesium chloride ultracentrifugation, and yields DNA of sufficient purity for use in restriction enzyme analysis and PCR amplification.
Materials and methods Algal materials The 15 selected red algal species used in this protocol are listed in Table 1. Young and healthy fresh materials with few epiphytes were chosen. Firstly the collected seaweeds were washed with filtered seawater, and rinsed in deionized distilled water (ddH2O) to eliminate the epiphytic organisms.
162 Table 1. Background of the selected red algal materials Phylum
Order
Family
Species
Date
Side
Lane
Rhodophyta
Bangiales Ceramiales
Bangiaceae Ceramiaceae Delesseriaceae Rhodomelaceae
Cryptonemiales
Cryptonemiaceae
Gelidiales Gigartinales
Gelidiaceae Gigartinaceae Gracilariaceae
Porphyra yezoensis Ceramium kondoi Acrosorium sp. Chondria sp. Polysiphonia sp. Symphycladia sp. Grateloupia filicina Halymenia sinensis Gelidium amansii Chondrus ocellatus Gracilaria asiatica Gracilaria tenuistipitata Gymnogongrus flabelliformis Plocamium telfairiae Lomentaria sp.
Feb. 2003 Feb. 2003 March 2003 March 2003 March 2003 April 2003 March 2003 March 2003 May 2003 April 2003 May 2003 March 2003 Feb. 2003 May 2003 March 2003
Qingdao Qingdao Qingdao Qingdao Qingdao Qingdao Qingdao Qingdao Qingdao Qingdao Qingdao Guangxi Qingdao Qingdao Qingdao
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Rhodymeniales
Phyllophoraceae Plocamiaceae Lomenlariaceae
Figure 1. Total genomic DNA electrophoresised patterns of 16 algal materials. M: Hind III-digested Lambda DNA, 16: Monostroma nitidum (Chlorophyta).
Genomic DNA isolation About 0.12 g fresh red algal tissue was frozen in liquid nitrogen, ground into a fine powder with a mortar and pestle, the ground mixture was then quickly transferred to a 1.5-mL eppendorf tube containing 0.7 mL SDS extraction buffer (0.1 M Tris-HCl, pH 8.0, 0.05 M ethylene diamine tetra-acetic acid [EDTA], 0.5 M NaCl, 1.6% sodium dodecyl sulphate [SDS], 0.2% polyvinyl-polypyroolidone [PVPP] and 2% βmercaptoethanol). The extraction solution mixture was incubated at 37 ◦ C with gentle inversion at reg-
ular intervals within 1 h, equal volume of ice-cold potassium acetate (5.0 M, pH 7.5) was added and mixed gently, after that mixture stayed on ice for 20 min, then centrifuged at 10600 × g for 15 min. The aqueous phase was collected and extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), the upper aqueous phase was transferred to a new tube and extracted with an equal volume of chloroform:isoamyl alcohol (24:1), the organic and aqueous phases were mixed thoroughly in each extraction and centrifuged at 10600 × g for 10 min.
163
Figure 2. Electrophoresis patterns of restriction enzyme digestion of genomic DNA with BamH I M1: Hind III-digested Lambda DNA, M2: molecular size marker of 100-bp ladder.
Figure 3. Electrophoresis patterns of 18S rDNA PCR amplification of 16 algal materials. M: molecular size marker of 100 bp ladder, 16: Monostroma nitidum (Chlorophyta).
The supernatant was collected, Rnase was added to a final concentration of 0.1 mg mL−1 , and placed at 37 ◦ C for 1 h. The sample was extracted respectively with phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform:isoamyl alcohol (24:1), the upper aqueous phase was collected and added 2/3 volume of ice-cold isopropanol. The mixture was stayed at –20 ◦ C for 1 h or overnight, subsequently the DNA was precipitated by micro-centrifugation at 18000 × g for 20 min. The supernatant was removed, and the precip-
itated DNA was washed with cold 70% ethanol for three times. The pellet of DNA was vaccume-dried for 10–15 min, resuspended in 100 µL deionized distilled water (ddH2 O) or in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) and stored at –20 ◦ C. Total genomic DNA were electrophoresised on 0.7% agarose gel, in 1 × TBE buffer (89 mmol L−1 Tris, 89 mmol L−1 borate, 2 mmol L−1 EDTA, pH 8.0) and stained with ethidium bromide.
164
Figure 4. Electrophoresis patterns of ITS PCR amplification of 16 algal materials. M: molecular size marker of 100 bp ladder, 16: Monostroma nitidum (Chlorophyta).
Figure 5. Nucleotide sequences of ITS regions for Chondrus ocellatus. ITS1: 1–148 bp, 5.8S: 149–306 bp, ITS2: 307–710 bp.
165 Restriction enzyme digestion The Genomic DNA was digested respectively by restriction enzyme EcoR I, Hind III and BamH I (Promega, USA) at 37 ◦ C for 2–6 h, then electrophoresised on 1.2% agarose gel, in 1 × TBE buffer (89 mmol L−1 Tris, 89 mmol L−1 Borate, 2 mmol L−1 EDTA, pH 8.0), and stained with ethidium bromide. PCR amplification of 18S rDNA and ITS regions The selected primers for amplifying the 18S ribosomal DNA (rDNA) were: Forward: 5’CCGAATTCGTCGACAACCTGGTTGATCCTGCCACT3’; Reverse: 5’CCCGGGATCCAAGCTTGATCCTTCTGCAGGTTCACCTAC3’ (Goff & Moon, 1993). The PCR reaction mixture (20 µL) contained 10 mmol L−1 Tris.HCl (pH 8.3), 50 mmol L−1 KCl, 1.5 mmol L−1 MgCl2 , 2.0 mmol L−1 dATP, dCTP, dGTP, dTTP respectively, 50 ng nuclear DNA, 1.0 mmol L−1 of each primer and 1.0 U Taq DNA polymerase (TaKaRa Biotechnology Co., Ltd. Dalian). The PCR reaction was performed on Eppendorf Masterthermocycler with the program of 5 min at 97 ◦ C, followed by 40 cycles of 1 min at 95 ◦ C, 2 min at 50 ◦ C, 6 min at 72 ◦ C and a final hold at 72 ◦ C for 7 min. The designed primers used to amplify the ITS1 and ITS2 regions were: TW18: 5’GGGATCCGTTTCCGTAGGTGAACCTGC3’; AB28: 5’GGGATCCATATGCTTAAGTTCAGCGGGT3’. The PCR reaction mixture (20 µL) contained 10 mmol L−1 Tris.HCl (pH 8.3), 50 mmol L−1 KCl, 1.5 mmol L−1 MgCl2 , 2.0 mmol L−1 dATP, dCTP, dGTP, dTTP respectively, 50 ng nuclear DNA, 1.0 mmol L−1 of each primer and 1.0 U Taq DNA polymerase (TaKaRa Biotechnology Co., Ltd. Dalian). The PCR reaction was performed on Eppendorf Masterthermocycler with the program of 5 min at 95 ◦ C; 1 min at 90 ◦ C and 2 min at 50 ◦ C for 5 cycles; 72 ◦ C for 1 min; Followed by 30 cycles of 1 min at 90 ◦ C, 1 min at 60 ◦ C, 1 min at 72 ◦ C; finally stayed at 72 ◦ C for 10 min.The PCR products were electrophoresised on 1.5% agarose gel, and stained with ethidium bromide for the preliminary verification of possible 18S rDNA and ITS regions. The ITS amplification products of several samples were sequenced directly, such as Porphyra yezoensis, Symphycladia sp., Gelidium amnsii, Chondrus ocellatus, Gracilaria asiatica, and the sequencing primers were modified TW18-1 (5’CGTTTCCGTAGGTGAACC-3’) and AB28. Sequencing reaction was performed with the Big Dye Terminators on ABI Autormated 377 sequencer (PE Applied Biosystems),
and the sequence data were collected with the ALF express DNA sequencer system (Pharmacia).
Results The testified protocol proved to be efficient and rapid for isolation of DNA, with less sign of degradation, and the A260 /A280 ratios in the range of 1.68–1.90. The yielded DNA was approximately 100 ng per mg of fresh material. Comparing different algal materials, it achieved that high yield DNA were more easily obtained from fresh and young algal materials than from the old ones. Figure 1 showed that there was less smeariness of the prepared DNA, but it testified that the degradation of DNA was not observed if sample was treated in large volume (50 mL) tube during the extraction. Figure 2 provided the result of genomic DNA digested with the restriction enzyme BamH I, which demonstrated the remnant RNA had less effect on restriction enzyme, and the obtained DNA may be used for AFLP and blotting analysis. As shown in Figure 3, a single band ca. 1500 bp was amplified with eukaryotic specific 18S primers in all materials except Porphyra yezoensis and Chondria sp., the size of 18S rDNA amplified production of Porphyra yezoensis was nearly 3000 bp while the Chondria sp. was about 1200 bp. On the contrary, there was more than one band in some algal samples with ITS amplification testments which was shown in Figure 4, this may be ascribe to the ununiversial primers compared with 18S primers. Direct sequencing of PCR products indicated that less contaminants existed in the template DNA, and Figure 5 showed the complete ITS (ITS1, 5.8S and ITS2) sequences of Chondrus ocellatus. Judging from the data of the 15 species, the demonstrated protocol yielded DNA was stable to be obtained, feasible to some restriction enzymes digestion (EcoR I, Hind III, BamH I), available in PCR amplifications for 18S rDNA and ITS regions, and it indicated that the obtained DNA can be applied for the further genetic manipulation.
Discussion Compared with Saunders’ (1993) method with the low melt point agarose purification, this protocol can yield high-product DNA while simplified the extraction steps, with less co-isolation of polysaccharides. Hong (1995) had ever noted that the 37 ◦ C may be
166 proper to the extraction of DNA, to verify this issue, a few experiments were done under different temperatures with 25 ◦ C, 37 ◦ C, 65 ◦ C, and it proved that 37 ◦ C was more feasible than the other extracting temperatures. Results supposed that high temperature (65 ◦ C) resulted in the release of DNA and polysaccharide in great amount; while the low tempreture (25 ◦ C) will hinder the activity of endonuclease, and lead to the less obtaining of genomic DNA. Besides, the crucial steps for eliminating polysaccharides should contain the addition of potassium acetate (pH 7.5) and the incubation on ice for 20 min. In addition, centrifugation at 4 ◦ C is another important factor for eliminating the polysaccharide. Previously, Saunders (1993) and Goff (1993) successfully isolated DNA from preserved dry red algal materials; however, it was proved to be difficult with our protocol (unpublished data), this suggested our developed protocol was preferable to extract DNA with fresh, semi-dry or cold algal materials. Fifteen red algal materials covering 6 orders and 11 families were applied with our DNA extraction procodure and each exhibited the ideal results, it showed that our protocol was efficient and valid for DNA isolation from red algae, or suitable for the other species in red algae and other DNA manipulation.
Acknowledgements This work was supported by the National High Tech 863 Project (No. 2001AA621090). The authors wish to thank anonymous reviewers for the critical comments and suggestions for the manuscript.
References Do N, Adams RP (1991) A simple technique for removing plant polysaccharide contaminants from DNA. Bio. Techniques. 10: 162–166. Dutcher JA, Kapraun DF, Sizemore RK (1990) Inter- and intraspecific variation of nuclear DNA re-association kinetics in the Gracilariales (Rhodophyta). J. appl. Phycol. 2: 259–267. Goff LJ, Coleman AW (1988) The use of plastid DNA restriction endonuclease patterns in delineating red algal species and population. J. Phycol. 24: 357–68. Goff LJ, Moon DA (1993) PCR amplification of nuclear and plastid genes from algal herbarium species and algal spores. J. Phycol. 29: 381–384. Hong YK, Kim SD, Polne-Fuller M, Gilbor A (1995) DNA extraction conditions from Porphyra perforata using LiCl. J. appl. Phycol. 7: 101–107. Hong YK, Sohn CH, Lee KW, Kim HG (1997) Nucleic and extraction from seaweed tissues for polymerase chain reaction. Bio. Techniques. 5: 95–99. Mayes C, Saunders GW, Tan IH, Druehi LD (1992) DNA extraction methods for kelp (Laminariales) tissue. J. Phycol. 28: 712–716. Rice EL, Bird CJ (1990) Relationships among geographically distant populations of Gracilaria verrucosa (Gracilariale, Rhodophyta) and related species. Phycologia 29: 501–510. Roell MK, Morse DE (1991) Fractionation of nuclear, chloroplast, and mitochondrial DNA from Polysiphonia boldii (Rhodophyta) using a rapid and simple method for the simultaneous isolation of RNA and DNA. J. Phycol. 27: 299–305. Saunders GW (1993) Gel purification of red algal genomic DNA: an inexpensive and rapid method for the isolation of polymerase chain reaction-friendly DNA. J. Phycol. 29: 251–254. Shivji MS, Rogers SO, Stanhope MJ (1992) Rapid isolation of high molecular weitht DNA from marine macroalgae. Mar. Ecol. Progr. Ser. 84: 197–203. Wattier RA, Prodohl PA, Maggs CA (2000) DNA isolation protocol for red seaweed (Rhodophyta). Plant. mol. Biol. Rept. 18: 275– 281.
