to exon 1 of the ERCC1 gene (Shutler et al., 1991). Polymorphism: Atwo alleleinsertion polymorphism is detected using anyone of the following three restriction ...
Nucleic Acids Research, Vol. 19, No. 5 1159
An insertion polymorphism identified by the probe pEO.8 (D19S115) at 19q13.3 G.Shutler, S.Leblond, J.Bailly, A.E.MacKenzie, C.Tsilfidis and R.G.Korneluk* Molecular Genetics Laboratory, Children's Hospital of Eastern Ontario, 401 Smyth Road, Ottawa KlH 811, Canada Source/Description: The probe pEO.8 is a 0.8 kb EcoRI genomic fragment subcloned in pUC13 and isolated from a cosmid containing human chromosome 19 sequences homologous to the excision repair gene, ERCC1. The ERCC1 gene has been shown to be located within 250 kb telomeric to the CKM gene (Smeets et al. 1990). Human DNA sequences contained in pEO.8 correspond to a genomic region approximately 15 kb centromeric to exon 1 of the ERCC1 gene (Shutler et al., 1991). Polymorphism: A two allele insertion polymorphism is detected using any one of the following three restriction endonucleases: BamHI, 7.0/6.5 kb; BglI 6.5/6.0 kb; and NcoI, 4.5/4.0 kb. Not Polymorphic For: PstI, Pvufl, RsaI, TaqI, HaeII, EcoRI, XmnI. Frequency: Estimated from at least 300 unrelated individuals Al = 0.62 (large fragment size) A2 = 0.38 Chromosome Localization: Using a panel of human-rodent somatic cell hybrids, pEO.8 was found to map to 19ql3.3, telomeric to the CKM gene. Mendelian Inheritance: A codominant segregation pattern has been observed in 110 myotonic dystrophy (DM) families (over 800 individuals tested). Probe Availability: Available for collaborative studies on myotonic dystrophy. Freely available for other studies. (Contact R.G.K.). Other Comments: Close linkage between pEO.8 and DM has been shown (Znmx = 19.3, On= = 0.01, Shutler et al., 1991). The polymorphisms detected by pEO.8 are observed under normal hybridization and wash stringencies. Acknowledgements: This work was supported by grants to R.G.K. from the Muscular Dystrophy Associations of Canada and the United States, and the Medical Research Council of Canada. The cosmid (identification number F15123) from which the probe pEO.8 was derived was provided by Dr. Pieter de Jong, Lawrence Livermore National Laboratories, Livermore, California. References: 1) Shutler et al. (1991) Genomics 9, 500-504. 2) Smeets et al. (1990) Am. J. Hum. Genet. 46, 492-501.
BgIlI 11 1.1 |-55kb -6.0 kb
*
To whom
correspondence should be addressed
A dinucleotide repeat polymorphism at the DMD locus J.F.Powell1, F.H.Fodor2, D.J.Cockburn2, A.P.Monaco3 and I.W.Craig2* 'Department of Neuroscience, Institute of Psychiatry, Denmark Hill, London SE5 8AF, 2Genetics Laboratory, Department of Biochemistry, South Parks Road, Oxford, OX1 3QU and 31CRF Laboratories, Lincoln Inn's Field, London WC2 3PX, UK
Source/Description: A human genomic cosmid (DMD1) selected by hybridisation to a 3' fragment of the dystrophin cDNA (63-1) also hybridised to poly(dC-dA) * poly(dG-dT). A Sau3a digest of this cosmid was subcloned into M13mpl8 and positive clones selected by hybridisation with poly(dC-dA) poly(dG-dT). Clone DMDl-c2 was sequenced and primers synthesised. The predicted length of the amplified fragment was 251 bp. Primer Sequences: TGTCTGTCTTCAGTTATATG (GT strand); ATAACTTACCCAAGTCATGT (CA strand) Frequency: Estimated from 73 X chromosomes of unrelated individuals. PIC = 0.50 Allele (bp) Frequency 0.01 BB5 245 0.15 B34 249 0.67 BB3 251 BB2 253 0.07 BB1 255 0.12 Chromosomal Localisation: X-linked assignment was confirmed by amplifications with a panel of X-autosome translocation hybrids. Mendelian Inheritance: X-linked inheritance was observed in one three generation family. Other Comments: Conditions for amplification reactions were as described by the manufacturers except that final Mg concentration was 1 mM. 25 cycles of 94°C, 2 mins; 50°C, 2 mins; 72°C, 1 min were performed. Alleles were separated on a 4% acrylamide, 50% urea gel system. The dinucleotide sequence was of the form GTCT (GT)17AT. The precise localisation with respect to the exon/intron organisation of the DMD gene was established by hybridisation of a HindIll digestion of cosmid DMD1 with subfragments of DMD cDNA probe 63-1. Exon containing HindHI fragments 46 and 47 were present in this cosmid (Koenig et al. 1987). The sequence of DMD1c-2 has been submitted to EMBL. Acknowledgements: This work was supported by the Muscular Dystrophy Society of Great Britain, FF was a Soros Foundation Scholar. Reference: 1) Koenig,M., Hoffman,E.P., Bertelson,C.J., Monaco,A.P., Feener,C. and Kunkel,L.M. (1987) Cell 50, 509-517.
*
To whom correspondence should be addressed
