An Interaction between Human Papillomavirus 16 E2 and TopBP1 Is Required for Optimum Viral DNA Replication and Episomal Genome Establishment Mary M. Donaldson,a Lorna J. Mackintosh,a Jason M. Bodily,b* Edward S. Dornan,a Laimonis A. Laimins,b and Iain M. Morgana Medical Research Council–University of Glasgow Centre for Virus Research, Glasgow, United Kingdom,a and Department of Microbiology-Immunology, Northwestern University, Chicago, Illinois, USAb
In human papillomavirus DNA replication, the viral protein E2 forms homodimers and binds to 12-bp palindromic DNA sequences surrounding the origin of DNA replication. Via a protein-protein interaction, it then recruits the viral helicase E1 to an A/T-rich origin of replication, whereupon a dihexamer forms, resulting in DNA replication initiation. In order to carry out DNA replication, the viral proteins must interact with host factors that are currently not all known. An attractive cellular candidate for regulating viral replication is TopBP1, a known interactor of the E2 protein. In mammalian DNA replication, TopBP1 loads DNA polymerases onto the replicative helicase after the G1-to-S transition, and this process is tightly cell cycle controlled. The direct interaction between E2 and TopBP1 would allow E2 to bypass this cell cycle control, resulting in DNA replication more than once per cell cycle, which is a requirement for the viral life cycle. We report here the generation of an HPV16 E2 mutant compromised in TopBP1 interaction in vivo and demonstrate that this mutant retains transcriptional activation and repression functions but has suboptimal DNA replication potential. Introduction of this mutant into a viral life cycle model results in the failure to establish viral episomes. The results present a potential new antiviral target, the E2-TopBP1 interaction, and increase our understanding of the viral life cycle, suggesting that the E2-TopBP1 interaction is essential.
T
here are more than 100 types of human papillomavirus (HPV) involved in a host of epithelial lesions, ranging from hand warts and genital warts to cervical cancer (69). So-called high-risk HPVs are those associated with cancer, and type 16 is the most commonly detected, being present in ca. 50% of cervical carcinomas and increasingly detected in head and neck cancers (30). All HPV encode two proteins, E1 and E2, required for replication of their double-stranded DNA genome in association with cellular partner proteins. The E2 protein forms homodimers and binds to 12-bp palindromic sequences surrounding the origin of replication and via a protein-protein interaction recruits the E1 protein to the A/T-rich origin (9, 40, 61). E1 then forms a dihexameric helicase that interacts with the cellular DNA polymerase machinery, resulting in DNA replication initiation (36, 38, 46, 55). The origin of replication is located in the long control region (LCR), a noncoding part of the genome that controls the initial transcription from the viral genome by cellular factors (50). The E2 protein can also regulate viral genome transcription; it can act as either an activator or a repressor of viral oncogene expression depending upon E2 levels and the cell type under study (10, 15, 60). The carboxyl terminus domain of E2 is required for homodimerization and DNA binding, while the amino terminus interacts with E1 and a number of cellular transcription factors (16, 47, 54, 56, 63). E2 can also associate with mitotic chromatin and is proposed as a viral genome segregation factor by binding the viral genome to the cellular DNA during mitosis ensuring recruitment of the viral genome into the nuclei of the resulting daughter cells (3, 6, 45, 67). For some E2 proteins, but not HPV16, the cellular protein Brd4 is the mitotic chromatin receptor (37, 43, 67); Brd4 is also an essential transcriptional coactivator for all E2 proteins (54). The essential role that E2 plays in transcription, replication, and genome segregation makes it an antiviral target. In order to increase understanding of HPV16 E2 (from now on E2 will mean
12806
jvi.asm.org
Journal of Virology
HPV16 unless stated otherwise), we carried out a yeast two-hybrid screen and identified the cellular protein TopBP1 as a binding partner (13, 14). TopBP1 is an excellent candidate protein for mediating E2 properties since it is involved in DNA replication initiation and transcriptional control and it associates with mitotic bodies (5, 23, 27, 28, 32, 35, 49). It has eight BRCA1 carboxylterminal (BRCT) domains, which are hydrophobic pockets first identified in BRCA1 that act as interacting domains for other proteins, damaged DNA, and phosphor-proteins (29). In yeast and Xenopus model systems, TopBP1 (and its homologues) is required for interacting with origin recognition complex proteins and loading Cdc45 and the GINS (Go, Ichi, Nii, San) complex onto MCM2-7 in an S-phase kinase-specific manner at the G1-S transition to form the replication helicase (28, 48, 68). TopBP1 also acts as a transcription cofactor. A direct interaction regulates transcription and apoptotic properties of E2F1 (32, 34). TopBP1 also acts as a transcriptional repressor for the Miz1 protein, thus regulating the function of c-Myc (20). TopBP1 can regulate p53 target genes via complexing directly with the p53 protein (31), as well as regulating properties of mutant p53 proteins that contribute toward transformation (33). In addition to regulating transcription and replication, TopBP1 is also a key component of the DNA damage response pathway. It binds directly to ATR to activate
Received 23 April 2012 Accepted 7 September 2012 Published ahead of print 12 September 2012 Address correspondence to Iain M. Morgan,
[email protected]. * Present address: Louisiana State University Health Sciences Center, Shreveport, Louisiana, USA. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.01002-12
p. 12806 –12815
December 2012 Volume 86 Number 23
TopBP1 Is Required for Optimum E2 Function
kinase activity (26) and also regulates ATM activation of ATR activity by acting as an ATM substrate, resulting in enhanced ATR signaling (65). It is also proposed that TopBP1 plays a role in homologous recombination by directly interacting with NBS1, resulting in DNA damage signaling (42, 66). The DNA damage and replication functions of TopBP1 can be dissected, demonstrating that this multi-BRCT domain containing scaffold protein can play key roles in multiple nucleic acid metabolism processes within the cell (19). Our previous studies have demonstrated the regulation of E2 function and chromatin interaction by TopBP1 (14, 17). We report here the in vivo identification and characterization of an E2 mutant severely compromised in TopBP1 binding. This mutant is functional since it retains transcriptional activation and repression functions but is defective in DNA replication. Introduction of this mutation into a viral life cycle model results in failure to establish episomal viral genomes in primary epithelial cells, as would be predicted for a mutant that did not induce optimal DNA replication. This is the first report, to our knowledge, describing an HPV16 E2 mutant that fails to support the viral life cycle. It is also the first report to describe a mutant E2 protein, from any species, that has altered DNA replication potential with a candidate cellular cofactor explaining the phenotype identified. Overall, the results strongly suggest that the E2-TopBP1 interaction is essential for the viral life cycle and that disruption of this interaction may be a novel antiviral target. MATERIALS AND METHODS Cell culture and transfection. HEK293T and C33a cells were maintained in Dulbecco modified Eagle medium (DMEM) with 10% fetal calf serum (FCS) and 1⫻ penicillin-streptomycin (pen-strep; Invitrogen Life Technologies) in a 5% CO2 atmosphere at 37°C. Cultures were split 1 in 10 every 3 days. The cells used for transfection were plated in 60-mm plates for the transcription assays and the cycloheximide experiments (2 ⫻ 105 cells/plate) or in 100-mm plates for the replication assays and for protein preparation for immunoprecipitation (6 ⫻ 105 cells/plate). The following day, the cells were transfected using calcium phosphate, and 16 h later the cells were washed twice with phosphate-buffered saline (PBS) and refed with DMEM containing 10% FCS with pen-strep. The cells were harvested ⬃48 h posttransfection for all experiments, with the exception of replication assays (harvested 72 h posttransfection). Human foreskin keratinocytes (HFKs) and HFK-derived cell lines were cultured in E-medium with NIH 3T3 J2 fibroblast feeders as described previously (39). Cell lines containing HPV16 genomes were created by cotransfection of pEGFP Ni HPV16 with an expression vector for Cre recombinase and a neomycin resistance plasmid, followed by G418 selection as described previously (11). Differentiation was induced by suspending cells in 1.5% methylcellulose for 24 h, followed by washes in PBS (51). Protein preparation for Western blotting and immunoprecipitation. Cells were harvested by trypsinization, and the pellet was washed with PBS. The cells were then resuspended in lysis buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8], 0.5% NP-40, 1⫻ Roche protease inhibitor cocktail) and lysed on ice for 30 min. Lysates were cleared by centrifugation (20,800 relative centrifugal force, 4°C, 30 min), and the supernatant was moved to a clean tube. The protein concentration was determined by bicinchoninic acid (BCA) assay (Sigma). Western blots. A total of 50 g of lysate was prepared for SDS-PAGE using the Invitrogen NuPage system. Gels were run at 200 V for 1 h, after which the gels were equilibrated in 2⫻ NuPage transfer buffer plus 10% methanol for 10 min at room temperature. Proteins were transferred onto nitrocellulose membranes using the Invitrogen iBlot system. The membranes were blocked in blocking solution (PBS, 0.1% Tween, 5% nonfat milk powder) for 16 h at 4°C or 1 h at room temperature. After both
December 2012 Volume 86 Number 23
primary and secondary antibody incubations, membranes were washed in PBS– 0.1% Tween. Bands were revealed by chemiluminescence (ECL⫹; Amersham). Antibodies. R1180 rabbit polyclonal anti-TopBP1 antibody (14) was used for Western blotting and immunoprecipitation (Fig. 1B). TVG261 mouse monoclonal anti-HPV16 E2 antibody (21) was used for Western blotting (see Fig. 1B, 3A, 4A, and 4C). Mouse monoclonal anti-TopBP1 antibody (BD Biosciences) was used for Western blot analyses (see Fig. 1B). Mouse monoclonal anti-hemagglutinin (HA) antibody HA.11 (Covance) used for immunoprecipitation (see Fig. 3A) and Western blot analyses (see Fig. 3A and C). GTU88 mouse monoclonal anti-gamma tubulin (Sigma) used as a Western blot loading control (see Fig. 4A and C). Horseradish peroxidase (HRP)conjugated sheep anti-mouse antibody (GE Healthcare) was used as a secondary antibody to mouse primary antibodies in Western blot analyses. HRP-conjugated goat anti-rabbit antibody (Sigma) was used as a secondary antibody to rabbit primary antibodies in Western blot analyses. Site-directed mutagenesis. Mutagenic PCRs were set up as follows. We used 5 l of 10⫻ KOD buffer with 5 l of 2 mM deoxynucleoside triphosphates, 4 l of 25 mM MgSO4, 1 l of dimethyl sulfoxide, forward primer, reverse primer, 100 ng of template DNA, 1 U of KOD Hot-Start DNA polymerase (Novagen), and distilled H2O to 50 l. Reactions were cycled as follows: 94°C for 4 min, followed by 18 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, with a final 72°C for 4 min. After completion of the mutagenic PCR, 10 U of DpnI was added to the reaction, followed by incubation for 90 min at 37°C. Then, 5 l of the reaction was transformed into Escherichia coli DH5␣, and transformed cells were selected on Luria-Bertani/ampicillin plates. Positive colonies were picked, and plasmids were recovered by using a miniprep procedure and sequenced to determine the mutation. The primers used for the generation of the N89YE90V mutant were as follows: forward, 5=-CAATATATAACTCACAATATAGTTATGTAAAG TGGACATTACAAG-3=; and reverse; 5=-CTTGTAATGTCCACTTTACA TAACTATATTGTGAGTTATATATTG-3=. Immunoprecipitation. A total of 200 g of protein lysate was precleared with 10 l of a protein A-Sepharose bead slurry equilibrated in immunoprecipitation buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8], 0.5% NP-40). The volume was made up to 100 l with immunoprecipitation buffer, followed by incubation for 1 h with rotation at 4°C. The beads were pelleted, and the cleared lysate was moved to a clean tube. Then, 1 l of antisera was added to lysate, followed by incubation for 1 to 2 h with rotation at 4°C. Next, 20 l of bovine serum albumin (BSA)blocked bead slurry (the washed beads were incubated in 1% BSA fraction V in PBS overnight at 4°C with rotation; the beads were then washed four times with 25 bed volumes immunoprecipitation buffer and resuspended in 1 volume of immunoprecipitation buffer) was added to the cell lysate, followed by incubation for 1 h with rotation at 4°C. The beads were then washed four times with 25 bed volumes immunoprecipitation buffer. The beads were then prepared for Western blotting. Transcription assays. At 48 h posttransfection, the medium was discarded, and the plates were washed twice with PBS. A total of 300 l of 1⫻ reporter lysis buffer (Promega) was added to each plate, and the cells were lysed in situ for 10 min at room temperature. The lysates were scraped, transferred into Eppendorf tubes, and cleared by centrifugation. Then, 80 l of each lysate was assayed for luciferase activity (Promega). The protein concentrations of the lysates were also determined by BCA assay (Sigma), and the results are expressed as the luciferase activity relative to the protein concentration. Replication assays. At 72 h posttransfection, the medium was discarded, and the plates were washed twice with PBS. The samples were processed for reverse transcriptase quantitative PCR (RT-qPCR)-detected transient replication assay, as described previously (59). Cycloheximide time course and densitometry. At 36 h posttransfection, cycloheximide (Sigma) was added to the plates to a final concentration of 100 g/ml. The plates were then incubated for the times indicated in the figures before being harvested by trypsinization. The cell pellets
jvi.asm.org 12807
Donaldson et al.
were then processed for BCA assay (Sigma) and Western blotting. Exposed films from Western blots were scanned at high resolution in grayscale, and the gel analysis software in ImageJ was used to determine the intensity of each band. The intensity of each band of interest was calculated relative to the loading control band for that sample. Densitometry experiments were repeated in triplicate, and the average relative intensities were graphed. Southern blotting and RT-qPCR. Total DNAs were isolated and digested with XhoI (which does not cut the HPV16 genome) or BamHI (which cuts the HPV16 genome once) and analyzed by Southern blotting as described previously (11). Total RNAs were harvested using RNASTAT 60 (TelTest, Inc.) and converted to cDNAs using the qScript cDNA synthesis kit (Quanta). qPCR was performed using a StepOnePlus realtime PCR instrument. E7-containing transcripts were detected with PerfeCTa SYBR green Supermix (Quanta) using 16E7 SYBR 5= (ATGAG CAATTAAATGACAGCTCAGAG) and 16E7 SYBR 3= (CACACTTGCA ACAAAAGGTTACAAT) as the primers. Cyclophilin (57) was assayed as an internal control using qCyc SYBR 5= (CTTGGGCCGCGTCTCC) and qCyc SYBR 3= (GCAGGAACCCTTATAACCAAATCC) as primers. E1E4-containing transcripts were detected using the TaqMan Fast advanced master mix containing a TaqMan probe (FAM) spanning the splice junction multiplexed with a cyclophilin (VIC) internal control probe.
RESULTS
The role of TopBP1 in mammalian DNA replication led us to hypothesize that this protein contributed to E1-E2 mediated DNA replication via binding to E2. To test this hypothesis, an E2 protein compromised in TopBP1 binding is required; depletion of TopBP1 from cells is toxic due to the role of TopBP1 in DNA replication and also in regulating the DNA damage response, making siRNA/shRNA experiments with TopBP1 difficult to interpret, particularly in relation to replication (23, 24). Identification of an E2 mutant compromised in TopBP1 interaction. The crystal structure of the E2 amino-terminal domain is known (4), and this was used to predict which amino acids may be contact residues for TopBP1. The amino-terminal domain was broken down into 50-amino-acid subdomains based on the crystal structure. In Fig. 1A, amino acids 50 to 100 are shown. In order to direct our mutagenesis strategy, we eliminated E2 residues with prior defined functions (Fig. 1A). Our previous results demonstrated that knocking down TopBP1 protein levels with siRNA did not affect E2 transcription properties (17); therefore, we eliminated the residues required for E2 transcription function, as detailed in the E2-Brd4 crystal structure (2). We also predicted that an E2 interaction with both TopBP1 and E1 would occur simultaneously to allow DNA polymerase loading onto the E1 helicase; therefore, the contact points on E2 for E1 could also be eliminated (1). Many previous studies had also identified residues whose mutation resulted in multiple defective phenotypes; therefore, these were also eliminated. Finally, the residues proposed to be involved in the homodimerization of the E2 amino terminus were also eliminated, leaving 17 amino acids as candidate residues for TopBP1 (4). Several of these amino acids had previously been mutated to alanine residues with no discernible phenotype; therefore, the residues were mutated in pairs and/or clusters and not necessarily to alanines in order to identify a mutant compromised in TopBP1 interaction. We prepared several E2 mutants with changes in the 17 amino acids and assayed their replication potential; we hypothesized that a compromised replication would relate to a compromised TopBP1 interaction. The results of these replication assays are shown in Fig. 1B, and the mutants are described
12808
jvi.asm.org
in Fig. 1C. Mutant 8 failed to induce replication, and the ability of this mutant to interact with TopBP1 in vivo was tested by coimmunoprecipitation (Fig. 1D). In lane 3, it is clear that wild-type E2 coimmunoprecipitates with TopBP1, whereas mutant 8 fails to interact efficiently (lane 4). This result supported the hypothesis that an interaction between E2 and TopBP1 is involved in viral replication. Our initial goal was to test whether the E2-TopBP1 interaction was essential for the HPV16 life cycle by generating an E2 mutant compromised in TopBP1 interaction. It is clear that mutant 8 is compromised in TopBP1 interaction, but the eight amino acid changes in this mutant (Fig. 1B) make it unsuitable for testing in a life cycle model. We therefore set out to reduce the number of residues required to be mutated to compromise the interaction with TopBP1. Figure 2A describes subsequent mutants that were prepared and assayed in DNA replication assays (Fig. 2B). All of the mutants studied remained significantly compromised in DNA replication except mutant 28, where there was no statistically significant difference with wild-type E2. The ability of the mutants to interact efficiently with TopBP1 was then tested (Fig. 2C). Lanes 1 to 7 demonstrate efficient expression of the mutant E2 proteins, and lanes 8 to 23 show the coimmunoprecipitation with TopBP1 (even-numbered lanes, anti-TopBP1 antisera; odd-numbered lanes, preimmune sera). Wild-type E2 interacts with TopBP1 (lane 10), while mutant 28 also interacts efficiently with TopBP1 (lane 20). All other mutants fail to interact efficiently with TopBP1 in this coimmunoprecipitation assay. Since mutant 28 was the only mutant not to have significantly reduced replication potential, we conclude that there is a correlation between compromised TopBP1 binding and a significant reduction in E2 replication properties. Mutant 25 has only two amino acid changes (N89YE90V) and retains compromised DNA replication activity; we designated this mutant E2TopBP1 for further study. The results suggest there are other contact points for TopBP1 on E2 but that the area around 89/90 is essential for an efficient interaction. Further characterization of E2TopBP1 (mutant 25). The compromised TopBP1 interaction of E2TopBP1 was reproducible, and an additional result from a coimmunoprecipitation with E2TopBP1 and the wild-type protein (E2WT) is shown in Fig. 3A. The shadow band visible with E2TopBP1 is perhaps due to a residual interaction between E2TopBP1 and TopBP1; it could also be due to the natural stickiness of E2 to beads used in these coimmunoprecipitation experiments (14, 18). What is clear from this experiment is that E2TopBP1 is reproducibly compromised in the TopBP1 interaction. Figure 2B demonstrated a significant reduction in E2TopBP1 replication properties, and it is possible that this was due to a compromised interaction with the E1 protein, even though our mutational strategy did not mutate any predicted E1-interacting residues (Fig. 1A). An HA-tagged version of E1 was coexpressed with E2WT, E2TopBP1, and E2E39A, which is a known non-E1-interacting mutant (52). Lysates from these cells were used in coimmunoprecipitation assays with an HA antibody (Fig. 3B). The input levels of HAE1 (upper panel) and the E2 proteins (lower panels) are shown in lanes 1 to 4. In lanes 5 to 8, it is clear that the HA immunoprecipitation has pulled down HAE1 (upper panel) and also E2WT and E2TopBP1 in a coimmunoprecipitation (lanes 6 and 7 in the lower panel), whereas E2E39A does not interact with HAE1 as predicted (lane 8, lower panel). The E39A mutant shows no residual “stickiness” to the beads (lane 8) since a short exposure time is required to detect the E1-E2 interaction due to E1 overex-
Journal of Virology
TopBP1 Is Required for Optimum E2 Function
FIG 1 Identification of a non-TopBP1 interacting E2 mutant. (A) Residues between E2 amino acids 50 to 100 that interact with Brd4 and E1, amino acids shown previously to be multiply defective, indicating improper folding, and amino acids involved in the homodimerization of the E2 protein are highlighted by row as indicated. The remaining amino acids were TopBP1 interaction candidates. (B) A panel of mutants was prepared, and DNA replication assays were carried out in 293T cells with 100 ng of input E2 plasmid. Please note the logarithmic scale, demonstrating poor replication by mutants 7 and 17, and no replication by mutant 8. (C) A table describing the mutants used in panel B. (D) Mutant 8 does not interact efficiently with TopBP1 in vivo. Lanes 1 and 2 show the levels of input E2 proteins for the coimmunoprecipitation experiments shown in lanes 3 and 4 with a loading control; TopBP1 is often difficult to detect in the input lanes and is not shown here. Lanes 3 and 4 are Western blots of TopBP1 immunoprecipitations. In lane 3, it is clear in the lower panel that E2WT interacts well with endogenous TopBP1, whereas mutant 8 is severely compromised, as shown in lane 5. The shadow band observed may indicate some residual binding, but there may also be a contribution to this from the “stickiness” of E2 for the beads (14, 18).
pression. These results confirm that E2TopBP1 interacts with E1 similarly to E2WT. The interaction between E2WT and E2TopBP1 with HAE1 was also no different when the coimmunoprecipitation experiments were carried out at 37°C (as opposed to the 4°C shown in Fig. 3B), demonstrating that the failure to replicate properly at 37°C by E2TopBP1 is not due to failure to interact with E1 (data not shown). Finally, replication assays were carried out with reduced levels of E2TopBP1 and E2WT plasmids to confirm the compromised replication phenotype of E2TopBP1. At 10 ng of E2
December 2012 Volume 86 Number 23
input plasmid, E2TopBP1 replicates at 18% compared to E2WT, demonstrating again that it is compromised in replication function (Fig. 3C); this difference is statistically significant. E2TopBP1 retains transcriptional activation and repression functions. The transcriptional activation properties of E2TopBP1 were determined (Fig. 4A). In lanes 1 to 5, it is clear that E2WT induces transcriptional activation from a tk promoter with 6 E2 binding sequences located upstream and that this activation becomes “squelched” at high levels of E2 input. Lanes 6 to 10 dem-
jvi.asm.org 12809
Donaldson et al.
FIG 2 Identification of critical residues of E2 required for efficient TopBP1 interaction. (A) Panel of mutants tested for DNA replication function and TopBP1 interaction. Mutant 8 has 8 amino acid changes, and our results from Fig. 1 indicated that the region around amino acid 90 was important for DNA replication function. (B) The E2 mutants were tested for their DNA replication potential with 100 ng of input plasmid DNA in 293T cells. Mutant 8 was null for DNA replication, as demonstrated in Fig. 1, whereas mutants 25, 26, 27, and 29 were significantly reduced in their DNA replication properties compared to the wild type, as determined by a Student t test. (C) All of the mutants were expressed in 293T cells (lanes 1 to 7) and then tested for coimmunoprecipitation with TopBP1 (lanes 8 to 23); even-numbered lanes used the TopBP1 antibody, and odd-numbered lanes used preimmune serum. The upper panel demonstrates that TopBP1 was immunoprecipitated as predicted. The lower panel demonstrates an efficient coimmunoprecipitation of wild-type E2 and mutant 28 with TopBP1. Mutant 28 was the only mutant that did not show a significant reduction in DNA replication properties in panel B. Therefore, there is a correlation with failure to efficiently interact with TopBP1 and DNA replication properties for the E2 mutants.
onstrate that E2TopBP1 activates transcription. The pattern of activation is distinct from E2WT with no squelching at higher levels, and there is a significant difference between E2TopBP1 and E2WT activity at 10 ng of input plasmid. These results demonstrate that E2TopBP1 is folded correctly and can bind to target DNA sequences and that there are differences between the transcriptional activation properties of this mutant and E2WT. The fold activation in transcription over that obtained when no E2 was coexpressed is shown in the boxes below the graph. E2 can also act as a transcriptional repressor of papillomavirus control regions, and the ability of E2WT and E2TopBP1 to repress the HPV18 long control region (LCR) was tested. The results from these experiments are shown in Fig. 4B. In lanes 1 to 4, it is shown that E2WT represses tran-
12810
jvi.asm.org
scription from the HPV18 LCR as predicted, and in lanes 5 to 8 it is clear that the E2TopBP1 mutant retains this repressive function. This again demonstrates that the E2TopBP1 protein is correctly folded, binds to DNA, and is functional. There were no statistical differences between E2WT and E2TopBP1 in the transcriptional repression assays. The stability of E2TopBP1 is similar to E2WT. One explanation for the compromised replication potential of E2TopBP1 could be that the protein is relatively unstable. To check for this, a cycloheximide chase experiment was carried out with E2WT and E2TopBP1, and the results of this experiment are shown in Fig. 5A. Lanes 1 to 5 represent the cycloheximide chase of E2WT cells, whereas lanes 6 to 10 show the results for E2TopBP1. It is clear that
Journal of Virology
TopBP1 Is Required for Optimum E2 Function
FIG 3 Further characterization of E2TopBP1. Mutant 25 from Fig. 2, containing N89YE90V mutations, was called E2TopBP1. (A) E2TopBP1 was retested for interaction with TopBP1 to confirm the compromised interaction. Lanes 1 and 2 show the input levels of the E2 proteins, along with a loading control (gamma tubulin). Lanes 3 and 4 show the immunoprecipitation with TopBP1, showing the pull down of TopBP1 (top panel) and coimmunoprecipitation of E2WT (lane 3) that is compromised for E2TopBP1 binding (lane 4). (B) The ability of E2TopBP1 to bind HPV16 E1 was tested in 293T cells. Lanes 1 to 4 represent input levels of HA-E1 protein with the indicated E2 proteins; E2E39A is a known E1 noninteractor (52). Lanes 5 to 8 represent coimmunoprecipitations with an HA antibody, followed by Western blotting for HA (top panel) and E2 (bottom panel). It is clear that E2TopBP1 binds HA-E1 like E2WT, while E2E39A fails to interact as expected. (C) DNA replication assays were carried out in 293T cells with input levels of E2WT and E2TopBP1 plasmids of 10 ng. E1 was held steady at 5 g in these assays since replication does not work well below this level (59). The results are expressed as picograms of replicated DNA detected. Below the bar chart is a summary of the actual numbers from the experiments. The results represent the average of three independent experiments. Bars represent ⫾ the standard errors of the mean. E2TopBP1 has a significantly reduced replication potential, indicated by an asterisk (*), as determined by a Student t test. These results confirm that E2TopBP1 is compromised in TopBP1 binding and DNA replication potential, while retaining wild-type levels of interaction with E1.
there are no significant differences in the rate of protein level reduction between the two samples. This analysis was carried out three times and quantitated with the results shown in Fig. 5B, which confirm that there is no significant difference in the stability of the E2WT and E2TopBP1 proteins. We recently demonstrated that the E2 protein is stabilized in the presence of E1 (25), and we
December 2012 Volume 86 Number 23
FIG 4 E2TopBP1 retains transcription function. (A) E2WT and E2TopBP1 were titrated into 293T cells, along with an E2 reporter containing six E2 DNA binding sites upstream from a tk promoter driving luciferase (62). Cells were harvested, and luciferase and protein assays were carried out. The results are normalized to protein levels in each sample and are represented as the fold increase over no E2 expression plasmid. The boxes below the figure specify the actual fold increase. These experiments were carried out at least three times in duplicate. Bars represent ⫾ the standard errors of the mean. The asterisk (*) indicates a significant difference between E2WT and E2TopBP1 at 10 ng of input plasmid DNA in this assay, as determined by a Student t test. (B) E2WT and E2TopBP1 were titrated into 293T cells, along with a vector containing the luciferase gene under the control of the HPV18 LCR. The cells were harvested, and luciferase and protein assays carried out. The results are normalized to protein levels in each sample and are represented as relative to no E2 expression plasmid equaling 1. These experiments were carried out at least three times in duplicate. Bars represent ⫾ the standard errors of the mean. There were no significant differences between E2TopBP1 and E2WT at any E2 plasmid input tested.
therefore checked the ability of E2TopBP1 to be stabilized by E1. The results of this experiment are shown in Fig. 5C, where it is clear again that the E2WT and E2TopBP1 proteins behave similarly, and represented graphically in Fig. 5D. This experiment was repeated with identical results. These results demonstrate that the compromised DNA replication properties of E2TopBP1 are not due to altered protein stability either in the presence or in the absence of the E1 protein. An HPV16 genome containing the E2TopBP1 mutation fails to establish episomes in primary HFKs. In order to test the effect of the E2TopBP1 mutations in the context of the complete HPV16 genome, primary HFKs were transfected with either wild-type or E2TopBP1 mutant HPV16 DNA and selected with G418. Immortal cell lines grew out from both wild-type and mutant transfections, demonstrating that the E2 mutations did not abrogate the ability of HPV to immortalize primary keratinocytes. As shown in Fig.
jvi.asm.org 12811
Donaldson et al.
FIG 6 E2TopBP1 mutant genomes (N89YE90V in this figure) fail to establish episomes in primary human foreskin keratinocytes. (A) HPV containing cells were generated as described in Materials and Methods, and the growth rates were measured. HPV-containing cells were grown for 10 passages. Growth rates were estimated assuming that cells doubled 3.3 times per passage at a 1:10 split ratio. (B) Total DNAs from cells grown in monolayer (Mo) or methylcellulose (MC) were incubated with an enzyme that does not digest the HPV16 genome (U) or cuts it once (C) (see Materials and Methods). DNAs were then subjected to Southern blotting and assayed with a probe consisting of the full HPV16 genome. Standards corresponding to 100, 10, or 1 copy of the HPV16 genome per cell are included. Please note that the blot shown is from the same exposure of the same gel, with the gap in between demonstrating that a control was removed for clarity.
FIG 5 E2TopBP1 is similar in stability to E2WT with or without E1. (A) E2WT and E2TopBP1 were transfected into 293T cells. These cells had cycloheximide added to them at the time points indicated prior to protein harvesting, and the protein extracts were blotted for E2 protein levels. Shown is a typical result from three independent experiments. (B) The levels of E2 protein in the experiments represented in panel A were quantitated as described in Materials and Methods and are shown graphically with the standard errors of the mean indicated by bars. (C) Previously, we have shown that E2WT is stabilized by E1 (25), and lanes 1 to 6 demonstrate that E2 levels persist after 6 h of cycloheximide treatment as predicted. In lanes 7 to 12, the results with E2TopBP1 are shown, where it is again clear that the E2 protein levels persist after cycloheximide treatment. This experiment was repeated with equivalent results. (D) The blot shown in panel C was scanned and quantitated as described in Materials and Methods. Overall, the results demonstrate that there is no significant alteration in E2TopBP1 stability compared to E2WT either in the presence or in the absence of E1.
6A, the growth rates of cell lines containing mutant genomes were very similar to the wild type. To determine whether viral genomes harboring E2TopBP1 mutations were capable of maintaining themselves as episomes, total DNA was isolated from pooled cell lines
12812
jvi.asm.org
and subjected to Southern blotting. In three independent experiments, the wild-type HPV16 genomes were all episomal, but none of the E2TopBP1 cell lines retained episomal genomes (a representative Southern blot is shown in Fig. 6B). Indeed, in one of the three experiments, the E2TopBP1 mutant genome failed to yield stable cell lines. It is notable that after differentiation the levels of wild-type HPV16 genome are not increased, as would be predicted. This has been observed previously, but viral particles are produced using this system (11); perhaps cervical keratinocytes are required to observe amplification of the HPV16 genome following differentiation in this system. The expression of viral RNAs was then investigated (Fig. 7A). Cells were grown in monolayers or suspended in methylcellulose to induce differentiation. Total RNA was isolated and subjected to RT-qPCR using primers specific for a portion of the E7 gene, which is transcribed from the early promoter p97 (Fig. 7A). This transcript was detected in E2WT and E2TopBP1 cells (Fig. 7B). Consistent with previous data, transcripts from p97 were not increased upon differentiation in cells containing wild-type genomes (12, 44; J. Bodily, unpublished data), nor were they increased in the E2TopBP1 cells (Fig. 7B). The fact that transcript levels were not elevated in the in the E2TopBP1 samples relative to the wild type indicates that genome integration was not sufficient by itself to increase transcript levels in this system. Using a qPCR probe spanning the E1E4 splice junction, which is immediately downstream of the late promoter p670 (Fig.
Journal of Virology
TopBP1 Is Required for Optimum E2 Function
FIG 7 Effects of E2TopBP1 mutations on transcription from HPV16 genomes. (A) Location of the early (p97) and late (p670) promoters, the E1E4 splice, and the PCR primers used in these experiments are shown. Total RNAs extracted from cells containing wild-type (WT) or mutant genomes grown either in monolayer or suspended in methylcellulose were subjected to RT-qPCR using primers targeting the E7 open reading frame (B) or using a TaqMan probe spanning the E1E4 splice junction (C). The data are the means of two to three HFK backgrounds and six to nine separate PCRs and were normalized first to cyclophilin as an internal control and then to viral transcript levels in wild-type cells grown in monolayers. Bars represent ⫾ the standard errors of the mean.
7A), we found that wild-type genomes could support the differentiation-induced p670 activation and accumulation of E1E4 transcripts. The E2TopBP1 mutant cells were unable to support accumulation of late transcripts (Fig. 7C), as expected given that the late promoter is not activated from integrated genomes. Overall, there was no clear defect in viral transcripts in E2TopBP1 genome expressing undifferentiated cells. This suggests that the failure of E2TopBP1 genomes to establish episomes in primary epithelial cells is probably not due to defects in the ability of E2TopBP1 to regulate transcription. These results also suggest that the mutations required to generate E2TopBP1 clones do not dramatically influence transcript levels per se. DISCUSSION
There are three modes of HPV replication following infection. The first is an establishment phase allowing initial viral replication resulting in viral genome copy numbers of ⬃50 per cell. The second phase is maintenance, where the genome copy number per cell is kept steady during the initial phases of epithelial differentiation. Finally, the third phase is amplification that occurs in the upper layers of the epithelium, resulting in increasing genome copy numbers to ⬃1,000 per cell (for a review, see reference 41). For establishment and amplification, the viral genome must be replicated more than once per cell cycle; therefore, HPV DNA replication is not subject to the tight “once and once only” regu-
December 2012 Volume 86 Number 23
lation that controls host cell genome replication. TopBP1 is instrumental in initiating host DNA replication following the G1to-S transition. The Saccharomyces cerevisiae homologue of TopBP1, Dpb11, interacts with two cellular proteins Sld2 and Sld3 after they are phosphorylated by Cdk at the G1-S transition. This is critical for replication initiation since it recruits Dpb11 to the prereplication minichromosome maintenance (MCM) complex loading on Cdc45 and GINS, resulting in polymerase loading and replication initiation (58, 68). The human functional counterpart of Sld3 is likely Treslin (27, 28), while RecQ4 is a candidate for fulfilling Sld2 function (22). In neither yeast nor humans does Dpb11/TopBP1 directly contact the origin recognition complex or the MCM helicase without recruitment by the phosphorylated Sld2/Sld3 and RecQ4/Treslin proteins, ensuring that the initiation of DNA replication occurs in a cell cycle-regulated manner. In this report we demonstrate that a failure of E2 and TopBP1 to interact optimally results in reduction in replication potential and failure to establish episomes in primary epithelial cells. This direct recruitment of TopBP1 to the HPV replication complex would allow polymerase loading onto the E1 replication helicase in a cell cycle-independent manner, giving the virus the potential to replicate more than once per cell cycle. As described above, this is a necessary function for the HPV life cycle. The mutational strategy described in Fig. 1 and 2 identified several E2 mutants compromised in DNA replication function and TopBP1 binding. The correlation between these phenotypes strongly implicates TopBP1 in regulating E2 DNA replication properties in association with E1. E2TopBP1 mutant genomes are unable to establish episomes in primary HFKs (Fig. 6 and 7). Figure 6B shows the results of a typical Southern blot carried out on the cells generated after transfection with E2WT and E2TopBP1 genomes. The HPV16 genome is clearly seen in this figure as episomal in the E2WT cells but is not detected in the E2TopBP1 cells. This lack of detection is due to multiple integration events in the pooled cells preventing detection of one band, as would be expected in a clonal line. Longer exposure of the Southern blot detects a smear in the E2TopBP1 cells, demonstrating the presence of multiple integrated genomes in these pools (data not shown). The E2TopBP1 cells clearly maintain expression of E6 and E7 sufficient for immortalization, and their inability to maintain episomal genomes is consistent with a defect in E1/E2-mediated DNA replication, as shown for E2TopBP1 in Fig. 2 and 3. However, E2TopBP1 also has altered transcription function (Fig. 4A), although it can activate transcription to E2WT levels when overexpressed, unlike in DNA replication, where it cannot. This transcription activation function and the ability to repress transcription as efficiently as E2WT demonstrates that E2TopBP1 retains binding to Brd4. The alterations in transcription and defects in DNA replication are not due to the altered stability of the E2TopBP1 protein (Fig. 5) compared to E2WT, demonstrating that these are functional differences rather than due to the levels of protein expressed. Our previous studies with siRNA targeting TopBP1 demonstrated that in the absence of TopBP1 E2WT had an altered affinity for chromatin. However, the E2TopBP1 mutant does not show this alteration for chromatin affinity (data not shown), suggesting that the studies with siRNA against TopBP1 may alter the cellular environment that influences E2WT affinity for chromatin. We favor a model where E2TopBP1 deficiency in DNA replication is responsible for the lack of episomal establishment by E2TopBP1 genomes. This view is supported by the observation that E2 cannot regulate tran-
jvi.asm.org 12813
Donaldson et al.
scription from HPV16 episomal genomes (8). However, this will require further investigation of the E2WT and E2TopBP1 replication and transcription complexes in vivo. Studies with BPV1 E2 mutants support the role of the E90 residue in DNA replication since a D89A E90A mutant had wild-type transcriptional activation properties but compromised DNA replication potential (7). We have previously shown that BPV1 E2 can interact with TopBP1 (17), and our preliminary results suggest that mutation of amino acids 89 and 90 in BPV1 E2 compromise interaction with TopBP1 (data not shown). Future studies on E2-TopBP1 will extend to a variety of PV types to confirm the essential nature of this interaction in PV life cycles. Although effective prophylactic vaccines against HPV16/18/ 6/11 have been successfully introduced (53), it remains a priority to develop novel antiviral therapies for several reasons. First, individuals currently infected will not be helped by these vaccines, and there are currently no therapeutic vaccines. Second, the introduced vaccines target only a subset of HPV that induce disease. Third, other high-risk oncogenic HPVs, or 16/18 subtypes partially resistant to the vaccine, may become more prevalent following the reduction of the 16/18 load; therefore, cervical cancer rates may not fall as predicted. Fourth, in most developing nations, where ca. 80% of cervical cancer deaths occur, it will be very difficult to successfully introduce the current vaccines to a sufficient percentage of the population. The role of the E2-TopBP1 interaction in mediating E2 function and the potential requirement for this interaction in episomal establishment suggests that disruption of this interaction represents a therapeutic target for the treatment of HPV disease. Inhibition of HPV DNA replication is a therapeutic target, and disruptors of E1-E2 interactions exist that reduce DNA replication (64); however, these inhibitors are restricted in their usefulness since they do not operate efficiently across a variety of HPV types due to the subtle differences in the E1-E2 interactions. It is more likely that interaction between viral and host proteins are closely conserved across HPV types. Therefore, it is possible that inhibition of the E2-TopBP1 interaction could reduce viral replication and load in all HPV-related diseases. We have already confirmed interaction between BPV1 E2 and TopBP1 (17), suggesting that this interaction will be widely conserved across different PV types from different species. We have already demonstrated a direct interaction between E2 and TopBP1 bacterial recombinant proteins (data not shown), and future studies will focus on determining the crystal structure of the E2-TopBP1 interaction and confirming the essential nature of this interaction for the viral life cycle. ACKNOWLEDGMENTS We thank Kavi Mehta for assistance with the primary HFK cultures. We also thank Mart Ustav for generously providing the plasmid encoding the HA-tagged version of HPV16 E1. M.M.D. was supported by Medical Research Scotland and Cancer Research UK. L.J.M. is a clinical fellow funded by the Medical Research Council. We also acknowledge support from the U.S. National Cancer Institute (grant RO1CA142861).
REFERENCES 1. Abbate EA, Berger JM, Botchan MR. 2004. The X-ray structure of the papillomavirus helicase in complex with its molecular matchmaker E2. Genes Dev. 18:1981–1996. 2. Abbate EA, Voitenleitner C, Botchan MR. 2006. Structure of the papillomavirus DNA-tethering complex E2:Brd4 and a peptide that ablates HPV chromosomal association. Mol. Cell 24:877– 889.
12814
jvi.asm.org
3. Abroi A, Ilves I, Kivi S, Ustav M. 2004. Analysis of chromatin attachment and partitioning functions of bovine papillomavirus type 1 E2 protein. J. Virol. 78:2100 –2113. 4. Antson AA, et al. 2000. Structure of the intact transactivation domain of the human papillomavirus E2 protein. Nature 403:805– 809. 5. Bang SW, et al. 2011. Human TopBP1 localization to the mitotic centrosome mediates mitotic progression. Exp. Cell Res. 317:994 –1004. 6. Bastien N, McBride AA. 2000. Interaction of the papillomavirus E2 protein with mitotic chromosomes. Virology 270:124 –134. 7. Baxter MK, McBride AA. 2005. An acidic amphipathic helix in the bovine papillomavirus E2 protein is critical for DNA replication and interaction with the E1 protein. Virology 332:78 – 88. 8. Bechtold V, Beard P, Raj K. 2003. Human papillomavirus type 16 E2 protein has no effect on transcription from episomal viral DNA. J. Virol. 77:2021–2028. 9. Benson JD, Howley PM. 1995. Amino-terminal domains of the bovine papillomavirus type 1 E1 and E2 proteins participate in complex formation. J. Virol. 69:4364 – 4372. 10. Bernard BA, et al. 1989. The human papillomavirus type 18 (HPV18) E2 gene product is a repressor of the HPV18 regulatory region in human keratinocytes. J. Virol. 63:4317– 4324. 11. Bodily JM, Mehta KP, Cruz L, Meyers C, Laimins LA. 2011. The E7 open reading frame acts in cis and in trans to mediate differentiation-dependent activities in the human papillomavirus type 16 life cycle. J. Virol. 85:8852– 8862. 12. Bodily JM, Meyers C. 2005. Genetic analysis of the human papillomavirus type 31 differentiation-dependent late promoter. J. Virol. 79:3309 – 3321. 13. Boner W, Morgan IM. 2002. Novel cellular interacting partners of the human papillomavirus 16 transcription/replication factor E2. Virus Res. 90:113–118. 14. Boner W, et al. 2002. A Functional interaction between the human papillomavirus 16 transcription/replication factor E2 and the DNA damage response protein TopBP1. J. Biol. Chem. 277:22297–22303. 15. Bouvard V, Storey A, Pim D, Banks L. 1994. Characterization of the human papillomavirus E2 protein: evidence of transactivation and transrepression in cervical keratinocytes. EMBO J. 13:5451–5459. 16. Cha S, Seo T. 2011. hSNF5 is required for human papillomavirus E2driven transcriptional activation and DNA replication. Intervirology 54: 66 –77. 17. Donaldson MM, Boner W, Morgan IM. 2007. TopBP1 regulates human papillomavirus type 16 E2 interaction with chromatin. J. Virol. 81:4338 – 4342. 18. Feeney KM, Saade A, Okrasa K, Parish JL. 2011. In vivo analysis of the cell cycle dependent association of the bovine papillomavirus E2 protein and ChlR1. Virology 414:1–9. 19. Germann SM, et al. 2011. Dpb11/TopBP1 plays distinct roles in DNA replication, checkpoint response and homologous recombination. DNA Repair (Amst.) 10:210 –224. 20. Herold S, et al. 2008. Miz1 and HectH9 regulate the stability of the checkpoint protein, TopBP1. EMBO J. 27:2851–2861. 21. Hibma MH, Raj K, Ely SJ, Stanley M, Crawford L. 1995. The interaction between human papillomavirus type 16 E1 and E2 proteins is blocked by an antibody to the N-terminal region of E2. Eur. J. Biochem. 229:517–525. 22. Im JS, et al. 2009. Assembly of the Cdc45-Mcm2-7-GINS complex in human cells requires the Ctf4/And-1, RecQL4, and Mcm10 proteins. Proc. Natl. Acad. Sci. U. S. A. 106:15628 –15632. 23. Jeon Y, et al. 2007. Human TopBP1 participates in cyclin E/CDK2 activation and preinitiation complex assembly during G1/S transition. J. Biol. Chem. 282:14882–14890. 24. Kim JE, McAvoy SA, Smith DI, Chen J. 2005. Human TopBP1 ensures genome integrity during normal S phase. Mol. Cell. Biol. 25:10907–10915. 25. King LE, Dornan ES, Donaldson MM, Morgan IM. 2011. Human papillomavirus 16 E2 stability and transcriptional activation is enhanced by E1 via a direct protein-protein interaction. Virology 414:26 –33. 26. Kumagai A, Lee J, Yoo HY, Dunphy WG. 2006. TopBP1 activates the ATR-ATRIP complex. Cell 124:943–955. 27. Kumagai A, Shevchenko A, Dunphy WG. 2011. Direct regulation of Treslin by cyclin-dependent kinase is essential for the onset of DNA replication. J. Cell Biol. 193:995–1007. 28. Kumagai A, Shevchenko A, Dunphy WG. 2010. Treslin collaborates with TopBP1 in triggering the initiation of DNA replication. Cell 140:349 –359.
Journal of Virology
TopBP1 Is Required for Optimum E2 Function
29. Leung CC, Glover JN. 2011. BRCT domains: easy as one, two, three. Cell Cycle 10:2461–2470. 30. Li G, Sturgis EM. 2006. The role of human papillomavirus in squamous carcinoma of the head and neck. Curr. Oncol. Rep. 8:130 –139. 31. Liu K, et al. 2009. Regulation of p53 by TopBP1: a potential mechanism for p53 inactivation in cancer. Mol. Cell. Biol. 29:2673–2693. 32. Liu K, Lin FT, Ruppert JM, Lin WC. 2003. Regulation of E2F1 by BRCT domain-containing protein TopBP1. Mol. Cell. Biol. 23:3287–3304. 33. Liu K, Ling S, Lin WC. 2011. TopBP1 mediates mutant p53 gain of function through NF-Y and p63/p73. Mol. Cell. Biol. 31:4464 – 4481. 34. Liu K, Luo Y, Lin FT, Lin WC. 2004. TopBP1 recruits Brg1/Brm to repress E2F1-induced apoptosis, a novel pRb-independent and E2F1specific control for cell survival. Genes Dev. 18:673– 686. 35. Makiniemi M, et al. 2001. BRCT domain-containing protein TopBP1 functions in DNA replication and damage response. J. Biol. Chem. 276: 30399 –30406. 36. Masterson PJ, Stanley MA, Lewis AP, Romanos MA. 1998. A C-terminal helicase domain of the human papillomavirus E1 protein binds E2 and the DNA polymerase alpha-primase p68 subunit. J. Virol. 72:7407–7419. 37. McPhillips MG, Oliveira JG, Spindler JE, Mitra R, McBride AA. 2006. Brd4 is required for e2-mediated transcriptional activation but not genome partitioning of all papillomaviruses. J. Virol. 80:9530 –9543. 38. Melendy T, Sedman J, Stenlund A. 1995. Cellular factors required for papillomavirus DNA replication. J. Virol. 69:7857–7867. 39. Meyers C, Laimins LA. 1994. In vitro systems for the study and propagation of human papillomaviruses. Curr. Top. Microbiol. Immunol. 186: 199 –215. 40. Mohr IJ, et al. 1990. Targeting the E1 replication protein to the papillomavirus origin of replication by complex formation with the E2 transactivator. Science 250:1694 –1699. 41. Moody CA, Laimins LA. 2010. Human papillomavirus oncoproteins: pathways to transformation. Nat. Rev. Cancer 10:550 –560. 42. Morishima K, et al. 2007. TopBP1 associates with NBS1 and is involved in homologous recombination repair. Biochem. Biophys. Res. Commun. 362:872– 879. 43. Oliveira JG, Colf LA, McBride AA. 2006. Variations in the association of papillomavirus E2 proteins with mitotic chromosomes. Proc. Natl. Acad. Sci. U. S. A. 103:1047–1052. 44. Ozbun MA, Meyers C. 1998. Human papillomavirus type 31b E1 and E2 transcript expression correlates with vegetative viral genome amplification. Virology 248:218 –230. 45. Parish JL, Bean AM, Park RB, Androphy EJ. 2006. ChlR1 is required for loading papillomavirus E2 onto mitotic chromosomes and viral genome maintenance. Mol. Cell 24:867– 876. 46. Park P, et al. 1994. The cellular DNA polymerase alpha-primase is required for papillomavirus DNA replication and associates with the viral E1 helicase. Proc. Natl. Acad. Sci. U. S. A. 91:8700 – 8704. 47. Peng YC, Breiding DE, Sverdrup F, Richard J, Androphy EJ. 2000. AMF-1/Gps2 binds p300 and enhances its interaction with papillomavirus E2 proteins. J. Virol. 74:5872–5879. 48. Piergiovanni G, Costanzo V. 2010. GEMC1 is a novel TopBP1interacting protein involved in chromosomal DNA replication. Cell Cycle 9:3662–3666. 49. Reini K, et al. 2004. TopBP1 localizes to centrosomes in mitosis and to chromosome cores in meiosis. Chromosoma 112:323–330. 50. Romanczuk H, Villa LL, Schlegel R, Howley PM. 1991. The viral transcriptional regulatory region upstream of the E6 and E7 genes is a major determinant of the differential immortalization activities of human papillomavirus types 16 and 18. J. Virol. 65:2739 –2744.
December 2012 Volume 86 Number 23
51. Ruesch M, Stubenrauch F, Laimins L. 1998. Activation of papillomavirus late gene transcription and genome amplification upon differentiation in semisolid medium is coincident with expression of involucrin and transglutaminase but not keratin 10. J. Virol. 72:5016 –5024. 52. Sakai H, Yasugi T, Benson JD, Dowhanick JJ, Howley PM. 1996. Targeted mutagenesis of the human papillomavirus type 16 E2 transactivation domain reveals separable transcriptional activation and DNA replication functions. J. Virol. 70:1602–1611. 53. Schiller JT, Castellsague X, Villa LL, Hildesheim A. 2008. An update of prophylactic human papillomavirus L1 virus-like particle vaccine clinical trial results. Vaccine 26(Suppl 10):K53–K61. 54. Schweiger MR, You J, Howley PM. 2006. Bromodomain protein 4 mediates the papillomavirus E2 transcriptional activation function. J. Virol. 80:4276 – 4285. 55. Sedman J, Stenlund A. 1998. The papillomavirus E1 protein forms a DNA-dependent hexameric complex with ATPase and DNA helicase activities. J. Virol. 72:6893– 6897. 56. Smith JA, et al. 2010. Genome-wide siRNA screen identifies SMCX, EP400, and Brd4 as E2-dependent regulators of human papillomavirus oncogene expression. Proc. Natl. Acad. Sci. U. S. A. 107:3752–3757. 57. Steele BK, Meyers C, Ozbun MA. 2002. Variable expression of some “housekeeping” genes during human keratinocyte differentiation. Anal. Biochem. 307:341–347. 58. Tanaka S, et al. 2007. CDK-dependent phosphorylation of Sld2 and Sld3 initiates DNA replication in budding yeast. Nature 445:328 –332. 59. Taylor ER, Morgan IM. 2003. A novel technique with enhanced detection and quantitation of HPV-16 E1- and E2-mediated DNA replication. Virology 315:103–109. 60. Thierry F, Howley PM. 1991. Functional analysis of E2-mediated repression of the HPV18 P105 promoter. New Biol. 3:90 –100. 61. Ustav M, Stenlund A. 1991. Transient replication of BPV-1 requires two viral polypeptides encoded by the E1 and E2 open reading frames. EMBO J. 10:449 – 457. 62. Vance KW, Campo MS, Morgan IM. 2001. A novel silencer element in the bovine papillomavirus type 4 promoter represses the transcriptional response to papillomavirus E2 protein. J. Virol. 75:2829 –2838. 63. Wang X, Naidu SR, Sverdrup F, Androphy EJ. 2009. Tax1BP1 interacts with papillomavirus E2 and regulates E2-dependent transcription and stability. J. Virol. 83:2274 –2284. 64. White PW, et al. 2003. Inhibition of human papillomavirus DNA replication by small molecule antagonists of the E1-E2 protein interaction. J. Biol. Chem. 278:26765–26772. 65. Yoo HY, Kumagai A, Shevchenko A, Dunphy WG. 2007. Ataxiatelangiectasia mutated (ATM)-dependent activation of ATR occurs through phosphorylation of TopBP1 by ATM. J. Biol. Chem. 282:17501– 17506. 66. Yoo HY, Kumagai A, Shevchenko A, Dunphy WG. 2009. The Mre11Rad50-Nbs1 complex mediates activation of TopBP1 by ATM. Mol. Biol. Cell 20:2351–2360. 67. You J, Croyle JL, Nishimura A, Ozato K, Howley PM. 2004. Interaction of the bovine papillomavirus E2 protein with Brd4 tethers the viral DNA to host mitotic chromosomes. Cell 117:349 –360. 68. Zegerman P, Diffley JF. 2007. Phosphorylation of Sld2 and Sld3 by cyclin-dependent kinases promotes DNA replication in budding yeast. Nature 445:281–285. 69. zur Hausen H. 2009. Papillomaviruses in the causation of human cancers: a brief historical account. Virology 384:260 –265.
jvi.asm.org 12815
