An ipdC gene knock-out of Azospirillum brasilense ... - Springer Link

Antonie van Leeuwenhoek (2008) 93:425–433 DOI 10.1007/s10482-007-9207-x

SHORT COMMUNICATION

An ipdC gene knock-out of Azospirillum brasilense strain SM and its implications on indole-3-acetic acid biosynthesis and plant growth promotion Mandira Malhotra Æ Sheela Srivastava

Received: 24 July 2007 / Accepted: 8 October 2007 / Published online: 20 October 2007 Springer Science+Business Media B.V. 2007

Abstract The indole-3-pyruvate decarboxylase gene (ipdC), coding for a key enzyme of the indole3-pyruvic acid pathway of IAA biosynthesis in Azospirillum brasilense SM was functionally disrupted in a site-specific manner. This disruption was brought about by group II intron-based Targetron gene knock-out system as other conventional methods were unsuccessful in generating an IAA-attenuated mutant. Intron insertion was targeted to position 568 on the sense strand of ipdC, resulting in the knock-out strain, SMIT568s10 which showed a significant (*50%) decrease in the levels of indole-3-acetic acid, indole-3-acetaldehyde and tryptophol compared to the wild type strain SM. In addition, a significant decrease in indole-3-pyruvate decarboxylase enzyme activity by *50% was identified confirming a functional knock-out. Consequently, a reduction in the plant growth promoting response of strain SMIT568s10 was observed in terms of root length and lateral root proliferation as well as the total dry weight of the treated plants. Residual indole-3-pyruvate decarboxylase enzyme activity, and indole3-acetic acid, tryptophol and indole-3-acetaldehyde formed along with the plant growth promoting response by strain SMIT568s10 in comparison with an untreated set suggest the presence of more than one copy of ipdC in the A. brasilense SM genome. M. Malhotra S. Srivastava (&) Department of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021, India e-mail: [email protected]

Keywords Gene knock-out Indole-3-acetic acid Indole-3-pyruvate decarboxylase Targetron Plant growth promoting ability

Auxins like indole-3-acetic acid (IAA) are key factors released by the root- associated bacterium Azospirillum, which is directly involved in benefiting plant growth (Bashan et al. 2004). However, its biosynthesis and regulation has not been completely unraveled and strain to strain differences have been demonstrated (Spaepen et al. 2007; Malhotra and Srivastava, submitted). In Azospirilla and Enterobacteriaceae, IAA is synthesized from the substrate, tryptophan (Trp) via the indole-3-pyruvic acid (IPyA) pathway and the most crucial enzyme of the pathway, indole3-pyruvate decarboxylase (IPDC), coded by the ipdC gene has been identified and cloned from different Azospirillum brasilense strains, such as Sp7, Sp245, and SM (Bothe et al. 1994; Zimmer et al. 1994, 1998; Malhotra and Srivastava, submitted). The different behavior of these strains might be due to differences in the regulation of phytohormone biosynthesis (Malhotra and Srivastava, submitted). A side-product of the IPyA pathway in certain Azospirilla is indole3-ethanol or tryptophol (TOL), formed by the reduction of Indole-3-acetaldehyde (IAAld; Costacurta et al. 1994; Lebuhn and Hartmann 1994). TOL is a storage form of IAA as it may be easily taken up by the plants and converted into active IAA through oxidation by TOL-oxidase (Dobbelaere et al. 2003).

123

426

Isolation of mutants is mandatory to identify the functional genes of a pathway. Earlier studies with transposons and Trp analogues identified A. brasilense mutants with altered IAA producing ability. 5-Fluorotryptophan could induce IAA over-expressing mutants of A. brasilense Sp Cd by consequent de-regulation of Trp biosynthesis (Hartmann et al. 1983) and random mutagenesis in A. lipoferum yielded IAA-negative as well as overproducer variants (Abdel-Salam and Klingmu¨ller 1987). However, all attempts to isolate a completely IAA-deficient mutant of A. brasilense have met with limited success suggesting either multiple pathways or more than one copy of certain genes located on more than one chromosome (Martin-Didonet et al. 2000). In this direction, many low IAA-producing mutants were isolated by Tn5 insertion in A. brasilense strains Sp6, Sp7, Sp13, Sp245, SpF94, Sp6, Yu62 and 8-I and the mutations in strains Sp245, SpF94 and Sp7 involved the ipdC gene (Barbieri et al. 1986; Prinsen et al. 1993; Costacurta et al. 1994; Dobbelaere et al. 1999; Carrenõ-Lopez et al. 2000; Katzy et al. 1990; Xie et al. 2005; Rodriguez et al. 2006). Some of these mutant strains showed variable response with host plants i.e. they either did not affect root growth or had a reduced ability to promote root development (Barbieri and Galli, 1993; Dobbelaere et al. 1999). In contrast to random mutagenesis, gene knock-outs may be beneficial to understand specific gene function. The Group II intron based gene knock-out system (Targetron) allows site-specific disruption of bacterial genes by inserting into defined sites in desired DNA targets through retrohoming, with efficiencies much higher than ectopic integration (Karberg et al. 2001). Such insertions can be selected subsequently by splice- activated markers (Zhong et al. 2003). A. brasilense strain SM produces IAA with Trp as a substrate via the IPyA pathway and lacks the indole-3-acetamide (IAM) pathway (Malhotra and Srivastava 2006; Malhotra and Srivastava, submitted). The aim of this study was to functionally disrupt/ knock-out the crucial ipdC gene involved in the IPyA pathway. Such a mutant strain would not only help to determine the contribution of this gene/ pathway towards IAA biosynthesis and the plant growth promoting (PGP) ability but may also provide an indication of the copy number of ipdC present in the genome.

123

Antonie van Leeuwenhoek (2008) 93:425–433

A natural isolate of A. brasilense strain SM (MTCC 4037, India) was used in this study (Malhotra and Srivastava 2006). The Azospirillum cultures were maintained and grown in modified Luria-Bertani (LB*) medium and DNA was isolated according to standard protocols (Ausubel et al. 1995). Electrotransformation was performed with A. brasilense SM competent cells with the micro-pulser apparatus (BioRad) as mentioned earlier (Malhotra and Srivastava 2006). Quantification of IAA and inoculation of sorghum seeds was performed as described earlier (Malhotra and Srivastava 2006). Escherichia coli strains were raised in LB medium and plasmid isolation, restriction digestion; ligation {enzymes procured from New England Biolabs (Beverley, Massachusetts)} and transformation were performed by standard techniques (Sambrook et al. 1989). DNA was eluted from agarose gels by the Gel extraction kit (MDI, Advanced Microdevices, India). PCRs were performed with d-NTPs (250–350 lM) and the Expand high fidelity PCR system from Roche Diagnostics (GmbH, Germany). All chemicals of analytical grade and standards were purchased from Sigma-Aldrich (St. Louis, Missouri). The strains used in this study are listed in Table 1. The TargeTron gene knockout system (SigmaAldrich) that allows the site-specific disruption of bacterial genes by insertion of a Group II intron was used for knocking out the ipdC gene of A. brasilense SM. This method was chosen as an alternative strategy, as chemical mutagens or transposons did not yield low-IAA expressing variants of A. brasilense SM. Such a mechanism of targeted insertion has been validated in a handful of bacterial strains till date (Karberg et al. 2001; Zhong et al. 2003). The success of such an integration event into the target bacterial genome depends on the stability of the construct, as efficient expression of the intron components is a pre-requisite for its site-specific insertion. For this purpose, appropriate modifications were carried out during this study to create a recombinant plasmid that allowed efficient expression of the intron components in the host bacterial strain, A. brasilense SM. The group II intron’s potential insertion sites in the ipdC gene were identified by the Sigma-Aldrich algorithm and position 568 on the ipdC sense strand (568s) was chosen as the intron-insertion target. Three primers were then designed to re-target


427

Table 1 Bacterial strains and plasmids used in this study Strain or plasmid

Relevant characterisitics

Reference

DH5a

hsdR17 endA1 thi-1 gyrA96 relA1 recA1 supE44 DlacU169 (U80lacZDM15)

Sambrook et al. 1989

XL1Blue

supE44 hsdR17 (r-k m+k ) recA1 endA1 thi-1 gyrA96 relA1 lacF0 [proAB+ lacIq lac Z DM15 Tn10 (Tcr)

Sambrook et al. 1989

pME3468

11.0 kb pME6000 derivative carrying a 4.0 kb KpnI-NcoI fragment containing iaaM-iaaH genes of Pseudomonas syringae, Tcr, Pcat; maintained in E. coli DH5a

Beyeler et al. 1999

pACD4K-C

7.7 kb intron expression vector driving expression from T7 promoter, Cmr, carrying kanr as the marker activated by retrotransposition (RAM) in E. coli XL1Blue

Sigma–Aldrich

pACDIT568s

*8 kb pACD4K-C derivative, carrying the *350 bp mutated intron specific to insertion at position 568s of ipdC, T7 promoter replaced by constitutive Pspc, Cmr, in E. coli XL1Blue

This study

pMEIT568s

*12.2 kb pME3468 derivative carrying *5.5 kb ClaI-NcoI fragment from pACDIT568s inserted into the ClaI-NcoI sites of pME3468 (replacing the iaaM-iaaH genes), containing all components necessary for intron expression driven by Pspc, Tcr, in E. coli DH5a

This study

A. brasilense SM

Wild-type strain, isolated from Sorghum officinalis roots, Apr

MTCC 4037, IMTECH, India

A. brasilense SMIT568s10

A. brasilense SM derivative carrying the mutated intron inserted at position 568s of the ipdC gene, Kmr

This Study

Escherichia coli

Azospirillum brasilense

(mutate) the intron to position 568 s of ipdC (Table 2). The primers- IBS, EBS1d and EBS2 were used to mutate the RNA portion of the intron by a primary PCR. The PCR product was eluted, digested with HindIII and BsrGI, subsequently ligated to the linearized pACD4K-C (digested with the same enzymes) which was transformed in E. coli strain XL1Blue. This plasmid was used as a template in a secondary PCR with Pspc (synthesized on the basis of the E. coli Pspc sequence information) and EBS1d primers to incorporate the constitutive, E. coli spc

ribosomal protein operon promoter (Pspc) and yielded pACDIT568s. The plasmid pACD4K-C could not be used directly since the components of the group II intron were placed under the T7 promoter and A. brasilense does not seem to express T7 polymerase (data not shown). The ipdC gene was ultimately disrupted in A. brasilense SM using the plasmid pMEIT568s which was derived from pME3468 (a derivative of pME6000, the pBBR1MCS-based broad host-range cloning vector, maintained in E. coli DH5a), as

Table 2 Primers used in this study. The primers were used for targeted disruption of Azospirillum brasilense strain SM ipdC gene, confirmation for the presence of the intron and preparation of the probe for Southern hybridization Primer IBS

a

EBS-1d

a

Sequence

Restriction site

AAAAAAGCTTATAATTATCCTTAACGCACATCCTGGTGCGCCCAGATAGGGTG

HindIII

CAGATTGTACAAATGTGGTGATAACAGATAAGTCATCCTGCCTAACTTACCTTTCTTTGT

BsrGI

EBS2a

TGAACGCAAGTTTCTAATTTCGATTTGCGTTCGATAGAGGAAAGTGTCT

–

Pspc

AAAAAAGCTTccgtttattttttctacccatatccttgaagcggtgttataatgccgcgccctcgata AAAAGAGCTTATAATTATCCTTA

HindIII

ipdCRI

ACCACCGTCAGGATGCGCTT

–

Note: The restriction sites used for cloning are marked in bold a

The primers are targeted to insert at position 568|569 in the sense strand (retargeting the Ll.LtrB-group II intron) of ipdC as follows: TTCAAGGTGGCGGAGGAAACGCAGATCCTG (50 exon)—INTRON—CCGCTCCACACGCTG (30 exon)

123

428


*2.6 kb fragment from strain SMIT568s10 but not from the wild type strain (Fig. 1c). This indicated that the intron was indeed inserted into the ipdC gene at position 568s and disrupted it. For detection of IAA, TOL and IAAld, A. brasilense SM and its ipdC knock-out variant, strain SMIT568s10 were raised as mentioned previously (Malhotra and Srivastava 2006). As Trp is the substrate for IAA biosynthesis in A. brasilense SM, cultures were raised initially in the presence of 1 mM Trp (prepared in 0.1 N HCl) for 20 h and subsequently grown further for 24 h in 5 mM Trp. The amount of IAA, TOL and IAAld were quantified by HPLC as described earlier (Carrenõ-Lopez et al. 2000; Malhotra and Srivastava 2006). Briefly, the ethyl acetate extracted culture filtrate samples were vacuum dried, reconstituted in 2 ml methanol and 10 ll aliquots were analyzed with a Merck Lichrospher 100 RP-18e (250 · 4 mm, 5 lm, Darmstadt, Germany) column in a Shimadzu Class10 HPLC system (Class-VP release 6.13 SP1, Kyoto, Japan). The products were resolved on the basis of a range of standards (Sigma-Aldrich) in methanol: 1% acetic acid at a flow rate of 1 ml/min at 280 nm with a UV detector. As is clear from Fig. 2, the strain SMIT568s10 showed significantly lower IAA level

described below. From the pACDIT568s, a *5.5 kb ClaI-NcoI fragment was ligated with the *6.7 kb ClaI-NcoI digested pME3468 to give an *12.2 kb plasmid, pMEIT568s (Fig. 1a), which carried the ipdC-specific mutated intron. This was electrotransformed into A. brasilense SM cells (Apr) and screening was done for the retrotranspositionactivated marker, Kmr. We have earlier used pME3468 for stable, heterologous gene expression in A. brasilense SM (Malhotra and Srivastava 2006). Further, such vectors have been shown to be stable in Azospirillum (Rothballer et al. 2005; Malhotra and Srivastava 2006). The vector plasmid generated during the study can be used to create specific gene knock-outs in Azospirillum with a set of specific mutated primers to retarget the intron to the required site in a gene. The Kmr variant strain of A. brasilense SM, strain SMIT568s10 was confirmed for the presence of the intron by PCR with IBS/EBS2 primers and ipdC disruption by EBS2/ipdCRI primers (intron and internal ipdC specific primer). As is clear from Fig. 1b, the former primer set yielded an *350 bp fragment (same as that obtained for pACDIT568s) from the variant strain SMIT568s10 but not the wild type A. brasilense SM. Similarly, primers EBS2 and ipdCRI yielded a 1

2

3

1

(a)

2

3

1

4

(b)

3

3

1.0

10 6 4 3 2

0. 8 0.7 0. 6

1

1.5 10 8 6 5 4

2

(c)

0. 5 0. 4 2

Fig. 1 Creation of the plasmid construct for gene-knockout and validation of ipdC disruption in Azospirillum brasilense SM. Restriction analysis of (a) pMEIT568s (lane 1) showing the *5.5 kb fallout observed after ClaI-NcoI digestion, carrying the intron components. Lane 3 shows the eluted fragment of 6.7 kb ClaI-NcoI digested pME3468 and Lane 2 shows the profile of 1 kb DNA marker as resolved on 0.8% agarose gel. (b) Shows the PCR amplification of the *350 bp fragment from the group II intron with IBS/EBS2 primers, from A. brasilense SM variant SMIT568s10 (lane 2) and the control plasmid pACDIT568s (carrying the intron, lane 3)

123

0.3

while the same was not observed from wild type A. brasilense SM (lane 1). Lane 4 represents the profile of 100 bp DNA marker. (c) PCR amplification with EBS2/ipdCRI primers that yields a *2.6 kb fragment carrying a part of the intron and the ipdC coding region, confirming the disruption of the ipdC gene with the intron. While lane 1 shows the positive PCR profile of A. brasilense SMIT568s10, lane 2 shows no amplification from wild type strain SM. Lane 3 shows the profile of 1 kb marker. Note: the marker band sizes are indicated in kb. The sequence of A. brasilense SM ipdC gene is deposited in GenBank under the accession number DQ490109


(a)

429

0.04

10.02 µ g/OD560 IAA

Volts

0.03 0.02 0.01 0.00 0

2

4

6

8

10

12

14

10

12

14

Minutes

(b)

0.04

5.12 µ g/OD560 IAA

Volts

0.03 0.02 0.01 0.00 0

2

4

6

8

Minutes

Fig. 2 HPLC analysis of ethyl acetate-extracted culture filtrates for IAA. (a) Azospirillum brasilense SM, (b) ipdCdisrupted variant of A. brasilense SM, strain SMIT568s10 grown with 5mM Trp. Samples were analyzed and peaks observed were correlated with that obtained for the IAA standard on the basis of retention time. Arrows in the figure identify peaks of IAA. Note: Concentrations of IAA were calculated to confirm the differences between the wild type strain and its variants, and is represented as lg/OD560 to account for any variation in the growth

(*51%) compared to strain SM. This result was further supplemented by 43% and 54% decrease in the accumulation of the IPyA pathway intermediate, IAAld, and its by-product, TOL, respectively, (Table 3). The production of these compounds, like IAA, has been observed to be Trp-dependent in strain SM (Table 3, Malhotra and Srivastava 2006). Our results, therefore, confirmed that targeted disruption of ipdC gene has indeed been achieved. In contrast, in Pseudomonas putida GR12–2, insertional inactivation of the ipdC gene led to a drastic decrease in IAA production by *96% compared to the wild type strain (Patten and Glick 2002). Our observations thus suggest that perhaps more than one copy of ipdC is present in the A. brasilense SM genome. While only one copy of ipdC may have been disrupted by the intron insertion, the other copy may still be intact, thereby allowing conversion of IPyA to IAAld and then to IAA. This was further substantiated by determining the IPDC enzyme levels of the two strains in question (Table 3). To confirm the disruption of ipdC, we quantified the IPDC enzyme activity in strains SM and SMIT568s10 as described earlier (Koga et al. 1992; Costacurta et al. 1994). Briefly, the cells raised in LB* medium supplemented with 2.5 mM CaCl2, 2.5 mM MgSO4 and 1 mM Trp were resuspended in the extraction buffer (10 mM phosphate buffer, pH 6.5, containing 5 mM MgCl2 and 0.1 mM thiamine pyrophosphate). After sonication for 6 min at 250 W, 20 KHz and subsequent centrifugation at 18,000 rpm for 30 min, the supernatant was collected

Table 3 Effect of knocking out the ipdC gene function on the indole-3-pyruvate decarboxylase (IPDC) enzyme activity in Azospirillum brasilense SM Product

Indole-3-ethanol Indole-3-acetaldehyde

Substrate

Quantification in culture filtrate (lg/OD560)a

IPDC specific activity (lg/mg protein/min)a

Strain SM

Strain SM

Strain SMIT568s10

Strain SMIT568s10

–Trp

Undetected

Undetected

0.268 ± 0.010

0.102 ± 0.007

+Trp

1.08 ± 0.012b

0.58 ± 0.011b

1.252 ± 0.009c

0.626 ± 0.004c

–Trp

Undetected

Undetected

0.615 ± 0.016

0.217 ± 0.020

+Trp

13.60 ± 0.033b

5.79 ± 0.019b

2.300 ± 0.022c

1.006 ± 0.019c

a

All experiments were carried out in triplicate and the values shown are mean ± standard error from mean (Sem). Each experiment was repeated three times. All the Data from experiments with bacterial cultures were pooled and analyzed for their distribution pattern by the one sample Kolmogorov-Smirnov Z test and all sets were found to be normally distributed. The data was subsequently analyzed by ANOVA followed by Tukey’s Post hoc analysis at P £ 0.05 and Student’s t-test at P £ 0.05. All analysis was performed with Statistical Package for Social Sciences (SPSS ver. 11.0 for Windows) b

The culture filtrate samples were prepared by raising the cells in 5 mM Trp as described

c

Samples for IPDC enzyme assay were raised in 1 mM Trp as described

123

430

as the enzymatically active fraction. Each IPDC assay contained in 3 ml, 0.2 mM IPyA (dissolved in ethanol) and 50 lg of protein. The mixture was incubated at 25C for 10 min and the reaction was subsequently stopped with the addition of 0.24 ml 0.1 N HCl containing 50% ethanol. The samples were filtered through 0.22 l filters and the amounts of TOL and IAAld formed were analyzed by HPLC as mentioned above. IPDC specific activity was calculated on the basis of the amount of the IAAld and TOL formed from IPyA with the protein present in the crude enzyme extract. The Bicinchoninic acid protein assay kit (Sigma-Aldrich) was used to estimate the protein concentration in the enzyme extracts as per the manufacturer’s instructions. The IPDC specific activity in strains SM and SMIT568s10 are indicated in Table 3. Unlike IAA biosynthesis which takes place in the presence of Trp, low IPDC specific activity was observed even in the absence of Trp. However, IPDC activity in the presence of Trp, like IAA accumulation in strain SMIT568s10, was significantly lower (*50%) than that observed in strain SM in similar conditions. This confirmed that the comparatively lower IAA levels in strain SMIT568s10 is because of reduced IPDC activity. Nevertheless, the residual IPDC activity of strain SMIT568s10 may also indicate the presence of a second copy of the ipdC gene in the A. brasilense genome. Our results are in contrast to those shown for the single ipdC copy carrying strain Sp7 where only 6% residual IPDC activity was noted in a mutant strain (Carrenõ-Lopez et al. 2000). The targeted disruption of the ipdC gene in the variant strain SMIT568s10 showed attenuated IAA production in the presence of exogenous Trp, a physiological condition in which the wild type strain produces large amounts of IAA (Fig. 2). The possibility of more than one copy of ipdC was earlier put across for A. brasilense Sp7 (Zimmer et al. 1998). Subsequent results for A. brasilense strains Sp245, Sp7 and Sp13 and for P. putida GR12–2, however, suggest only a single copy of the ipdC gene (Costacurta et al. 1994; Carrenõ-Lopez et al. 2000; Patten and Glick 2002). This reflects a possible variability in the copy number of ipdC within the same bacterial species and this may contribute to the variable IAA level between members of the same species. The organization of the Azospirillum genome is highly complex, with the genetic information

123


distributed on several replicons ranging in their molecular sizes from 0.2 to 2.7 Mbp (Martin-Didonet et al. 2000). The presence of 16S rDNA on more than one replicon suggests that Azospirilla may contain multiple chromosomes, leading to the proposition that certain genes may be present on more than one replicon. Moreover, the DNA pattern may be strainspecific rather than species-specific, a result also observed for Brucella (Jumas-Bilak et al. 1998). The role of these replicons may be to support the metabolic flexibility of the bacterial species. The major Trp-dependent pathways of IAA biosynthesis in bacteria are the IPyA and IAM pathways while Tryptamine (TAM), Trp side-chain oxidase and Indole acetonitrile (IAN) pathways are less prevalent. Of the major pathways, the IPyA pathway is known to be inducible, subject to extremely tight regulation and the most prominent pathway both in plants and plant-beneficial bacteria, such as Azospirillum (Spaepen et al. 2007). The mechanisms, by which microbes regulate the IAA levels, are complex and not fully understood and may involve non-specific molecules as well. Recently, Rodriguez et al. (2006) isolated a Tn-5 insertion mutant in the clpX gene coding for a heat shock protein of A. brasilense 8-I leading to pleiotropic physiological effects including IAA-attenuation. Besides a multitude of factors that interplay with each other to control the IAA secreted by a microbe, the problem is further compounded by the multiple IAA biosynthetic pathways operating in a bacterium. The production of a high level of indolic compounds by an ipdC- mutant of A. brasilense Sp7 identified the presence of an alternative route of IAA biosynthesis regulated by catabolite repression (Carrenõ-Lopez et al. 2000). In A. brasilense Sp6, three different IAA biosynthetic pathways were identified (Prinsen et al. 1993; Costacurta et al. 1994). However, as no genes/enzymes have been identified, the Trp-independent pathway has not been confirmed till date. Trp-precursors, anthranilate and indole do not support efficient IAA biosynthesis by A. brasilense SM (data not shown). This provides evidence that IAA is solely a by-product of Trp catabolism and confirms the results put forth for A. brasilense strains Sp7 and Sp245 (Zimmer et al. 1991; Zakharova et al. 1999). However, multiple pathways of IAA biosynthesis in strain SM have been ruled out as this stain produces IAA only via the IPyA pathway and the others, such as the IAM, IAN and


TAM pathways are absent (Malhotra and Srivastava 2006; Sheela Srivastava, personal communication). The most crucial IPyA pathway enzyme, IPDC, is encoded by the ipdC gene and the same has been cloned from A. brasilense SM (Malhotra and Srivastava, submitted). To analyze the effect of this partial knocking out of the ipdC function in strain SM, sorghum (Sudex chari) seeds were inoculated (bacterized) with the optimum *2 · 108 cfu/ml of A. brasilense strains SM and SMIT568s10, as described previously (Malhotra and Srivastava 2006). The seeds were transferred to sterile sand and the seedling growth was monitored under controlled conditions in a culture room at 28C for 14 days. At the end of this period, the data for root and shoot length, lateral root number and dry weight was recorded. The wild type A. brasilense SM showed significant improvement in root length (*46%) and lateral branching of roots in comparison with uninoculated seeds (Table 4). Similar inoculation with the strain SMIT568s10 led to reduced PGP ability in terms of significantly decreased root length (by 20%) and number of lateral roots (by *15%) in comparison with wild type strain SM treatment. Nevertheless, as this strain was still able to produce *50% IAA of that produced by strain SM, its response was significantly better than the untreated plants in terms of the above mentioned parameters (Table 4; Fig. 3). Additionally, the lateral roots observed after strain SMIT568s10 treatment were shorter than those observed after A. brasilense SM treatment (Fig. 3). The shoot length in both the sets of inoculated seedlings showed an increase of

431

8–11% in comparison with the untreated set. As is also evident from Table 4, a significant increase in the total dry weight of the inoculated seedlings was observed for strain SM and SMIT568s10 (*72% and 29%, respectively), in comparison with the untreated seeds after two weeks. In addition, the low IAA producing strain SMIT568s10 showed a decreased PGP ability. On similar lines, it has been shown that bacterial IAA plays a major role in the promotion of canola root growth. The random insertional inactivation of the P. putida GR12–2 ipdC gene not only led to drastic decrease in IAA production but also a consequent reduction in the PGP ability. Here again, the wild type strain could bring about 35% increase in root growth compared to the mutant strain (Patten and Glick 2002). In contrast, however, the inhibition of wheat root development brought about by high cell number of A. brasilense Sp245 was abolished when its ipdC–inactivated mutant strain Sp245b was used (Dobbelaere et al. 1999). As IAA is secreted out of bacterial cells, it has an important role to play in the plant-bacterium interactions. The *50% decrease in IAA and the reduced formation of IAA intermediates, IAAld and TOL, in the ipdC-disrupted A. brasilense SMIT568s10, indicated the important contribution of this gene in regulating the amount of IAA accumulated by the bacterium and its influence on the PGP ability of strain SM. In the light of the absence of multiple IAA biosynthetic pathways in this strain and residual IPDC activity in the ipdC knock-out strain SMIT568s10, the presence of more than one copy of the ipdC gene in the A. brasilense SM genome can

Table 4 Effect of inoculation of sorghum seeds with wild type Azospirillum brasilense SM, and its ipdC- disrupted variant strain, SMIT568s10. Untreated seeds served as control Parameter

Untreated

A. brasilense SM a

A. brasilense SMIT568s10 7.15 ± 0.242b,

a

Root length

6.08 ± 0.252

8.91 ± 0.380

Shoot length

17.44 ± 0.915

19.00 ± 0.986a

Lateral root number

23.33 ± 0.816

a

34.11 ± 0.889

28.78 ± 0.401b,

Total dry weight

0.787

1.356

1.013

19.44 ± 0.747a a

Note: The values represent the average/total of 12 plants per set along with their Sem taken at 14 days post treatment. Root and shoot lengths are shown in cm and dry weight is in gm. For the statistical analysis, the data for root and shoot length, and the number of lateral roots of 12 plants per set was analyzed by the one sample Kolmogorov-Smirnov Z test for their distribution pattern and by ANOVA followed by Tukey’s Post hoc analysis at P £ 0.05 as well as Student’s t-test at P £ 0.05, to identify if seed inoculation influenced the seedling growth a

Represents values that significantly differ from untreated plants at P £ 0.05

b

Represents values that significantly differ from wild type strain SM-treated plants at P £ 0.05

123

432


Fig. 3 Influence of ipdCknockout on plant growth promoting ability of Azospirillum brasilense strain SM. Sorghum seed bacterization was carried out with cultures containing *108 cfu/ml of A. brasilense SM and its ipdC knock-out strain, SMIT568s10. The figure shows the representative plant response to the bacterial treatment (differences in the length of root and lateral roots) at the end of 14 days. (a) Untreated control, (b) A. brasilense SM and (c) A. brasilense SMIT568s10

be hypothesized. It can also be suggested that this would enable the strain to maintain an appropriate level of IAA in the rhizosphere, and thus ensure its PGP status. This study is the first to report the use of the group II intron to achieve targeted disruption of a critical gene in plant growth promotion by the rhizospheric bacterium, Azospirillum. Since the genome information of Azospirillum is still incomplete, the copy number of the genes involved in bacterial IAA biosynthesis and/or regulation can only be predicted as of now and there may be a variability within the strains of the same species on this account. Acknowledgements Authors thank Prof. Dieter Haas (Universite de Lausanne, Switzerland) for the gift of pME3468. M.M. acknowledges financial support by Council of Scientific and Industrial Research, India. The authors also acknowledge financial assistance by Department of Biotechnology, Govt. of India to S.S. and facilities supported by University Grants Commission under the SAP program and Department of Science and Technology under the FIST program in the Department of Genetics, UDSC, New Delhi.

References Abdel-Salam MS, Klingmu¨ller W (1987) Transposon Tn5 mutagenesis in Azospirillum lipoferum: isolation of indole-3-acetic acid mutants. Mol Gen Genet 210: 165–170

123

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1995) Short protocols in molecular biology, 3rd edn. Wiley Interscience, New York Barbieri P, Galli E (1993) Effect on wheat root development of inoculation with an Azospirillum brasilense mutant with altered indole-3-acetic acid production. Res Microbiol 144:69–75 Barbieri P, Zanelli T, Galli E, Zanetti G (1986) Wheat inoculation with Azospirillum brasilense Sp 6 and some mutants altered in nitrogen fixation and indole-3-acetic acid production. FEMS Microbiol Lett 36:87–90 Bashan Y, Holguin G, de-Bashan LE (2004) Azospirillum-plant relationships: physiological, molecular, agricultural and environmental advances (1997–2003). Can J Microbiol 50:521–577 Beyeler M, Keel C, Michaux P, Haas D (1999) Enhanced production of indole-3-acetic acid by a genetically modified strain of Pseudomonas fluorescens CHA0 affects root growth of cucumber, but does not improve protection of the plant against Pythium root rot. FEMS Microbiol Ecol 28:225–233 Bothe H, ZimmerW, Kloos K, Kaldorf M (1994) Azospirillum and related organisms: ecological, physiological, biochemical and genetical aspects. In: Hegazi NA, Fayez M, Monib M (eds) Nitrogen fixation with nonlegumes. The American University in Cairo Press, Cairo pp 43–52 Carrenõ-Lopez R, Campos-Reales N, Elmerich C, Baca BE (2000) Physiological evidence for differently regulated tryptophan-dependent pathways for indole-3-acetic acid synthesis in Azospirillum brasilense. Mol Gen Genet 264:521–530 Costacurta A, Keijers V, Vanderleyden J (1994) Molecular cloning and sequence analysis of an Azospirillum

Antonie van Leeuwenhoek (2008) 93:425–433 brasilense indole-3-pyruvate decarboxylase gene. Mol Gen Genet 243:463–472 Dobbelaere S, Croonenborghs A, Thys A, Vande Broek A, Vanderleyden J (1999) Phytostimulatory effect of Azospirillum brasilense wild type and mutant strains altered in IAA production on wheat. Plant Soil 212:155–164 Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growthpromoting effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci 22:107–149 Hartmann A, Singh M, Klingmueller W (1983) Isolation and characterization of Azospirillum mutants excreting high amounts of indoleacetic acid. Can J Microbiol 29: 916–923 Jumas-Bilak E, Michaux-Charachon S, Bourg G, Ramuz M, Allardet-Servent A (1998) Unconventional genomic organization in the alpha subgroup of the Proteobacteria. J Bacteriol 180:2749–2755 Karberg M, Guo H, Zhong J, Coon R, Perutka J, Lambowitz A (2001) Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat Biotechnol 19:1162–1167 Katzy EI, Iosipenko AD, Egorenkov DA, Zhuravleva EA, Panasenko VI, Ignatov VV (1990) Involvement of Azospirillum brasilense plasmid DNA in the production of indoleacetic acid. FEMS Microbiol Lett 72:1–4 Koga J, Adachi T, Hidaka H (1992) Purification and characterization of indolepyruvate decarboxylase. J Biol Chem 267:15823–15828 Lebuhn M, Hartmann A (1994) Production of auxin and L-tryptophan related indolic and phenolic compounds by Azospirillum brasilense and Azospirillum lipoferum. In: Ryder MH, Stephens PM, Bowen GD (eds) Improving plant productivity with rhizosphere bacteria. CSIRO, Glen Osmond pp 145–147 Malhotra M, Srivastava S (2006) Targeted engineering of Azospirillum brasilense strain SM with Indole Acetamide pathway for IAA over-expression. Can J Microbiol 52:1078–1084 Martin-Didonet CCG, Chubatsu LS, Souza EM, Kleina M, Rego FGM, Rigo LU, Yates MG, Pedrosa FO (2000) Genome structure of the genus Azospirillum. J Bacteriol 182:4113–4116 Patten CL, Glick BR (2002) Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Appl Environ Microbiol 68:3795–3801

433 Prinsen E, Costacurta A, Michiels K, Vanderleyden J, Van Onckelen H (1993) Azospirillum brasilense indole-3acetic acid biosynthesis: evidence for a non-tryptophan dependent pathway. Mol Plant Microbe Interact 6: 609–615 Rodriguez H, Mendoza A, Cruz MA, Holguin G, Glick BR, Bashan Y (2006) Pleiotropic physiological effects in the plant growth-promoting bacterium Azospirillum brasilense following chromosomal labeling in the clpX gene. FEMS Microbiol Ecol 57:217–225 Rothballer M, Schmid M, Fekete A, Hartmann A (2005) Comparative in situ analysis of ipdC-gfpmut3 promoter fusions of Azospirillum brasilense strains Sp7 and Sp245. Environ Microbiol 7:1839–1846 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Spaepen S, Vanderleyden J, Remans R (2007) Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol Rev 31:425–448 Xie B, Xu K, Zhao HX, Chen SF (2005) Isolation of transposon mutants from Azospirillum brasilense Yu62 and characterization of genes involved in indole-3-acetic acid biosynthesis. FEMS Microbiol Lett 248:57–63 Zakharova EA, Shcherbakov AA, Brudnik VV, Skripko NG, Bulkhin NS, Ignatov VV (1999) Biosynthesis of indole-3acetic acid in Azospirillum brasilense, Insights from quantum chemistry. Eur J Biochem 259:572–576 Zhong J Karberg M, Lambowitz A (2003) Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition activated selectable marker. Nucleic Acids Res 31:1656–1664 Zimmer W, Aparicio C, Elmerich C (1991) Relationship between tryptophan biosynthesis and indole-3-acetic acid production in Azospirillum: identification and sequencing of a trpGDC cluster. Mol Gen Genet 229:41–51 Zimmer W, Hundeshagen B, Niederau E (1994) Demonstration of the indolepyruvate decarboxylase gene in different auxin-producing species of the Enterobacteriaceae. Can J Microbiol 40:1072–1076 Zimmer W, Wesche M, Timmermans L (1998) Identification and isolation of the indole-3-pyruvate decarboxylase gene from Azospirillum brasilense Sp7: sequencing and functional analysis of the gene locus. Curr Microbiol 36: 327–331

123