DNA AND CELL BIOLOGY Volume 21, Number 8, 2002 © Mary Ann Liebert, Inc. Pp. 571–580
An Oxysterol-Binding Protein Family Identified in the Mouse ANGELA M. ANNISS, 1 JIM APOSTOLOPOULOS, 1 SEBASTIAN DWORKIN, 2 LOUISE E. PURTON,2 and ROSEMARY L. SPARROW1
ABSTRACT Oxysterols are oxygenated derivatives of cholesterol. They have been shown to influence a variety of biological functions including sterol metabolism, lipid trafficking, and apoptosis. Recently, 12 human OSBP-related genes have been identified. In this study, we have identified a family of 12 oxysterol-binding protein (OSBP)related proteins (ORPs) in the mouse. A high level of amino acid identity (88–97%) was determined between mouse and human ORPs, indicating a very high degree of evolutionary conservation. All proteins identified contained the conserved OSBP amino acid sequence signature motif “EQVSHHPP,” and most contained a pleckstrin homology (PH) domain. Using RT-PCR, each mouse ORP gene was found to exhibit a unique tissue distribution with many showing high expression in testicular, brain, and heart tissues. Interestingly, the tissue distribution of ORP-4 and ORP-10 were the most selective within the family. Expression of the various ORP genes was also investigated, specifically in highly purified populations of hemopoietic precursor cells defined by the lin2 c-kit1 Sca-11 (LKS 1 ) and lin2 c-kit1 Sca-12 (LKS2 ) immunophenotype. Most ORP genes were expressed in both LKS1 and LKS2 populations, although ORP-4 appeared to be more highly expressed in the primitive, stem-cell enriched LKS1 population, whereas ORP-10 was more highly expressed by maturing LKS2 cells. The identification of a family of ORP proteins in the mouse, the frequently preferred animal model for in vivo studies, should further our understanding of the function of these proteins and their interactions with each other. INTRODUCTION
O
of cholesterol that have potent regulatory functions in a wide range of biologic mechanisms (reviewed by Schroepfer, 2000). These include cholesterol homeostasis through transcriptional inhibition of 3-hydoxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, HMG CoA synthase, and low-density lipoprotein receptors (LDL), as well as apoptosis, calcium uptake, atherosclerotic plaque formation, and cell differentiation. Oxysterol binding protein (OSBP) is a cytosolic protein that has been shown to bind a variety of oxysterols and is capable of mediating its function by interaction with the Golgi apparatus (Taylor and Kandutsch, 1985, Ridgway et al., 1992). Recently, a family of 11 human genes showing sequence similarity to OSBP has been identified (Laitinen et al., 1999; Jaworski et al., 2001; Lehto et al., 2001). The predicted proteins encoded by these genes, called OSBP-related proteins (ORPs), have a sterol-binding domain containing the highly conserved amino acid sequence sigXYSTEROLS ARE OXYGENATE D DERIVATIVE S
nature motif “EQVSHHPP.” In addition, most ORPs also contain a pleckstrin homology (PH) domain that is associated with intracellular translocation and Golgi membrane binding of OSBP (Ridgway et al., 1992; Lagace et al., 1997; Levine et al., 1998). To date, little is known about the function of the various human ORP family members. Northern blot and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis has verified that each ORP displays a distinct tissue expression pattern, with the majority showing high expression in the brain (Jaworski et al., 2001; Lehto et al., 2001). This suggests that ORPs play an important role in maintaining cholesterol homeostasis in the central nervous system (Laitinen et al., 1999). Roles other than cholesterol metabolism have also been suggested. For example, ORP-4, also designated HLM, has been reported to be upregulated in the breast and cervix cancer cell lines as well as in the breast and lung cancer tissue samples (Fournier et al., 1999). In addition, it has been suggested that ORP-4 could play a role in age-related eye diseases such as macular degeneration and cataracts due to its high and specific expression in the retina
1 Research 2 Stem
Unit, Australian Red Cross Blood Service Victoria, Melbourne, Australia. Cell Laboratory, Peter MacCallum Cancer Institute, Melbourne, Australia.
571
OSBP ORP-1a ORP-2 ORP-3 ORP-4 ORP-5 ORP-6 ORP-7 ORP-8 ORP-9 ORP-10 ORP-11 GAPDH b2-microglobulin
Gene
AGGAGGAAACAGTGAAGGCTGCAAC CGTACCTCATCCACAAAGCCAGTTC CAGCGGATCACAGAGTACATGGAGC GGAGAGGATGGTGTACGTAGCAGCC GAGACCTTCGAGCTGGACCGTATGG TCTCACTCAGGAATGGCGCTACCGA GAAGCTCCCAGTAGGTGTCGTTAGA GCTCAACGAACCGCTCAACACACTG TCCGAGCTACTTCAGAGTCAGATGG GCCGAATGATACTGAAGAGAACGCAG CAGAAGAGGAACACAACTCACAGCC AGCGTTCTGGAGTTCACCTACAGCA GTCTTCTGGTTGGCAGTAATGGCATGGACT GTCGCTTCAGTCGTCAGCATGG
39)
GENE -SPECIFIC PRIMERS USED
Forward primer (59®
TABLE 1. TO
IN
39)
VARIOUS MOUSE TISSUES
CAATCACCTGGAGAGAGCCTTCCGG TCCACTTCCCATAGAGAGCACAGAG ACAGCAGGTAGGGTTGGTCCAGGTA CAGTGGCAGGAGTCGTCATTCAGGT CTCACCACTCCAGTCACCTTTCGGG CTAGGAGGGAGTTCTGCAGGCGT GGAGGAGATGGATCGAGCACTACGG CACAGGCACGATCTCCAGGGATTTG TTTAAGGGCTCCACAGGCTCAGGGT AAGGCTGCGGGACTCATACTCATTCT AGGAGATGGGCGGATGATGGGATAC CGTTTCTGCTCTGTGGCCTTGTCAT TCATCAACGGGAAGCCCATCACCATCTTC CATTGCTATTTCTTTCTGCGTGCAT
Reverse primer (59®
DETERMINE EXPRESSION
RT-PCR
59 57 59 59 61 61 57 61 59 57 60 57 60 65
Annealing temp (°C)
BY
506 567 400 415 395 585 542 358 390 600 561 185 357 480
Fragment length (nucleotide number)
572 ANNISS ET AL.
95%
Mapped to Chromosome 19 687a
% AA identity compared to human
Genomic sequences
261–677
Oxysterol binding region (AA number)
2–429
No
437 (50)
AC102055.1
97%
AF394063
ORP-1A
OSBPL2
35–476
No
484 (55)
AC092259.1 AA711634
89%
BI152501 BB844047 BB619534 BB667982 BI415372 AW989063 BE334880 BF300491
ORP-2
OSBPL3
454–843
Yes (51–145)
855 (97)
N/A —
91%
AK004768
ORP-3
Yes (151–267)
ND a
OSBP2 HLM
OSBPL5
361–787
898 (101)
447a
20–437
AC068006
84%
AJ278263
ORP-5
N/A
90%
AK007088
ORP-4
OSBPL6
437–784
NDa
796a
AC073817
97%
BB630936 BB846848 BI557181 BI102192 BB600540 BI103787 BI715995 AI585406 AA542355 BB465743 BG083851 BB648633 BB707871
ORP-6
THE MOUSE ORP GENE FAMILY
OSBPL7
381–785
Yes (48–142)
979a
AC032012 AL606664
94%
AK017095 BE284902 BE307293 BG085801 BG961937 BB649123
ORP-7
OSBPL9
324–723
NDa
OSBPL8
Yes (3–99)
723 (82)
N/A
97%
BB871960 B1684323 BI688590 AA122990 BI156676 BF134946 BG922701 BC002157
ORP-9
Yes (8–30)
142a
N/A
96%
AI019359
ORP-8
GenBank accession numbers correspond to mouse nonredundant and EST sequences that align to assemble the various mouse ORP genes. a Incomplete sequences; AA 5 amino acid; N/A 5 not available; ND 5 not detectable due to incomplete sequence.
Other designations
Yes (1–90)
PH domain (AA number)
Estimated peptide length and size (kDa)
AA137795 AA445771 BE656056 BI852609 Z31096 BB861111 BG246212
cDNA/ESTs
OSBP
TABLE 2.
OSBPL10
277–699
Yes (1–77)
670a
AL627406 AC102912.1
91%
AK017034
ORP-10
OSBPL11
NDa
NDa
298a
N/A
88%
AL118449 BB610367
ORP-11
FIG. 1.
575
A MOUSE OXYSTEROL-BINDING PROTEIN FAMILY
binding domain and display a very high degree of amino acid identity aligned with human ORPs. Using RT-PCR analysis, each of the genes was found to exhibit unique tissue distribution with many showing high expression in testicular, brain, and heart tissues. Expression of the various ORP genes was also investigated in a highly purified population of hemopoietic cells that contain HSC defined by the lin2 c-kit1 Sca-11 (LKS1 ) immunophenotype, and a more mature population defined by lin2 c-kit1 Sca-12 (LKS2 ) immunophenotype.
MATERIALS AND METHODS Bioinformatics Previously identified nucleotide sequences of the human ORP family (Laitinen et al., 1999; Jaworski et al., 2001; Lehto et al., 2001) were used to search the National Center for Biotechnology Information (NCBI) Genbank database for their respective mouse ORP homologs. BLASTn and BLASTp searches of the nonredundant nucleotide and protein databases as well as the mouse EST database were performed. Overlapping ESTs were assembled into contiguous (contigs) sequences using the Vector NTI program (Version 6, Informax, Inc., North Bethesda, MD). Where possible, multiple ESTs covering the same region were compared for errors in the sequence. Genomic nucleotide sequences were also derived from the NCBI mouse genome sequencing database.
ORP phylogenetic tree The ORP phylogenetic tree calculation is based on a sequence distance method and utilized the Neighbour-Joining (NJ) algorithm as described by Saitou and Nei (1987).
Cloning of mouse ORP-1a FIG. 1 (continued). Amino acid sequences of human ORPs compared with mouse ORP homologs. Conceptual translation of mouse ORP protein sequences based on contig assemblies of mouse ESTs and nonredundant sequences. Each mouse amino acid sequence was aligned against its human homolog. Boxed regions indicate amino acid identity. Only partial sequences were available for some mouse ORPs (blank spaces). Sequences that were available required insertion of gaps for alignment purposes (dashes). Numbers on the left- and right-hand side of each sequence represent amino acid position number for each protein. (Moreira et al., 2001). Recently, ORP-3 has also been shown to be highly expressed in CD341 -enriched populations of hemopoietic stem cells (HSC) and absent or weakly expressed in more mature CD342 hemopoietic cells (Gregorio-King et al., 2001), suggesting a role for ORP-3 and oxysterols in HSC differentiation. Given the importance of OSBP in cholesterol metabolism and recent insights into other possible biologic functions of ORP-3 and ORP-4, further investigation of the ORP gene family is of interest. As the mouse species is frequently the preferred animal model for in vivo studies, we set out to identify the mouse ORP homologs. Here we describe the identification of a family of 12 mouse ORP genes that contain an oxysterol
A contig sequence of mouse ESTs was assembled for mouse ORP-1a as described above, followed by alignment with human ORP-1a. Gene-specific primers were designed to the 59 and 39 ends of the contig sequence (Table 1), and the complete coding region was then amplified by PCR from a mouse spleen cDNA library (a gift from Prof. Mauro Sandrin). The product was verified by restriction enzyme digest with HpaII (Bresatec) and by sequencing in both directions using PCR and a terminator sequencing kit (ABI BigDye) on an ABI 377 automatic sequencer (PE Biosystems, Melbourne, Australia). Finally, the sequence was submitted to the Genbank database (Accession number AF394063).
Enrichment of hemopoietic precursors cells Female C57Bl/6J mice were purchased from Animal Resources Center (Perth, WA, Australia) and maintained in a conventional clean animal house. All mice were fed acidified drinking water and autoclaved chow ad libitum. Mice were used at 8 to 12 weeks of age. Bone marrow lineage negative, c-kit1 Sca-11 cells (LKS1 ) and lineage negative, c-kit1 Sca-12 cells (LKS2) were enriched as previously described (Purton et al., 1999) with a minor modification as follows. Following staining with lineage antibodies, the bone marrow cells were incubated on ice for 15 min with 15 ml
576
ANNISS ET AL. performed on a FACStarPlus (Becton Dickinson, San Jose, CA) directly into tubes. Cells were sequentially sorted into PI2 , c-kit1 , Sca-11 (LKS1) or PI2 , c-kit1, Sca-12 (LKS2 ) populations.
Isolation of RNA RNA was extracted from sorted cell bone marrow LKS1 and LKS2 populations using RNAzol B (Tel-Test Inc., Friendswood, TX), according to the manufacturer’s instructions. Briefly, RNA was extracted on ice with 800 ml RNAzol B and 80 ml chloroform. After centrifugation, RNA was precipitated with an equal volume of isopropanol for a minimum of 16 h at 220°C. RNA pellets were washed with 75% ethanol, briefly air dried, and resuspended in 25 ml MilliQ H2O. Total RNA from a variety of other mouse tissues (brain, heart, liver, lung, spleen, testis, 7-day embryo, spinal cord, lymph node, bone marrow, thymus, and kidney) were obtained commercially (Clontech BD Biosciences, Palo Alto, CA).
FIG. 2. Phylogenetic tree depicting evolutionary relationships between the ORPs.
goat antirat IgG microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and 85 ml phosphate-buffered serum (PBS) containing 5 mM EDTA and 1% BSA per 107 cells and agitated regularly. The lineage-positive cells were then depleted using a D column magnetic cell sorter (MACS, Miltenyi Biotech, Bergisch Giadbach, Germany), according to the manufacturer’s instructions. The nonmagnetic fraction (lineage-negative cells) were then stained with phycoerythrin-conjugated anti-Sca-1 and fluorescein isothyiocyanate-conjugated anti-CD117 (c-kit; Pharmingen, San Diego, CA) for 30 min on ice, washed with phosphate-buffered saline (PBS) 1 2% foetal bovine serum and suspended in 1 mg/ml propidium iodide (PI). Fluorescence-activated cell sorting was
FIG. 3. Tissue-expression of mouse ORP genes. Total RNA from 12 different mouse tissues was reverse-transcribed into first-strand cDNA. cDNA fragments for each mouse ORP were amplified (30 cycles) by PCR with specific primers for each gene and with GAPDH as a positive control.
577
A MOUSE OXYSTEROL-BINDING PROTEIN FAMILY TABLE 3.
OSBP ORP-1 ORP-2 ORP-3 ORP-4 ORP-5 ORP-6 ORP-7 ORP-8 ORP-9 ORP-10 ORP-11
SEMIQUANTIT ATIVE D ETERMINATION OF THE LEVELS OF ORP GENE EXPRESSION IN VARIOUS M OUSE TISSUES AS DETERMINED BY RT-PCR
Brain
Heart
Liver
Lung
Spleen
Testis
7-Day embryo
Spinal cord
Lymph node
Bone marrow
Thymus
Kidney
11 111 1 111 111 11 111 111 111 111 11 1
111 111 11 111 11 1 11 1/2 111 111 1/2 1
11 111 ND 1 ND 1 ND 1/2 1 111 ND ND
11 1 1/2 11 ND 111 111 1/2 1 11 1/2 1/2
1 1 ND 11 ND 1 ND 1 11 111 ND ND
111 111 111 1 1111 11 1 1 111 1111 111 111
11 1 1 11 1 111 1 1 1 111 1 111
11 111 1 1 11 11 111 11 1 1 1 1/2
1 1 1 1 ND 111 111 1 1 1 1 1/2
1 1 1 1 ND 1 1 1/2 11 11 ND ND
11 1 1/2 11 ND 1 1 11 1 1/2 1 1
11 11 1 1 1 11 111 1 1 1 1/2 1
ND 5 not detectable, 1/2 faint signal, 1 weakly expressed, 11 moderately expressed, 111 highly expressed, 1111 very highly expressed.
First-strand cDNA synthesis First-strand cDNA was synthesized by first incubating 2 mg RNA with 0.5 ml Random primers (500 ng/ml), 1 ml 10 mM dNTP Mix (10 mM each dATP, dGTP, dCTP, and dTTP) and 6.5 ml MilliQ H 2O at 65°C for 5 min. Subsequently, a reaction mix of 4 ml First-Strand Buffer (250 mM Tris-HCl, 375 mM KCl, 15 mM MgCl2), 2 ml DTT (0.1 M), 1 ml RNAsin (40 U/ml) and 0.4 ml Superscript IIaa H-Reverse Transcriptase (200 U/ml; Life Technologies, Grand Island, NY) was added, and the reaction incubated at room temperature for 10 min, followed by incubation for 1 h at 42°C. The reaction was terminated by incubation at 70°C for 15 min.
Tissue and cell expression Gene-specific primers (Table 1) based on contigs assembled by bioinformatics were designed for each mouse ORP. These primers were then used to amplify first-strand cDNA by PCR. First-strand cDNA (1 ml) was amplified in a standard PCR reaction mix containing 200 mM dNTP, 2.0 mM MgCl2, 100 ng forward and reverse amplification primers, and 1.0 U Taq DNA polymerase (Geneworks, Adelaide, South Australia) with Reaction Buffer provided (final: 50 mM Tris-HCl [pH 9.0 at 25°C], 15 mM [NH4]2SO4, 0.1% Triton X-100) in a 50-ml reaction. PCR was initiated with denaturation at 94°C for 45 sec, annealing at a temperature optimized for each gene-specific primer set (Table 1), and extension at 72°C for 2 min for a total of 30 cycles followed by a final extension at 72°C for 7 min. Simultaneous amplification of mouse b2-microglobulin (b2m) or mouse glyceraldehyde3-phosphate dehydrogenase (GAPDH) cDNA fragments was used as an internal positive control to monitor consistency in the amount of first-strand cDNA template between cells or tissues. PCR products were electrophoresed on 2% agarose gels, stained with ethidium bromide, and analyzed using a bioimaging and analysis system (UVP Bioimaging digital camera system with UVP Labworks software, Upland, CA).
RESULTS Mouse ORP cDNA sequences Using BLASTn and BLASTp searches of the NCBI Genbank database, we identified overlapping mouse ESTs and nonredundant cDNA sequences showing homology to the human family of ORP genes. Genbank accession numbers corresponding to sequences used to assemble either complete or partial mouse ORP gene contigs are listed in Table 2. Only two of these Genbank sequences described any homology to OSBP. We identified 12 mouse ORP genes, each containing the conserved sequence motif “EQVSHHPP” (Fig. 1). We adopted the nomenclature used by Lehto et al. (2001) to name the mouse ORP genes so as to maintain consistency with the designations used for the human ORP genes. Of the 12 mouse ORP genes identified, five full-length contigs were assembled containing complete coding regions corresponding to human ORP-1a, ORP-2, ORP-3, ORP-5, and ORP-9 (Fig. 1). We have cloned the complete coding region of mouse ORP-1a and verified the sequence by forward and reverse sequencing. A very high degree of evolutionary conservation was observed between mouse and human ORPs as indicated by the boxed regions in Figure 1, which indicate conserved amino acid identity. The level of amino acid identity for each ORP gene is detailed in Table 2, and ranges from 88–97%. The oxysterol binding region and PH domain for each ORP was also determined using motif searches with Pfam (www.motif.genome.ad.jp) (Table 2). In humans, all but ORP-1a and ORP-2 contain a PH domain. Similarly, all but ORP-1a and ORP-2 contain a PH domain in the equivalent mouse homologues (Table 2). The partially complete NCBI mouse genomic resources database was also searched for genomic sequences of each member of the mouse ORP family. Accession numbers corresponding to genomic sequences identified in the database that were available are also listed in Table 2. Mouse OSBP and ORP-7 genes have previously been mapped to chromosome 19 and 11, respectively (Levanon et al., 1990; NCBI database).
578
ANNISS ET AL.
a
b
FIG. 4. (a) FACS sorting of LKS1/2 hemopoietic precursor cells. Dot-plot showing FACS sorting of mouse lineage negative, c-kit-positive hemopoietic precursor cells sorted by the presence or absence of Sca-1 expression (LKS1 and LKS2 , respectively). R1 region contains LKS1 cells; R2 region contains LKS2 cells. (b) Expression of mouse ORP genes in hemopoietic precursor cells. Expression of the mouse ORP genes was compared in mouse LKS1 and LKS2 cells together with mouse 12.5-day embryo tissue. Mouse b2-microglobulin was used as a positive control. *Repeated experiments using LKS1/2 hemopoietic precursor cells obtained from another sorting run and increased loading of sample.
579
A MOUSE OXYSTEROL-BINDING PROTEIN FAMILY
Structural relationships between mouse and human ORPs The evolutionary relationships between the ORPs are illustrated by the phylogenetic tree (Fig. 2). This analysis indicates that the proteins can be divided into three main evolutionary branches (a, b, and c), similar to that reported earlier (Jaworski et al., 2001; Lehto et al., 2001). Branch (a) contains subfamily I containing branch (d) (ORP-1a, ORP-2) and branch (e) (ORP3, ORP-6, ORP-7). The second branch (b) contains subfamily II (ORP-4, OSBP, yeast, and Drosophila sequences). The third branch (c) contains subfamily III (ORP-5, ORP-8, ORP-9, ORP-10, ORP-11, Caenorhabditis elegans and yeast sequences). In all cases, human and mouse ORPs share a common ancestor.
Tissue-specific expression Tissue expression patterns between the various mouse ORP genes were also compared semiquantitatively using GAPDH as a control (Fig. 3). OSBP, ORP-1, ORP-3, ORP-5, ORP-8, and ORP-9 were detected ubiquitously, with varying degrees of expression, in each of the tissues described (Table 3). ORP-4 and ORP-10 displayed the most selective tissue distribution. ORP4 did not have any detectable levels of expression in the lymph node, bone marrow (which mainly consists of maturing, lineage positive cells), thymus, spleen, liver, or lung, but exhibited very high levels of expression in the testis and high levels in the brain, heart, and spinal cord. ORP-10 had moderate levels of expression in all tissues but no detectable expression in bone marrow, the liver, and spleen. Overall, the ORP family appeared to be most highly expressed in testicular tissue followed by the brain and heart tissues (Table 3).
Expression in hemopoietic precursors cells Highly purified populations of mouse lin2 , c-kit1 hemopoietic precursor cells were FACS sorted by the presence or absence of Sca-1 expression, as shown in Figure 4a. LKS1 and LKS2 populations were found to have a purity of 82 and 88%, respectively. Expression patterns of the mouse ORP genes were compared in LKS1 and LKS2 cells together with fetal liver (data not shown) and 12.5-day embryo tissue (Fig. 4b). Simultaneous amplification of b2 m was used as an internal positive control. All ORP genes were detected in fetal liver and 12.5-day embryo tissues. OSBP, ORP-1, ORP-2, ORP-3, ORP5, ORP-7, ORP-8, ORP-9, and ORP-11 were detected in both LKS1 and LKS2 hemopoietic cell populations. ORP-6 was not present in either the LKS1 or LKS2 population. Our initial findings indicated that ORP-4 was expressed by the primitive subset of cells defined by the LKS1 immunophenotype, and was not expressed by the more mature LKS2 subset. Conversely, ORP-10 was expressed by the LKS2 subset of cells but not by LKS1 cells. We repeated our experiments to confirm these findings using mouse LKS1 and LKS2 hemopoietic precursor cells obtained from another sorting run, and increased the loading of our cDNA sample. Although a small amount of expression of ORP-4 in LKS2 cells and ORP-10 in LKS1 cells was observed in our later experiment, the overall trend of expression was maintained.
DISCUSSION Although OSBP is known to play an important role in sterol homeostasis, little is known of the function of the recently identified family of human ORPs. We report the identification and tissue expression of a family of ORP homologs in the mouse, a suitable model for in vivo investigations into ORP functions and interactions. The human OSBP gene has been reported to be 98% identical to the rabbit OSBP (Levanon et al., 1990). This extremely high degree of homology is consistent with our findings between human and mouse ORP homologs where amino acid sequence identity ranged from 84–97%. All the major structural features including the OSBP sequence motif, sterol binding region, and pleckstrin homology domain previously identified in human ORPs are conserved in the mouse homologs. Although OSBP has been well documented to play a role in cholesterol metabolism, a 52% sequence similarity between the human OSBP gene and that of Drosophila melanogaster may indicate that OSBP is involved in roles additional to those concerning cholesterol metabolism, as insects are unable to biosynthesize sterols (Alphey et al., 1998). Recent findings involving ORP-3 and ORP-4 suggest that members of the OSBP-related family are involved in a range of functions that also vary from cholesterol synthesis and homeostasis (Fournier et al., 1999; Gregorio-King et al., 2001; Moreira et al., 2001). However, although there appears to be considerable functional diversity, with the existence of such a large family of genes it is likely that there may be redundancy in function between various members. Characterization of the ORP family of proteins in vivo will help to elucidate this. Our finding that many of the mouse ORP genes were highly expressed in testicular tissue is consistent with the role of testicular macrophages, which have been shown to produce and secrete oxysterols that are, in turn, converted to testosterone (Nes et al., 2000; Lukyanenko et al., 2001). Many ORP genes were also found to be highly expressed in the brain, which contains a large distribution of cholesterol, and is also characterized by active membrane transport processes (Dietschy and Turley, 2001). These expression patterns are similar to the tissue expression patterns of human ORPs studied using similar techniques (Jaworski et al., 2001; Moreira et al., 2001). Our finding that all the various ORP genes were expressed in embryonic tissue at both day 7 and day 12.5 is also of interest, suggesting that ORP may play a role in embryonic development. In addition, the increased expression of ORP-4 in primitive hemopoietic LKS1 precursor cells compared to the more mature LKS2 subset could suggest a role of ORP-4 in HSC differentiation. In conclusion, as an extension to the identification of the human OSBP-related protein family we have identified a family of ORP homologs in the mouse. We have identified and described 12 mouse ORP homologs in this family and shown tissue and cell-specific expression of each gene. As there is an extremely high degree of homology between human and mouse ORP genes, much knowledge may be gained about the function of this large family of proteins through the use of mouse models.
580
ANNISS ET AL.
ACKNOWLEDGMENTS Part of this work was funded by a grant in aid awarded by the Anti-Cancer Council of Victoria to L.E.P. L.E.P. is a Special Fellow of The Leukemia and Lymphoma Society.
REFERENCES ALPHEY, L., JIMENEZ, J., and GLOVER, D. (1998). A Drosophila homologue of oxysterol binding protein (OSBP)—Implications for the role of OSBP. Biochim. Biophys. Acta 1395, 159–164. DIETSCHY, J.M., and TURLEY, S.D. (2001). Cholesterol metabolism in the brain. Curr. Opin. Lipidol. 12, 105–112. FOURNIER, M.V., GUIMARAES, F.C., PASCHOAL, M.E.M., RONCO, L.V., DA GLORIA COSTA CARVALHO, M., and PARDEE, A.B. (1999). Identification of a gene encoding a human oxysterol-binding protein-homologue: A potential general molecular marker for blood dissemination of solid tumors. Cancer Res. 59, 3748–3753. GREGORIO-KING, C.C., COLLIER, G.R., MCMILLAN, J.S., WAUGH, C.M., MCLEOD, J.L., COLLIER, F.M., and KIRKLAND, M.A. (2001). ORP-3, a human oxysterol-binding protein gene differentially expressed in hematopoietic cells. Blood 98, 2279–2281. JAWORSKI, C.J., MOREIRA, E., LI, A., LEE, R., and RODRIGUEZ, I.R. (2001). A family of 12 human genes containing oxysterol-binding domains. Genomics 78, 185–196. LAGACE, T.A., BYERS, D.M., COOK, H.W., and RIDGWAY, N.D. (1997). Altered regulation of cholesterol and cholesteryl ester synthesis in Chinese-hamster ovary overexpressing the oxysterol-binding protein is dependent on the pleckstrin homology domain. Biochem. J. 326, 205–213. LAITINEN, S., OLKKONEN, V.M., EHNHOLM, C., and IKONEN, E. (1999). Family of human oxysterol binding protein (OSBP) homologues: A novel member implicated in brain sterol metabolism. J. Lipid Res. 40, 2204–2211. LEHTO, M., LAITINEN, S., CHINETTI, G., JOHANSSON, M., EHNHOLM, C., STAELS, B., IKONEN, E., and OLKKONEN, V.M. (2001). The OSBP-related protein family in humans. J. Lipid Res. 42, 1203–1213. LEVANON, D., HSIEH, C.-L., FRANCKE, U., DAWSON, P.A., RIDGWAY, N.D., BROWN, M.S., and GOLDSTEIN, J.L. (1990). cDNA cloning of human oxysterol-binding protein and localization
of the gene to human chromosome 11 and mouse chromosome 19. Genomics 7, 65–74. LEVINE, T.P., and MUNRO, S. (1998). The pleckstrin homology domain of oxysterol-binding protein recognises a determinant specific to Golgi membranes. Curr. Biol. 8, 729–739. LUKYANENKO, Y.O., CHEN, J.J., and HUTSON, J.C. (2001). Production of 25-hydroxycholesterol by testicular macrophages and its effects on Leydig cells. Biol. Reprod. 64, 790–796. MOREIRA, E.F., JAWORSKI, C., LI, A., and RODRIGUEZ, I.R. (2001). Molecular and biochemical characterization of a novel oxysterol-binding protein (OSBP2) highly expressed in retina. J. Biol. Chem. 276, 18570–18578. NES, W.D., LUKYANENKO, Y.O., JIA, Z.H., QUIDEAU, S., HOWALD, W.N., PRATUM, T.K., WEST, R.R., and HUTSON, J.C. (2000). Identification of the lipophilic factor produced by macrophages that stimulate steroidogenesis. Endocrinology 141, 953–958. PURTON, L.E., BERNSTEIN, I.D., and COLLINS, S.J. (1999). Alltrans retinoic acid delays the differentiation of primitive hematopoietic precursors (lin2 c-kit 1 Sca-11 ) while enhancing the terminal maturation of committed granulocyte/monocyte progenitors. Blood 94, 483–495. RIDGWAY, N.D., DAWSON, P.A., HO, Y.K., BROWN, M.S., and GOLDSTEIN, J.L. (1992). Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding. J. Cell Biol. 116, 307–319. SAITOU, N., and NEI, M. (1987). The neighbour-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. SCHROEPFER, G.J. (2000). Oxysterols: Modulators of cholesterol metabolism and other processes. Physiol. Rev. 80, 361–554. TAYLOR, F.R., and KANDUTSCH, A.A. (1985). Oxysterol binding protein. Chem. Phys. Lipids 38, 187–194.
Address reprint requests to: Angela Anniss, Ph.D. Research Unit Australian Red Cross Blood Service Victoria P.O. Box 354 South Melbourne, Victoria, Australia, 3205 E-mail:
[email protected] Received for publication March 29, 2002; received in revised form April 12, 2002; accepted May 13, 2002.
This article has been cited by: 1. Marion Weber-Boyvat, Henriikka Kentala, Johan Peränen, Vesa M. Olkkonen. 2015. Ligand-dependent localization and function of ORP–VAP complexes at membrane contact sites. Cellular and Molecular Life Sciences 72, 1967-1987. [CrossRef] 2. Marion Weber-Boyvat, Henriikka Kentala, Johanna Lilja, Terhi Vihervaara, Raisa Hanninen, You Zhou, Johan Peränen, Tuula A. Nyman, Johanna Ivaska, Vesa M. Olkkonen. 2015. OSBP-related protein 3 (ORP3) coupling with VAMP-associated protein A regulates R-Ras activity. Experimental Cell Research 331, 278-291. [CrossRef] 3. Henriikka Kentala, Simon G. Pfisterer, Vesa M. Olkkonen, Marion Weber-Boyvat. 2015. Sterol liganding of OSBP-related proteins (ORPs) regulates the subcellular distribution of ORP–VAPA complexes and their impacts on organelle structure. Steroids . [CrossRef] 4. You Zhou, Gerd Wohlfahrt, Jere Paavola, Vesa M. Olkkonen. 2014. A vertebrate model for the study of lipid binding/transfer protein function: Conservation of OSBP-related proteins between zebrafish and human. Biochemical and Biophysical Research Communications 446, 675-680. [CrossRef] 5. Vesa M. Olkkonen, Shiqian Li. 2013. Oxysterol-binding proteins: Sterol and phosphoinositide sensors coordinating transport, signaling and metabolism. Progress in Lipid Research 52, 529-538. [CrossRef] 6. Vesa M. Olkkonen. 2012. Macrophage oxysterols and their binding proteins. Current Opinion in Lipidology 23, 462-470. [CrossRef] 7. Olivier Béaslas, Terhi Vihervaara, Jiwei Li, Pirkka-Pekka Laurila, Daoguang Yan, Vesa M. Olkkonen. 2012. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity. Experimental Cell Research 318, 1933-1945. [CrossRef] 8. Vesa M. Olkkonen, You Zhou, Daoguang Yan, Terhi Vihervaara. 2012. Oxysterol-binding proteins-emerging roles in cell regulation. European Journal of Lipid Science and Technology n/a-n/a. [CrossRef] 9. Terhi Vihervaara, Maurice Jansen, Riikka-Liisa Uronen, Yuki Ohsaki, Elina Ikonen, Vesa M. Olkkonen. 2011. Cytoplasmic oxysterol-binding proteins: sterol sensors or transporters?. Chemistry and Physics of Lipids . [CrossRef] 10. Terhi Vihervaara, Riikka-Liisa Uronen, Gerd Wohlfahrt, Ingemar Björkhem, Elina Ikonen, Vesa M. Olkkonen. 2011. Sterol binding by OSBP-related protein 1L regulates late endosome motility and function. Cellular and Molecular Life Sciences 68, 537-551. [CrossRef] 11. Sumana Raychaudhuri, William A. Prinz. 2010. The Diverse Functions of Oxysterol-Binding Proteins. Annual Review of Cell and Developmental Biology 26, 157-177. [CrossRef] 12. You Zhou, Shiqian Li, Mikko I. Mäyränpää, Wenbin Zhong, Nils Bäck, Daoguang Yan, Vesa M. Olkkonen. 2010. OSBP-related protein 11 (ORP11) dimerizes with ORP9 and localizes at the Golgi–late endosome interface. Experimental Cell Research 316, 3304-3316. [CrossRef] 13. Mike H. Ngo, Terry R. Colbourne, Neale D. Ridgway. 2010. Functional implications of sterol transport by the oxysterol-binding protein gene family. Biochemical Journal 429, 13-24. [CrossRef] 14. Ramu S. Saravanan, Erin Slabaugh, Vijay R. Singh, Lisa J. Lapidus, Thomas Haas, Federica Brandizzi. 2009. The targeting of the oxysterol-binding protein ORP3a to the endoplasmic reticulum relies on the plant VAP33 homolog PVA12. The Plant Journal 58:10.1111/tpj.2009.58.issue-5, 817-830. [CrossRef] 15. Daoguang Yan, Vesa M. OlkkonenCharacteristics of Oxysterol Binding Proteins 253-285. [CrossRef] 16. Daoguang Yan, Vesa M Olkkonen. 2007. OSBP-related proteins: lipid sensors or transporters?. Future Lipidology 2, 85-94. [CrossRef] 17. Andrea L. Skirpan, Peter E. Dowd, Paja Sijacic, Cynthia J. Jaworski, Simon Gilroy, Teh-hui Kao. 2006. Identification and characterization of PiORP1, a Petunia oxysterol-binding-protein related protein involved in receptor-kinase mediated signaling in pollen, and analysis of the ORP gene family in Arabidopsis. Plant Molecular Biology 61, 553-565. [CrossRef] 18. L. E. Purton. 2006. RAR is critical for maintaining a balance between hematopoietic stem cell self-renewal and differentiation. Journal of Experimental Medicine 203, 1283-1293. [CrossRef] 19. K. Okamura, T. Ito. 2006. Lessons from comparative analysis of species-specific imprinted genes. Cytogenetic and Genome Research 113, 159-164. [CrossRef]
20. Markku Lehto, Riikka Hynynen, Katja Karjalainen, Esa Kuismanen, Kati Hyvärinen, Vesa M. Olkkonen. 2005. Targeting of OSBP-related protein 3 (ORP3) to endoplasmic reticulum and plasma membrane is controlled by multiple determinants. Experimental Cell Research 310, 445-462. [CrossRef] 21. Vesa M Olkkonen. 2004. Oxysterol binding protein and its homologues: new regulatory factors involved in lipid metabolism. Current Opinion in Lipidology 15, 321-327. [CrossRef] 22. Vesa M Olkkonen, Timothy P Levine. 2004. Oxysterol binding proteins: in more than one place at one time?. Biochemistry and Cell Biology 82, 87-98. [CrossRef] 23. Anna O. Avrova, Nawsheen Taleb, Veli-Matti Rokka, Jacqueline Heilbronn, Edward Campbell, Ingo Hein, Eleanor M. Gilroy, Linda Cardle, John E. Bradshaw, Helen E. Stewart, Yasmina Jaufeerally Fakim, Gary Loake, Paul R. J. Birch. 2004. Potato oxysterol binding protein and cathepsin B are rapidly up-regulated in independent defence pathways that distinguish R gene-mediated and field resistances to Phytophthora infestans. Molecular Plant Pathology 5:10.1111/mpp.2004.5.issue-1, 45-56. [CrossRef]
