and Suppressors of Cytokine Signaling Negatively Regulated in T ...

The Journal of Immunology

Cell Proliferation and STAT6 Pathways Are Negatively Regulated in T Cells by STAT1 and Suppressors of Cytokine Signaling Cheng-Rong Yu, Rashid M. Mahdi, Samuel Ebong, Barbara P. Vistica, Jun Chen, Yonghong Guo, Igal Gery, and Charles E. Egwuagu1 Suppressor of cytokine signaling (SOCS) proteins have emerged as important regulators of cytokine signals in lymphocytes. In this study, we have investigated regulation of SOCS expression and their role in Th cell growth and differentiation. We show that SOCS genes are constitutively expressed in naive Th cells, albeit at low levels, and are differentially induced by Ag and Thpolarizing cytokines. Whereas cytokines up-regulate expression of SOCS1, SOCS2, SOCS3, and cytokine-induced Src homology 2 protein, Ags induce down-regulation of SOCS3 within 48 h of Th cell activation and concomitantly up-regulate SOCS1, SOCS2, and cytokine-induced Src homology 2 protein expression. We further show that STAT1 signals play major roles in inducing SOCS expression in Th cells and that induction of SOCS expression by IL-4, IL-12, or IFN-␥ is compromised in STAT1-deficient primary Th cells. Surprisingly, IL-4 is a potent inducer of STAT1 activation in Th2 but not Th1 cells, and SOCS1 or SOCS3 expression is dramatically reduced in STAT1ⴚ/ⴚ Th2 cells. To our knowledge, this is the first report of IL-4-induced STAT1 activation in Th cells, and suggests that its induction of SOCS, may in part, regulate IL-4 functions in Th2 cells. In fact, overexpression of SOCS1 in Th2 cells represses STAT6 activation and profoundly inhibits IL-4-induced proliferation, while depletion of SOCS1 by an anti-sense SOCS1 cDNA construct enhances cell proliferation and induces constitutive activation of STAT6 in Th2 cells. These results are consistent with a model where IL-4 has dual effects on differentiating T cells: it simulates proliferation/differentiation through STAT6 and autoregulates its effects on Th2 growth and effector functions via STAT1-dependent up-regulation of SOCS proteins. The Journal of Immunology, 2004, 173: 737–746.

S

uppressorsof cytokine signaling (SOCS)2 are inhibitory proteins that regulate responses to cytokines (1–3). The family is comprised of eight known members characterized by the presence of a Src homology 2 (SH2) domain and a carboxyl-terminal conserved domain called the SOCS box (4). Their inhibitory effects derive from direct interaction of SOCS SH2 domains with cytokine receptors and/or JAK kinases, leading to their recruitment to the signaling complex and eventual suppression or attenuation of the cytokine signal (5–7). Significant interest in the SOCS family stems from the belief that SOCS proteins may serve to integrate multiple cytokine signals and mediate cross-communication between antagonistic cytokines elaborated by differentiating Th cells. Th-polarizing cytokines, IFN-␥, IL-4, and IL-12, have all been shown to induce SOCS expression in Th cells, and results of recent studies suggest that IFN-␥/STAT1, IL4/STAT6, and IL-12/STAT4 signaling pathways in differentiating Th cells may be under feedback regulation by SOCS (8 –10). The

Laboratory of Immunology, National Eye Institute, National Institutes of Health, Bethesda, MD 20892 Received for publication September 4, 2003. Accepted for publication April 22, 2004. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Address correspondence and reprint requests to Dr. Charles E. Egwuagu, Molecular Immunology Section, Laboratory of Immunology, National Institutes of Health, Building 10, Room 10N116, 10 Center Drive, Bethesda, MD 20892-1857. E-mail address: [email protected] 2 Abbreviations used in this paper: SOCS, suppressor of cytokine signaling; SH2, Src homology 2; CIS, cytokine-induced SH2 protein; HEL, hen egg lysozyme; Tg, transgenic; WT, wild type; CD62L, L-selectin; P-Tyr, phosphotyrosine; SIE, sis-inducible element; GAS, ␥ activation site; IP, immunoprecipitation; IRS-2, insulin receptor substrate-2; RT, reverse transcriptase.

Copyright © 2004 by The American Association of Immunologists, Inc.

SOCS1 promoter contains functional STAT1 and STAT3 sites, and SOCS1 induction or promoter activity is drastically reduced in STAT1 null cells and by mutation of STAT1 site, respectively (11–13). Although these studies have established the molecular basis for feedback regulation of IFN-␥ signaling in Th cells by SOCS1 (13), functional STAT6 binding sites have not been identified in promoters of SOCS genes, and this has led to significant interest in understanding mechanisms that underlie induction of SOCS1 by IL-4. In addition, much less is known about other members of the SOCS family and how these SOCS genes are regulated in Th cells. In this study, we have used a hen egg lysozyme (HEL) TCR transgenic (Tg) mouse model to study mechanisms that regulate expression of SOCS genes at very early stages of differentiation of naive Th cells to effector Th1 or Th2 cells. We show that naive Th cells constitutively express SOCS1, SOCS2, SOCS3, and CIS (cytokine-induced SH2 protein) genes, and that these genes are differentially regulated by cytokines and Ags. We further show that the STAT1 signaling pathway is commonly activated by each of the three Th-polarizing cytokines (IL-4, IL-12, and IFN-␥) in early differentiating Th cells, and that optimum induction of SOCS expression by these cytokines requires STAT1. In addition, IL-4 is found to be a potent inducer of SOCS1, SOCS3, and STAT1 activation in Th2 cells, and we provide evidence that IL-4-induced proliferation or STAT6 is under feedback regulation by SOCS proteins.

Materials and Methods Isolation, propagation, and characterization of naive and activated CD4⫹ Th cells CD4⫹ Th lymphocytes were isolated and purified from spleens and lymph nodes of HEL-specific TCR Tg mice designated “3A9” (a generous gift from Dr. Mark Davis, Stanford University, Stanford, CA), C57BL/6 (wildtype (WT)) or C57BL/6-STAT1⫺/⫺ mice as described (14 –16). Purified 0022-1767/04/$02.00

738

FEEDBACK REGULATION OF T CELL GROWTH AND DIFFERENTIATION

(⬎98%) CD4⫹ 3A9 Th cells were cultured at 2.5 ⫻ 105/ml in RPMI 1640 medium supplemented with 50 ␮M 2-ME, antibiotics, and 10% FBS (“complete medium”) with 10⫻ irradiated syngeneic splenocytes (as APC) in the presence of 1 ␮g/ml HEL (Sigma-Aldrich, St. Louis, MO). Purified Th cells from WT or STAT1⫺/⫺ C57BL/6 mice (14) (2.5 ⫻ 105/ml; kindly provided by Dr. D. E. Levy, New York University, New York, NY) were activated in plate-bound anti-CD3 Ab (10 ␮g/ml; BD Biosciences, San Jose, CA) and anti-CD28 Ab (5 ␮g/ml) in complete medium. Stimulation of the cells in the absence of exogenous polarizing cytokines and their Abs is referred to as Tho condition. For propagation under neutral condition (Thn), the Tho condition was supplemented with anti-IL-4 Ab (10 ␮g/ml), anti-IFN-␥ Ab (10 ␮g/ml), and 10 ␮g/ml anti-IL-12 Ab (BD Pharmingen, San Diego, CA). For propagation under Th1 condition, the Tho condition was supplemented with anti-IL-4 Ab (10 ␮g/ml) and IL-12 (10 ng/ml) (PeproTech, Rocky Hill, NJ), and for propagation under Th2 condition the Tho condition was supplemented with IL-4 (10 ng/ml), anti-IFN-␥ Ab (10 ␮g/ml), and anti-IL-12 Ab (10 ␮g/ml). FACS analysis using anti-CD4, L-selectin (CD62L), CD25 mAbs, and corresponding isotype control Abs (BD Pharmingen) was performed on the BD FACSCalibur (BD Biosciences) as previously described (16). For signal transduction studies, cells were washed twice in RPMI 1640 medium, and cultured for 2 h under starvation condition (0.5% BSA, RPMI 1640 medium) before stimulation.

Stimulation of D10.G4.1 Th2 and AE7 Th1 cell lines D10.G4.1 Th2 cell line (American Type Culture Collection (ATCC), Manassas, VA) was cultured in RPMI 1640 medium supplemented with 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, 0.05 mM 2-ME, 10 pg/ml IL-1␣ (R&D Systems, Minneapolis, MN), and 10% rat T-STIM factor with Con A (BD Biosciences) as recommended. Lymphocyte proliferation assay was performed as detailed elsewhere (15). The AE7 Th1 cell line (17) (kindly provided by J. Ragheb, National Institutes of Health (NIH), Bethesda, MD) was cultured by repeated stimulation with syngeneic irradiated splenocytes and Ag (100 ␮g/ml pigeon cytochrome c (Sigma-Aldrich) in ER10 medium supplemented with penicillin/streptomycin and L-glutamine, 10% FBS, 2 mM L-glutamine, 50 ␮M 2-ME, and mouse rIL-2 (10 U/ml).

Lymphocyte proliferation assay and cytokine measurements Lymphocyte proliferation assay was performed as detailed elsewhere (18). Briefly, cells (2.5 ⫻ 105 cells/ml) were propagated in complete medium for 24 or 48 h. The cultures were pulsed with [3H]thymidine (0.5 ␮Ci/10 ␮l per well) for 4 additional hours. The presented data are mean change in counts per minute ⫾ SEM of responses of five replicate cultures. Supernatants were collected from cultures after 48 or 96 h stimulation with HEL and syngeneic APC and analyzed for cytokine secretion by ELISA, using kits from Endogen (Woburn, MA).

Confocal microscopy D10.G4.1 Th2 cell line, as well as primary Th2 cells established from Ag-primed naive Th cells after two cycles of polarization, were serumstarved 2 h before treatment with cytokine. Duplicate cultures were treated with IL-4 (10 ng/ml) for 30 min and reactions were terminated by washing with PBS. Cells were fixed and processed as recommended for the Cytofix/ Cytoperm Plus kit (BD Pharmingen). The cells were stained with a 1/1000 dilution of anti-STAT-1 Ab (BD BioSciences, Signal Transduction Laboratories), followed by Alexa Fluor 488 goat anti-mouse IgG (Molecular Probes, Eugene, OR). Cell nuclei were stained with 4⬘,6⬘-diamidino-2phenol-indol dihydrochloride (Molecular Probes). Images were collected on a Leica SP2 laser scanning confocal microscope (Leica Microsystems, Exton, PA) using a Leica ⫻63 1.32NA UV-corrected planapo objective. Relative fluorescence intensity in cytoplasm or nuclei was determined and all fluorescent dyes were imaged using sequential scan mode to prevent bleed-through artifacts.

RT-PCR and quantitative real-time PCR analysis RNA was isolated, digested with RNase-free DNase (Promega, Madison, WI) and first strand cDNA synthesis was performed with RNA (5 ␮g), SuperScript II Reverse Transcriptase (RT) (Invitrogen Life Technologies, Gaithersburg, MD), and oligo(dT)12–16 as previously described (19). Samples were subjected to hot-start PCR using AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA) and primers used for amplification are: T-bet, 5⬘-TGCCTGCAGTGCTT CTAACA-3⬘ and 5⬘-TGCCCCGCTTCCTCTCCAACCAA-3⬘; GATA-3, 5⬘GAAGGCATCCAGACCCGAAAC-3⬘ and 5⬘-ACCCATGGCGGTGACC ATGC-3⬘; ␤-actin, 5⬘-GTGGGCCGCTCTAGGCACCAA-3⬘ and 5⬘-TCTT TGCCAATAGTGATGACTTGGC-3⬘; p21WAF1, 5⬘-ATGTCCAATCCTG

GTGATGT CCGAC-3⬘ and 5⬘-GAAATCTGTCAGGCTGGTCTGCCT-3⬘; and p27kip1, 5⬘-ATGTCAAACGTGCGGGTGTCTAACG-3⬘ and 5⬘-ACC GTCTGAGACATTTTC-3⬘. Amplification was conducted for 30–35 cycles of denaturation for 30 s at 95°C, annealing for 45 s at 60°C, and extension at 72°C for 45 s. After the last amplification cycle, the samples were subjected to a final 10-min extension at 72°C. A negative control reaction without RT was performed for each RNA sample. For quantitative RT-PCR analysis, RNA samples were normalized to 18S rRNA using TaqMan Ribosomal RNA Control Reagents kit (Applied Biosystems). Real-time 5⬘-nuclease fluorogenic RTPCR analysis was performed on an ABI 7700 (Applied Biosystems) or ICycler iQ Real-Time PCR Sequence Detection System (Bio-Rad, Hercules, CA) with the following primers: SOCS1, 5⬘-ACCTTCTTGGTGCGCGAC-3⬘ and 5⬘AAGCCATCTTCACGCTGAGC-3⬘; SOCS2, 5⬘-GGTTGCCGGAGGAACA GTC-3⬘ and 5⬘-GAGCCTCTTTTAATTTCTCTTTGGC-3⬘; SOCS3, 5⬘-CCT TCAGCTCCAAAAGCGAG-3⬘ and 5⬘-GCTCTCCTGCAGCTTGCG-3⬘; CIS, 5⬘-CCAGCCATGCAGCCCTTA-3⬘ and 5⬘-CGTCTTGGCTATGCAC AGCA-3⬘; and ␤-actin, 5⬘-CAAGTCATCACTATTGGCAACGA-3⬘ and 5⬘CCCAAGAAGGAAGGCTGGA-3⬘. The hybridization probes are: SOCS1, 6FAM-TCGCCAACGGAACTGCTTCTTCG-TAMRA; SOCS2, 6FAM-CG CGTCTGGCGAAAGCCCTG-TAMRA; SOCS3, 6FAM-CCAGCTGGTG GTGAACGCCGT-TAMRA; CIS, 6FAM-CCCAGAGGAAGTGACAGAG GAGACCCC-TAMRA; and ␤-actin, 6FAM-CGGTTCCGATGCCCTGAGG CTC-TAMRA. PCR parameters are as recommended for the TaqMan Universal PCR master mix kit (Applied Biosystems). SOCS copies per cell were calculated by extrapolation from standard curves generated using SOCS plasmid cDNAs as previously described (16). Standard curves generated for each SOCS cDNA showed excellent linearity and indicated precise quantitative relationship between cDNA copy number and fluorescence signal intensity within the dynamic range of the assay (data not shown).

Western blot analyses Preparation of whole cell lysates and immunodetection were as described (19). Briefly, samples (40 ␮g/lane) were fractionated on 4 –20% gradient SDS/PAGE, and blots were probed with STAT1, pSTAT6-specific Abs (Cell Signaling Tech. Beverly, MA), anti-phosphotyrosine (P-Tyr) IgG clone 4G10 (Upstate Biotechnology, Lake Placid, NY), STAT1, pSTAT1, SOCS1, p27kip1, or ␤-actin Abs (Santa Cruz Biotechnology, Santa Cruz, CA). Preimmune serum was used in parallel as controls and signals were detected with HRP conjugated-secondary F(ab⬘)2 Ab (Zymed Laboratories, San Francisco, CA) using the ECL system (Amersham Biosciences, Arlington Heights, IL).

EMSA Nuclear extracts were prepared using buffer containing the following protease inhibitors: 2 ␮M leupeptin, 2 ␮M pepstatin, 0.1 ␮M aprotinin, 1 mM [4-(2-Aminoethyl)benzenesulfonyl fluoride, hydrochloride], 0.5 mM phenylmethyl-sulfonyl fluoride, and 1 ␮M E-64 [N-(N-L-trans-carboxyoxiran2-carbonyl)-L-leucyl]agmatine as described (20). Protein levels were determined by the BCA method as recommended, and extracts were stored at ⫺70°C until use. Nuclear extract (5 ␮g) in binding buffer (20 mM HEPES, pH 7.9, 50 mM KCl, 10% glycerol, 0.5 mM DTT, 0.1 mM EDTA) containing 0.14 ␮g/␮l poly(dI:dC) was incubated on ice for 20 min. Labeled dsDNA probe was then added and incubated for an additional 15 min at room temperature. The probes used are: the c-fos promoter sis-inducible element (SIE) m67 SIE, 5⬘AGCTTGTCGACATTTCCCGTAAATCG TCGG-3 (21); ␥ activation site (GAS) motif from the Fc␥RI promoter, 5⬘-AGCTTGTATTTCCCAGAAAAGGGATC-3⬘ (22, 23); GAS motif from the human C⑀ regulatory region, 5⬘-AGTCAAGACCTTTTCCC AAGAAATCTATC-3⬘ (24, 25). The double-stranded oligonucleotides were labeled by fill-in reaction using Klenow polymerase (Invitrogen Life Technologies) with either [␣-32P]dATP or [␣-32P]dGTP (3000 Ci/mmol; Amersham Biosciences). Samples were electrophoresed in 5% polyacrylamide gel in ⫻0.25 Tris-borate-EDTA buffer. For supershift assays, the indicated Ab was added to the binding buffer containing nuclear extract mixture and preincubated on ice for 10 min. 32P-labeled probe was then added and the entire mixture was incubated for an additional 20 min on ice before electrophoresis. Gel shift grade anti-mouse STAT1, STAT3, STAT4, STAT5a, STAT5b, or STAT6 polyclonal Abs (Santa Cruz Biotechnology) were used.

Generation of Th2 cells overexpressing sense or anti-sense SOCS1 cDNA Sense and anti-sense mouse SOCS1 cDNA fragments flanked by BamH1 and EcoRI restriction sites were generated by PCR amplification from pEFflag-1/SOCS1 plasmid kindly provided by Drs. D. Hilton (Walter and Eliza

The Journal of Immunology Hall Institute, Melbourne, Australia) and H. Young (NIH). Primer set 1 (5⬘-CCCGGATCCATGG TAGCACGCAACCAGGTGGCA-3⬘ and 5⬘CCCGAATTCTCAGATCAGGAAGGGGAAGG AACTCA-3⬘) was used to generate the SOCS1 (sense) fragment, and primer set 2 (5⬘-CCCGA ATTCATGGTAGCACGCAACCAGGTGGCA-3⬘ and 5⬘-CCCGGATCC TCAGATCAGGAAGG GGAAGGAACTCA-3⬘) was used to generate the anti-sense SOCS1 fragment. The fragments were directionally cloned into the BamH1 and EcoRI sites of pBabe-Puro vector kindly provided by K. W. C. Peden (Laboratory of Retrovirus Research, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD) and the sequence was verified by dsDNA sequencing (ABI 310 Genetic Analyzer; Applied Biosystems). For transfection, plasmid cDNAs were prepared by two cycles of CsCl banding. Fifty micrograms of pBabe (empty vector control), pBabe/SOCS1, or pBabe/anti-sense SOCS1 plasmid DNA in culture medium (400 ␮l) containing 2 ⫻ 107/ml D10.G4.1 Th2 cells (ATCC) were electroporated at 120 V, 0.2 cm gap for 20 ms using a square wave electroporator (BTX 600; Genotronics, San Diego,

739 Ca). Stable transfectants were established by selection in 2 ␮g/ml puromycin (Sigma-Aldrich).

Results SOCS genes are differentially regulated by TCR ligation and costimulatory signals in Th cells Naive Th cells isolated from the spleen and lymph nodes of HELspecific TCR Tg mice were used to examine whether transcription of SOCS genes is induced following Th cell activation or in response to stimulation by Th1/Th2-polarizing cytokines. More than 98% of the freshly isolated naive Th cells express cell surface CD4, high levels of CD62L (⬎95%), and low levels of CD25 (⬍6%), features associated with the naive cell phenotype (Fig. 1A). Following antigenic stimulation of the naive Th cells under

FIGURE 1. SOCS genes are differentially regulated in naive and Ag-primed CD4⫹ Th cells. A, Histograms showing results of FACS analysis of freshly isolated naive CD4⫹ Th cells and Th cells primed with Ag for 96 h (Day 4), using PE-Cy5-CD4, PE-CD62L, or FITC-CD25 Abs. Curves with lighter shaded regions are cells stained by isotype control Abs. B, Th cell lineage-specific transcription factors, T-bet and GATA-3, are detected by RT-PCR in naive and Ag-primed Th cells. Naive, freshly isolated CD4⫹ Th cells; Day 2, Th cells stimulated with Ag/APC for 2 days; Day 4, Th cells stimulated with Ag/APC for 4 days; mature Th1 or Th2 cells were isolated by two cycles of cytokine-mediated polarization (14 –16). RT(⫺), First strand cDNA synthesis with day 4 RNA and no RT. ␤-Actin served as control. C, Detection of IL-2, IFN-␥, IL-5, and IL-10 in supernatants of day 2 or day 4 Ag-primed differentiating Th cells by ELISA. D, Quantitative detection of SOCS mRNA transcripts in naive Th cells or Th cells stimulated with Ag for 2 days (Day 2) or 4 days (Day 4) by real-time RT-PCR. SOCS1, SOCS2, SOCS3, and CIS mRNA levels are presented as copies per cell as calculated in the text. For each of the data presented, similar results were obtained in three independent experiments.

740


nonpolarizing conditions (26, 27), expression of CD62L is downregulated (Fig. 1A) while CD25 and IL-2 secretion (Fig. 1C) are up-regulated, indicating that the HEL concentration used induces Th activation and not anergy. Consistent with published reports (28), we do not detect significant expression of T-bet in naive cells (Fig. 1B), but the level of this transcription factor, a marker of the Th1 lineage, increased significantly by day 2 of Ag stimulation (Fig. 1B). Expression of GATA-3 mRNA, a transcription factor that characterizes cells of the Th2 lineage (29), is detectable in naive cells and its level increases with time in culture (Fig. 1B) as previously reported (30). We also detect significant secretion of Th1 (IFN-␥) and Th2 (IL-5, IL-10) cytokines in the culture supernatants, and increases in the levels of these cytokines are accompanied by a sharp decline in IL-2 secretion (Fig. 1C). Together, these results establish that the early differentiating Th cells used in our analysis contain significant numbers of both Th1 and Th2 progenitor cells. We then assessed the effects of TCR signaling on regulation of SOCS expression by real-time RT-PCR. In Fig. 1D, we show that SOCS1, SOCS2, SOCS3, and CIS mRNAs are constitutively expressed in naive Th cells, with SOCS3 being the most abundant. We further show that stimulation of naive Th cells for 48 h (day 2 cells) induces significant up-regulation of SOCS1, SOCS2, and CIS expression, and a sharp decline in SOCS3 expression (Fig. 1D). Although the decrease in SOCS3 is most dramatic at the 48-h time point, we also observe a slight decrease after 24 h (data not shown). Consistent with previous reports (18, 31), the decrease in SOCS3 is transient as it is followed by steady increase in its steady-state levels thereafter (Fig. 1D). Dynamic changes in the pattern of SOCS gene expression that accompany initiation of naive Th cell differentiation suggest that cellular pathways that regulate T cell activation and lineage commitment may be under feedback regulation by SOCS proteins. These results further suggest that increases in SOCS expression following Agpriming may serve as a phenotypic marker of activated Th cells. Polarizing cytokines activate transcription of SOCS genes in differentiating Th cells The data presented above clearly suggest that transcription of SOCS genes during early stages of naive Th activation is regulated in part by signals emanating from TCR ligation and costimulation. As significant cytokine secretion occurs following antigenic stimulation of naive Th cells (Fig. 1C), we examined the contribution of Th1- and Th2-polarizing cytokines to the induction of SOCS expression in these early differentiating cells. Naive Th cells primed with Ag/APC for 4 days were washed to remove the Ag, starved for 2 h before stimulation with IFN-␥, IL-4, or IL-12, and then analyzed for induction of SOCS expression by real-time RTPCR. Across the board, SOCS expression is induced by all three

cytokines, although the effects on individual SOCS genes vary and depend on the cytokine used for stimulation (Fig. 2). For example, IL-4 or IFN-␥ induces relatively higher levels of SOCS1 compared with IL-12, while much higher levels of SOCS3 is induced by IL-4 or IL-12. Interestingly, IL-4 appears to be the most potent inducer of all SOCS members analyzed and, among SOCS members, SOCS1 is most responsive to cytokine stimulation. Similar pattern of cytokine-induced SOCS expression was observed in naive Th cells stimulated for 48 h (data not shown). It is of note that the day 2 or day 4 Ag-primed cells induce SOCS3 expression in response to cytokine stimulation, suggesting that the decline in SOCS3 mRNA observed after 48 h of antigenic stimulation may derive from TCR ligation and costimulatory signals Because cytokines mediate their effects through activation of JAK/STAT signal transduction pathway, we performed EMSA and supershift analyses to determine the specific STAT pathways that may be involved in induction of SOCS expression by these cytokines. For these analyses, three GAS probes were used: the Fc␥GAS and m67 SIE probe that bind with high affinity to most activated STATs, and the C⑀-GAS probe with an N4 GAS site that allows for high affinity binding to the STAT6 site (32, 33). In line with previous studies, we show that in day 4 differentiating Th cells, IL-12 activates STAT1, STAT3, and STAT4 (Fig. 3A), while IFN-␥ exclusively signals through STAT1 homodimers (Fig. 3B) (34, 35). Analysis of STAT activation by IL-4 using the C⑀-GAS motifs shows specific activation of STAT6 (Fig. 3C), consistent with previous reports. However, similar analysis with the Fc␥ probe reveals that IL-4 activates both STAT1 and STAT6 in differentiating Th cells (Fig. 3D). Supershift analysis indicates that the activated STAT1 interacts with the GAS motif independent of STAT6 and does not for a heterodimer with STAT6 (Fig. 3D, lane 5). Thus, in uncommitted early differentiating Th cells, IL-4 signals are transduced by two signaling pathways, one that is mediated by STAT6 homodimers and another involving STAT1 homodimers. Optimal induction of SOCS genes in developing Th-polarizing cytokines requires STAT1 Activation of STAT1 signaling pathway by each of the three cytokines (IL-4, IL-12, IFN-␥) that influence commitment to the Th1 or Th2 phenotype (Fig. 3) suggests that this critical signal transducer may be an important regulator of SOCS genes during Th cell differentiation. To assess the contribution of STAT1, if any, in regulating expression of SOCS genes in differentiating Th cells, purified naive CD4⫹ Th cells from WT or STAT1⫺/⫺ mice were activated in plate-bound anti-CD3/anti-CD28 Abs and analyzed for SOCS expression by real-time RT-PCR. Propagation of WT Th cells under nonpolarizing or Tho condition (no Abs or exogenous

FIGURE 2. Transcription of SOCS genes is induced by IL-4, IL-12, or IFN-␥ in Ag-primed primary Th cells. Ag-primed CD4⫹ 3A9 Th cells were starved for 2 h and then stimulated with IL-4, IL-12, or IFN-␥ for 30 or 60 min. SOCS mRNA transcripts were detected by quantitative real-time RT-PCR.

The Journal of Immunology cytokine) induces significant expression of SOCS1 (⬃200 copies/ cell), while culturing the cells under neutral or Thn condition (medium contains anti-IL-4, anti-IL-12, and anti-IFN-␥ Abs) induces much lower levels of SOCS1 expression (⬃80 copies/cell). Propagation of the cells under Th1 or Th2 condition induces similar levels of SOCS1 expression, suggesting that in differentiating and uncommitted Th cells, IL-4 induces SOCS1 expression to the same extent as IL-12 and IFN-␥ combined (Fig. 4, left panel). In terms of SOCS3, we consistently observe much higher levels of induction in differentiating Th cells stimulated under Th2 condition (Fig. 4, right panel) and this further supports studies showing that fully differentiated Th2 cells have high constitutive expression of SOCS3 (16, 36). These results further underscore the role of Thpolarizing cytokines in transcriptional activation of SOCS genes and indicate that IL-4 is a more potent inducer of SOCS1 and SOCS3 in differentiating Th cells than IFN-␥ or IL-12. Regardless of whether the cells are stimulated under neutralizing, nonpolarizing, Th1, or Th2 condition, SOCS1 and SOCS3

741 mRNA transcripts are more abundant in WT cells compared with STAT1⫺/⫺ cells (Fig. 4), suggesting involvement of STAT1 in mechanisms that regulate SOCS expression in differentiating Th cells. Although STAT1 plays a significant role in the induction of SOCS1 under Th1 or Th2 condition, it has minimal effects on induction of SOCS3 under the Th1 condition. In contrast, STAT1 plays a crucial role in inducing SOCS3 expression under Th2 condition (Fig. 4, right panel). Selective induction of SOCS3 expression by IL-4 but not by the two Th1-polarizing cytokines, IFN-␥ and IL-12, thus provides a mechanistic explanation for high constitutive expression of SOCS3 in mature Th2 but not Th1 cells. The very low levels of SOCS1 and SOCS3 in STAT1 null Th cells stimulated under Th2 condition indicate that induction of these SOCS members by IL-4 is not mediated by STAT6. Similarly, lower levels of SOCS induction under Th1 condition indicate that STAT4 signaling is not a major SOCS inducer and further underscores the central role of STAT1 in transcriptional regulation of SOCS genes. Taken together, these results underscore the role of

FIGURE 3. IL-4, IFN-␥, and IL-12 activate common and distinct STAT proteins in differentiating CD4⫹ Th cells. EMSA was performed using nuclear extracts (5 ␮g) prepared from Th cells cultured with Ag and APC for 4 days before stimulation with cytokine for the indicated times. Abs used for supershift analysis are shown above each panel. Cytokine-induced retarded DNA-protein binding complexes are indicated by C1, C2, or C3; SS, Ab-induced supershifted complexes. A, EMSA, using 32P-labeled m67 SIE-GAS oligonucleotide probe and nuclear extracts prepared form cells cultured in medium alone (lane 1) or stimulated with IL-12 for 30 min (lane 2, 4-9) or 60 min (lane 3). B, The probe is a 32P-labeled m67 SIE-GAS oligonucleotide and nuclear extracts were derived from cells cultured in medium alone (lane 1) or stimulated with IFN-␥ for 30 min (lane 2, 4-9) or 60 min (lane 3). C, EMSA was performed using a 32P-labeled C⑀-GAS oligonucleotide probe and nuclear extracts from cells cultured in medium alone (lane 1) or stimulated by IL-4 for 30 min (lane 2, 4-8), or 60 min (lane 3). D, EMSA was performed using a 32P-labeled Fc␥RI-GAS oligonucleotide probe and nuclear extracts from cells described in C. Lane 1, cells cultured in medium alone; cells stimulated with IL-4 for 30 min (lane 2, 4-9) or 60 min (lane 3).

742


FIGURE 4. Optimal induction of SOCS genes expression in differentiating Th cells requires STAT1. Freshly isolated naive CD4⫹ Th cells from WT (f) or STAT1⫺/⫺ mice (^) were activated in plate-bound anti-CD3/antiCD28 Abs for 4 days under nonpolarizing (Tho), neutral (Thn), Th1, or Th2 condition as described in Materials and Methods. SOCS1 or SOCS3 mRNA transcripts expressed in the cells were quantitated by real-time RT-PCR analysis.

Ag and cytokines in induction of SOCS expression and suggest that both TCR and cytokine signaling are under feedback regulation by SOCS in differentiating Th cells. IL-4 is a potent inducer of STAT1 activation in Th2 but not Th1 cells In view of the role of STAT1 in SOCS induction and the dramatic reduction in SOCS1 and SOCS3 expression in naive STAT1⫺/⫺ Th cells propagated under Th2 condition, it was of interest to determine the Th cell subtypes that activate STAT1 in response to IL-4 signaling. Therefore, we analyzed STAT1 activation in D10.G4.1 Th2, AE7 Th1 cell lines, as well as in primary Th1 and Th2 cells established from Ag-primed naive Th cells after two cycles of polarization. Western blotting using pSTAT1 Abs shows that STAT1 is activated by IL-4 in primary Th2 cells (Fig. 5A) and the D10.G4.1 Th2 cell line (Fig. 5B), and the effect on STAT activation is concentration dependent. However, STAT1 activation is barely detectable in primary Th1 cells stimulated with the higher IL-4 concentration (Fig. 5A) and is not detected in the AE7 Th1 cells (Fig. 5B). These results have also been confirmed by EMSA/ supershift analyses using the SIE GAS probe and STAT1 Ab (data not shown). Two groups have previously shown that IL-4, which typically activates STAT6, activates STAT5 in activated T cells by unknown mechanism (37, 38). Because the evidence for IL-4-induced STAT1 activation in Th2 cells is based mainly on results from supershift assay and Western blot analysis with a pSTAT1 Ab that may cross-react with STAT5 and/or STAT6, we verified these using a STAT1-specific Ab. We performed immunoprecipitation (IP)/Western blot analyses on cell extracts from the IL-4 stimulated Th2 cells. The IP is performed with STAT1␣ Ab, followed by Western blot analysis with anti-P-Tyr Ab, and reveals STAT1 phosphorylation (Fig. 5Ci). Verification of equal protein loading is demonstrated by blotting with STAT1 (Fig. 5Cii). After IP with the STAT1 Ab, the diluted supernatant was subjected to IP/Western blot analysis with either STAT6 Ab (Fig. 5Ciii) or STAT5 (Fig. 5Civ). Similar IP/Western blot analysis was performed using a P-Tyr-specific Ab and STAT1 Ab (Fig. 5D, i and ii). We also performed IP with the NH2-terminal STAT1 Ab, followed by Western blotting using pSTAT1 Ab (Fig. 5Diii). Sequential blot analysis using STAT1 Ab detects equivalent amounts of the STAT1 protein in control and IL-4-stimulated cells (Fig. 5Div), suggesting that our pSTAT1 Ab specifically detects tyrosine-phosphorylated STAT1 in the cells treated with IL-4. Collectively, these results obtained with a STAT1 Ab that does not cross-react with either STAT5 or STAT6 are consistent with our gel shift (Fig. 3B) and Western blot (Fig. 5, A and B) data presented above. We have also demonstrated by immunofluorescence analysis that stim-

ulation of Th2 cells with IL-4 induces STAT1 nuclear localization (Fig. 5, E and F). The IP/Western (Fig. 5D, iii and iv) and immunofluorescence (data not shown) studies were also repeated with established Th2 D10.1 cells with similar results. To our knowledge, this is the first demonstration that IL-4 activates STAT1 in Ag-activated differentiating Th, Th2 cells, and to a lesser extent in Th1 cells. This may represent a form of negative-feedback mechanism regulating IL-4 signaling in Th2 cells and may reflect a fundamental difference in the effects of IL-4 on Th1 and Th2 cells. SOCS1 inhibits STAT6 activation in Th cells STAT6 signaling pathway plays a central role in IL-4-induced transcriptional activation of Th2 effector genes. Therefore, we used the D10.G4.1 Th2 cell line to directly examine whether SOCS proteins regulate this important pathway of Th2 cells (39, 40). This cell line provides a stringent test system because the D10.G4.1 cell secretes and responds to IL-4, constitutively expresses both SOCS1 and SOCS3 (18), and STAT6 is constitutively phosphorylated under normal culture condition in medium containing IL-2 (40). We transfected the D10.G4.1 cells with a SOCS1 expression vector, and analysis of cells with stable overexpression of SOCS1 (Fig. 6A) shows that STAT6 phosphorylation is inhibited in clones with overexpression of SOCS1 but not in the control clone (Fig. 6B). Thus, inhibition of STAT6 activation of Th2 cells is effected by inducing a net increase in the steady-state levels of SOCS molecules in the cells. A logical implication of this assertion is that a significant reduction of endogenous SOCS levels would enhance STAT6 activation. To test this prediction, we depleted SOCS1 in D10.G4.1 Th2 cells by overexpressing an anti-sense SOCS1 cDNA construct. Control cells transfected with the empty vector or the SOCS1-depleted D10.G4.1 cells were washed, starved for 2 h, and stimulated with various concentrations of IL-4. Results of Western blot analysis using pSTAT6 are consistent with our prediction: whereas significant phosphorylation of STAT6 is detected in control cells only after IL-4 stimulation, STAT6 is constitutively activated in SOCS1-depleted cells (Fig. 6C, upper band). SOCS1 negatively regulates proliferation of Th2 cells We next examined the effect of SOCS1 on the proliferation of D10.G4.1 Th2 cells. Control cells (Vector) and cells overexpressing SOCS1 (sense) or anti-sense SOCS1 cDNA were cultured for 48 h in medium containing exogenous IL-2 and secreted IL-4. Proliferation of the cells was measured by [3H]thymidine incorporation assay. Robust proliferative responses are observed in all three clones after 24 h in culture, although a slight increase in [3H]thymidine incorporation is noted for cells expressing the anti-

The Journal of Immunology

743

FIGURE 5. IL-4 is a potent inducer of STAT1 activation in Th2 but not Th1 cells. A, Primary Th1 and Th2 cells were established from Ag-primed naive Th cells after two cycles of polarization and stimulated with the various concentrations of IL-4 indicated. B, D10.G4.1 Th2 or AE7 Th1 cells were stimulated with IL-4. Western blot analysis of STAT1 activation by IL-4 was performed with whole cell extracts (40 ␮g/lane) using pSTAT1 Abs. Filters were stripped and reprobed with ␤-actin Abs. C and D, IP/Western blot analyses on cell extracts from IL-4-stimulated primary Th2 or D10.G4.1 Th2 cells. C, IP was performed with STAT1␣ Ab, then blotted with either a P-Tyr-specific Ab (i) or an NH2-terminal STAT1 Ab (ii). After IP with the STAT1 Ab, the diluted supernatant was split into two aliquots: one aliquot was subjected to IP/Western blot analysis with STAT6 Ab (iii) while the other to STAT5 (iv). D, IP was performed on extracts from primary Th2 (i) or D10.G4.1 (ii) cells using the P-Tyr-specific Ab and Western blotting was with STAT1 (i and ii). IP was also performed with the STAT1␣ Ab and blotted with pSTAT1 (iii) or the NH2-terminal STAT1 Ab (iv). E, Primary HEL-specific Th2 cells stimulated with IL-4 were stained with STAT1-specific mAb and translocation of STAT1 into the nucleus was detected by confocal microscopy as described in Materials and Methods and in the panel to the left of the figure. F, Relative amounts of STAT1 in the cytoplasm and nucleus of the cells (described in E) were quantitated (fluorescence units) and presented on the bar graph as a ratio of STAT1 in the cytoplasm/STAT1 in the nucleus.

sense SOCS1 cDNA construct (Fig. 7A). Twenty-four hours later (day 2), proliferation of the vector control (Fig. 7A, left panel) and cells overexpressing SOCS1 (Fig. 7A, center panel) declines, con-

sistent with progressive consumption of IL-2 in the culture (40). However, reduction in proliferation is most drastic in cells with forced expression of SOCS1 on day 2 of stimulation (Fig. 7A,

FIGURE 6. SOCS1 inhibits STAT6 activation in Th cells. Whole cell extracts (40 ␮g/lane) from cells stably transfected with pBabe vector alone (Vector), pBabe/SOCS1 expression construct clone 1 (SOCS1 c1), or SOCS1 clone 2 (SOCS1 c2) were subjected to Western blot analysis with a SOCS1-specific Ab (A) or pSTAT6 Ab (B) as probe. C, D10.G4.1 cells stably transfected with the empty vector or anti-sense SOCS1 cDNA were stimulated with the various concentrations of IL-4 indicated. Activation of STAT6 was detected by Western blot analysis using the pSTAT6 Ab. The membranes were stripped and re-probed with anti-␤-actin (A and C) or STAT6 (B) Abs.

744


FIGURE 7. SOCS1 regulates proliferation of Th2 cells by modulating p27kip1 expression. A, D10.G4.1 Th2 cells with stable expression of SOCS1 or anti-sense SOCS1 cDNA or containing the empty vector were cultured for 1 or 2 days. Proliferation of the cells was assessed by [3H]thymidine incorporation and presented as mean change in counts per minute ⫾ SEM of responses of five replicate cultures as described in Materials and Methods. B, Transcriptional activation of genes coding for cell cycle regulatory proteins p21WAF1 or p27kip1 was analyzed by RT-PCR of RNA isolated from transfected D10.G4.1 Th2 cells described above. C, Detection of p27kip1 or ␤-actin protein in whole cell extracts (40 ␮g/lane) derived from D10.G4.1 Th2 cells containing the empty vector or transfected with anti-sense SOCS1 cDNA. S, sense; AS, anti-sense.

center panel). In contrast, depletion of SOCS1 levels by overexpression of the anti-sense SOCS1 cDNA enhances proliferation of the cells (⬃3-fold), suggesting that proliferation of Th cells is under negative feedback regulation by SOCS1. Similar results have been obtained with D10.G4.1 Th2 cells expressing sense and antisense SOCS3 cDNA (18). To explore the mechanistic basis of the growth inhibitory effects of SOCS on these cells, we analyzed expression of several genes that have been implicated in the regulation of the cell cycle. This analysis reveals that the growth regulatory effects of the SOCS1 is mediated in part by its effects on cyclin-dependent kinase protein, p27kip1 (Fig. 7, B and C), a critical modulator of Th cell proliferation (41). The effect is specific, as the level of another cyclin-dependent kinase protein, p21WAF1, is unaffected. However, as expression of SOCS1 or other members of the SOCS family are under stringent regulation to prevent inappropriate inhibition of diverse signaling pathways, we cannot rule out the possibility that overexpression of SOCS1 may have influenced other signaling pathways in a nonspecific manner and contributed to the inhibition of proliferation.

Discussion In this study, we have examined the regulation of SOCS genes during primary immune responses and explored the possibility that SOCS proteins may function as feedback regulators of Th cell activation, growth, and differentiation. We show that SOCS1, SOCS2, SOCS3, and CIS genes are constitutively expressed in naive Th cells, with SOCS3 being the most abundant (Fig. 1D). Ag-stimulation of naive Th cells down-regulates SOCS3 expression and concomitantly upregulates SOCS1, SOCS2, and CIS genes transcription, and the change in the pattern of SOCS genes transcription correlates temporally with increases in cytokine secretion (Fig. 1C), suggesting that TCR and cytokine signaling induce SOCS expression and may in turn be under feedback regulation by SOCS proteins. However, the downregulation of SOCS3 expression that accompanies Th cell activation is transient (18), and we show in this study that it is mediated by signals derived from TCR ligation and costimulatory molecules, but not cytokines. The level of SOCS3 mRNA also decreases following Ag-priming of resting mature Th cells, suggesting that transient inhibition of SOCS3 may be an essential event in T cell activation.

The Journal of Immunology Although TCR ligation and costimulatory signals play central roles in regulating SOCS expression at initial stages of Th cell activation, cytokines are the major inducers of SOCS expression in Th cells. The level of SOCS expression increases tremendously in cells propagated under Th1 or Th2 cell condition compared with cells maintained without exogenous cytokines or under neutral condition (Fig. 4) and SOCS levels are severalfold higher in resting Th cells than naive or day 2 differentiating Th cells. Moreover, we show that Th1- (IFN-␥ and IL-12) and Th2-polarizing (IL-4) cytokines induce SOCS expression in differentiating Th cells. IL-4 appears to be the most potent inducer of SOCS1 and SOCS3 (Fig. 4), and this is particularly surprising considering that IL-4 signals through STAT6 (42, 43) in Th2 cells, and functional STAT6 binding sites have not been positively identified in promoters of SOCS genes. However, analysis of STAT signaling in day 4 differentiating Th cells reveals that IL-4 activates both STAT1 and STAT6 pathways (Figs. 3 and 5), implying that induction of SOCS expression by IL-4 in these cells may be mediated through STAT1. A role for STAT1 in the induction of SOCS expression by IL-4 is supported by a recent study showing that a STAT1 GAS site in the SOCS3 promoter is required for induction of SOCS3 expression by leukemia inhibitory factor in pituitary corticotroph cells (12). Although STAT1 activation by IL-4 has previously been reported in a colon carcinoma cell line (44), to our knowledge this is the first report of STAT1 activation by IL-4 in Th cells. The activation of STAT1 by IL-4, IL-12, or IFN-␥ in early differentiating Th cells and the requirement of STAT1 for optimum induction of SOCS1 and SOCS3 by Th-polarizing cytokines (Fig. 4) underscore the potentially pivotal role of STAT1-induced SOCS expression during Th cell activation, differentiation, and lineage commitment. It is remarkable that the decrease in SOCS expression in STAT1⫺/ ⫺-deficient Th cells is most prominent in response to IL-4, and although STAT1 activation by IL-4 has previously been reported in a colon carcinoma cell line (44), to our knowledge, this is the first report of STAT1 activation by IL-4 in Th cells. Taken together, these results thus reveal a previously unrecognized role of IL-4 in the induction of STAT1 activation or SOCS expression. Interestingly, IL-4 preferentially induces STAT1 activation in Th2 cells but not Th1 cells (Fig. 5), and the levels of SOCS1 and SOCS3 are dramatically reduced in STAT1⫺/⫺ Th2 cells (Fig. 4), suggesting that STAT1 signaling pathway may negatively regulate intensity and duration of cytokine signaling in Th2 cells by inducing SOCS expression. We show that one of the possible mechanisms by which SOCS proteins can regulate host immunity is by inhibiting IL-4-induced STAT6 phosphorylation in Th2 cells (Fig. 6). Assuming that development to Th2 phenotype is the default and dominant pathway of differentiating naive Th cells as has been proposed (45), repression of IL-4-induced STAT6 phosphorylation by SOCS proteins may provide a feedback autoregulatory loop that attenuates Th2 effector functions in situations where host immunity requires Th1-dominated responses. In fact, inhibition of IL4-induced STAT6 phosphorylation by SOCS proteins has been described in B lymphocytes and monocytes, although the mechanism of SOCS induction differs from that of Th cells (46, 47). Whereas IL-4 does not regulate SOCS1 expression in B lymphocytes (46), we find that it is an inducer of SOCS1 and SOCS3 expression in Th cells (Fig. 4). However, it is still not clear whether regulation of SOCS expression by IL-4 in Th but not B cells indicates intrinsic differences between Th cells and B cells, or if this is due to analysis of primary mouse Th cells vs long-term human B lymphoma BJAB cell lines (46). Nonetheless, the biological relevance of regulating the levels of SOCS proteins in Th2 cells is underscored by the profound effects exerted on cell pro-

745 liferation by changes in the endogenous levels of SOCS proteins in Th2 cells (Fig. 7). In current models of IL-4 signal transduction, STAT6 mediates IL-4-induced changes in gene transcription and differentiation events while growth signals derive from insulin receptor substrate-2 (IRS-2) signaling pathway (48 –50). As activated STAT6 and IRS-2 proteins are recruited to distinct regions of the IL-4R, it has been proposed that growth and gene expression in Th2 cells are regulated by distinct mechanisms (50). In this report, we have provided evidence suggesting that the two limbs of IL-4 signaling in Th2 cells are under feedback regulation by SOCS proteins. In addition to the inhibition of STAT6 signaling by SOCS1 and SOCS3, we show that overexpression of SOCS1 or SOCS3 (18) profoundly inhibits proliferation of Th2 cells (Fig. 7). Although we did not examine whether the growth inhibitory effects result from inhibition of IRS-2 signaling, a recent study, showing that SOCS1 or SOCS3 binds to IRS-2 in pancreatic ␤ cells and targets it for degradation by ubiquitin-mediated proteolysis, is highly suggestive (51). Remarkably, depletion of SOCS1 by forced overexpression of anti-sense SOCS1 construct induces significant proliferation of Th2 cells by regulating the expression of the cyclindependent kinase inhibitor p27kip1 (Fig. 7, B and C). These observations are in concert with reports showing that cytokinestimulated Th cell proliferation is regulated by p27kip1 (41, 52). Thus, SOCS proteins may be important regulators of growth signals in Th cells as they can inhibit IRS-2 signaling (50) and also modulate proliferation of Th cells through their regulatory effects on cyclin-dependent kinase inhibitors. In summary, results presented in this study are consistent with a model where antagonistic cytokines that influence developmental fate of early differentiating Th cells are under feedback regulation by SOCS proteins, and homeostatic levels of these polarizing cytokines in the Th cell are sensitive and responsive to slight changes in steady levels of SOCS proteins. Skewing of the immune response toward a Th1- or Th2-dominated response may therefore be the result of cross-talk between Th1- and Th2-polarizing cytokines and integration of their antagonistic signals by SOCS proteins. The opposing effects of STAT1 and STAT6 signaling pathways noted in this study further suggests that IL-4 has dual effects on differentiating Th cells and plays a central role in homeostatic regulation of the relative abundance of Th1 and Th2 cells. On one hand, it simulates growth and activates cytokine pathways through activation of STAT6 and IRS-2 signaling pathways, while on the other hand, it inhibits growth and attenuates cytokine signaling via STAT1-dependent up-regulation of SOCS proteins.

Acknowledgments We are grateful to Drs. John O’Shea (National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH) and Raymond P. Donnelly (Center for Biologics Evaluation and Research, Food and Drug Administration) for critical reading of the manuscript. We also thank Dr. Kaimei Song (National Institute of Allergy and Infectious Diseases, NIH) for technical assistance with FACS. We also thank Dr. Robert Fariss (National Eye Institute, NIH) for assistance with confocal microscopy.

References 1. Chen, X. P., J. A. Losman, and P. Rothman. 2000. SOCS proteins, regulators of intracellular signaling. Immunity 13:287. 2. Starr, R., T. A. Willson, E. M. Viney, L. J. Murray, J. R. Rayner, B. J. Jenkins, T. J. Gonda, W. S. Alexander, D. Metcalf, N. A. Nicola, and D. J. Hilton. 1997. A family of cytokine-inducible inhibitors of signalling. Nature 387:917. 3. Naka, T., M. Fujimoto, and T. Kishimoto. 1999. Negative regulation of cytokine signaling: STAT-induced STAT inhibitor. Trends Biochem. Sci. 24:394. 4. Hilton, D. J., R. T. Richardson, W. S. Alexander, E. M. Viney, T. A. Willson, N. S. Sprigg, R. Starr, S. E. Nicholson, D. Metcalf, and N. A. Nicola. 1998. Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc. Natl. Acad. Sci. USA 95:114.

746


5. Narazaki, M., M. Fujimoto, T. Matsumoto, Y. Morita, H. Saito, T. Kajita, K. Yoshizaki, T. Naka, and T. Kishimoto. 1998. Three distinct domains of SSI1/SOCS-1/JAB protein are required for its suppression of interleukin 6 signaling. Proc. Natl. Acad. Sci. USA 95:13130. 6. Sasaki, A., H. Yasukawa, T. Shouda, T. Kitamura, I. Dikic, and A. Yoshimura. 2000. CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2. J. Biol. Chem. 275:29338. 7. Yasukawa, H., H. Misawa, H. Sakamoto, M. Masuhara, A. Sasaki, T. Wakioka, S. Ohtsuka, T. Imaizumi, T. Matsuda, J. N. Ihle, and A. Yoshimura. 1999. The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. EMBO J. 18:1309. 8. Fujimoto, M., H. Tsutsui, S. Yumikura-Futatsugi, H. Ueda, O. Xingshou, T. Abe, I. Kawase, K. Nakanishi, T. Kishimoto, and T. Naka. 2002. A regulatory role for suppressor of cytokine signaling-1 in Th polarization in vivo. Int. Immunol. 14:1343. 9. Eyles, J. L., D. Metcalf, M. J. Grusby, D. J. Hilton, and R. Starr. 2002. Negative regulation of interleukin-12 signaling by suppressor of cytokine signaling-1. J. Biol. Chem. 277:43735. 10. Cornish, A. L., M. M. Chong, G. M. Davey, R. Darwiche, N. A. Nicola, D. J. Hilton, T. W. Kay, R. Starr, and W. S. Alexander. 2003. Suppressor of cytokine signaling-1 regulates signaling in response to interleukin-2 and other ␥c-dependent cytokines in peripheral T cells. J. Biol. Chem. 278:22755. 11. Jegalian, A. G., and H. Wu. 2002. Regulation of Socs gene expression by the proto-oncoprotein GFI-1B: two routes for STAT5 target gene induction by erythropoietin. J. Biol. Chem. 277:2345. 12. Auernhammer, C. J., C. Bousquet, and S. Melmed. 1999. Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc. Natl. Acad. Sci. USA 96:6964. 13. Saito, H., Y. Morita, M. Fujimoto, M. Narazaki, T. Naka, and T. Kishimoto. 2000. IFN regulatory factor-1-mediated transcriptional activation of mouse STAT-induced STAT inhibitor-1 gene promoter by IFN-␥. J. Immunol. 164:5833. 14. Durbin, J. E., R. Hackenmiller, M. C. Simon, and D. E. Levy. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443. 15. Kim, S. J., M. Zhang, B. P. Vistica, C. C. Chan, D. F. Shen, E. F. Wawrousek, and I. Gery. 2002. Induction of ocular inflammation by T-helper lymphocytes type 2. Invest. Ophthalmol. Visual Sci. 43:758. 16. Egwuagu, C. E., C. R. Yu, M. Zhang, R. M. Mahdi, S. J. Kim, and I. Gery. 2002. Suppressors of cytokine signaling proteins are differentially expressed in Th1 and Th2 cells: implications for Th cell lineage commitment and maintenance. J. Immunol. 168:3181. 17. Carbone, F. R., B. S. Fox, R. H. Schwartz, and Y. Paterson. 1987. The use of hydrophobic, ␣-helix-defined peptides in delineating the T cell determinant for pigeon cytochrome c. J. Immunol. 138:1838. 18. Yu, C. R., R. M. Mahdi, S. Ebong, B. P. Vistica, I. Gery, and C. E. Egwuagu. 2003. Suppressor of cytokine signaling 3 regulates proliferation and activation of T-helper cells. J. Biol. Chem. 278:29752. 19. Egwuagu, C. E., J. Sztein, R. M. Mahdi, W. Li, C. Chao-Chan, J. A. Smith, P. Charukamnoetkanok, and A. B. Chepelinsky. 1999. IFN-␥ increases the severity and accelerates the onset of experimental autoimmune uveitis in transgenic rats. J. Immunol. 162:510. 20. Li, W., C. N. Nagineni, H. Ge, B. Efiok, A. B. Chepelinsky, and C. E. Egwuagu. 1999. Interferon consensus sequence-binding protein is constitutively expressed and differentially regulated in the ocular lens. J. Biol. Chem. 274:9686. 21. Sadowski, H. B., K. Shuai, J. E. Darnell, Jr., and M. Z. Gilman. 1993. A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261:1739. 22. Lin, J. X., T. S. Migone, M. Tsang, M. Friedmann, J. A. Weatherbee, L. Zhou, A. Yamauchi, E. T. Bloom, J. Mietz, S. John, et al. 1995. The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. Immunity 2:331. 23. Pearse, R. N., R. Feinman, and J. V. Ravetch. 1991. Characterization of the promoter of the human gene encoding the high-affinity IgG receptor: transcriptional induction by ␥-interferon is mediated through common DNA response elements. Proc. Natl. Acad. Sci. USA 88:11305. 24. Shimoda, K., J. van Deursen, M. Y. Sangster, S. R. Sarawar, R. T. Carson, R. A. Tripp, C. Chu, F. W. Quelle, T. Nosaka, D. A. Vignali, et al. 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630. 25. Rothman, P., S. C. Li, B. Gorham, L. Glimcher, F. Alt, and M. Boothby. 1991. Identification of a conserved lipopolysaccharide-plus-interleukin-4-responsive element located at the promoter of germ line ⑀ transcripts. Mol. Cell. Biol. 11:5551. 26. Iezzi, G., D. Scheidegger, and A. Lanzavecchia. 2001. Migration and function of antigen-primed nonpolarized T lymphocytes in vivo. J. Exp. Med. 193:987. 27. Kaplan, M. H., A. L. Wurster, and M. J. Grusby. 1998. A signal transducer and activator of transcription (Stat)4-independent pathway for the development of T helper type 1 cells. J. Exp. Med. 188:1191.

28. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, and L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655. 29. Murphy, K. M., W. Ouyang, J. D. Farrar, J. Yang, S. Ranganath, H. Asnagli, M. Afkarian, and T. L. Murphy. 2000. Signaling and transcription in T helper development. Annu. Rev. Immunol. 18:451. 30. Grogan, J. L., M. Mohrs, B. Harmon, D. A. Lacy, J. W. Sedat, and R. M. Locksley. 2001. Early transcription and silencing of cytokine genes underlie polarization of T helper cell subsets. Immunity 14:205. 31. Matsumoto, A., Y. Seki, R. Watanabe, K. Hayashi, J. A. Johnston, Y. Harada, R. Abe, A. Yoshimura, and M. Kubo. 2003. A role of suppressor of cytokine signaling 3 (SOCS3/CIS3/SSI3) in CD28-mediated interleukin 2 production. J. Exp. Med. 197:425. 32. Vignais, M. L., H. B. Sadowski, D. Watling, N. C. Rogers, and M. Gilman. 1996. Platelet-derived growth factor induces phosphorylation of multiple JAK family kinases and STAT proteins. Mol. Cell. Biol. 16:1759. 33. Yu, C. R., J. X. Lin, D. W. Fink, S. Akira, E. T. Bloom, and A. Yamauchi. 1996. Differential utilization of Janus kinase-signal transducer activator of transcription signaling pathways in the stimulation of human natural killer cells by IL-2, IL-12, and IFN-␣. J. Immunol. 157:126. 34. Ho, I. C., and L. H. Glimcher. 2002. Transcription: tantalizing times for T cells. Cell 109(Suppl.):S109. 35. Szabo, S. J., N. G. Jacobson, A. S. Dighe, U. Gubler, and K. M. Murphy. 1995. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity 2:665. 36. Seki, Y., K. Hayashi, A. Matsumoto, N. Seki, J. Tsukada, J. Ransom, T. Naka, T. Kishimoto, A. Yoshimura, and M. Kubo. 2002. Expression of the suppressor of cytokine signaling-5 (SOCS5) negatively regulates IL-4-dependent STAT6 activation and Th2 differentiation. Proc. Natl. Acad. Sci. USA 99:13003. 37. Moriggl, R., V. Sexl, R. Piekorz, D. Topham, and J. N. Ihle. 1999. Stat5 activation is uniquely associated with cytokine signaling in peripheral T cells. Immunity 11:225. 38. Boothby, M., A. L. Mora, M. A. Aronica, J. Youn, J. R. Sheller, S. Goenka, and L. Stephenson. 2001. IL-4 signaling, gene transcription regulation, and the control of effector T cells. Immunol. Res. 23:179. 39. Kaye, J., and C. A. Janeway, Jr. 1984. Induction of receptors for interleukin 2 requires T cell Ag:Ia receptor crosslinking and interleukin 1. Lymphokine Res. 3:175. 40. Kupper, T., M. Horowitz, F. Lee, R. Robb, and P. M. Flood. 1987. Autocrine growth of T cells independent of interleukin 2: identification of interleukin 4 (IL 4, BSF-1) as an autocrine growth factor for a cloned antigen-specific helper T cell. J. Immunol. 138:4280. 41. Kaplan, M. H., C. Daniel, U. Schindler, and M. J. Grusby. 1998. Stat proteins control lymphocyte proliferation by regulating p27Kip1 expression. Mol. Cell. Biol. 18:1996. 42. Zhu, J., L. Guo, C. J. Watson, J. Hu-Li, and W. E. Paul. 2001. Stat6 is necessary and sufficient for IL-4’s role in Th2 differentiation and cell expansion. J. Immunol. 166:7276. 43. Glimcher, L. H., and K. M. Murphy. 2000. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14:1693. 44. Chang, T. L., X. Peng, and X. Y. Fu. 2000. Interleukin-4 mediates cell growth inhibition through activation of Stat1. J. Biol. Chem. 275:10212. 45. Moser, M., and K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. 1:199. 46. Venkataraman, C., S. Leung, A. Salvekar, H. Mano, and U. Schindler. 1999. Repression of IL-4-induced gene expression by IFN-␥ requires Stat1 activation. J. Immunol. 162:4053. 47. Dickensheets, H. L., C. Venkataraman, U. Schindler, and R. P. Donnelly. 1999. Interferons inhibit activation of STAT6 by interleukin 4 in human monocytes by inducing SOCS-1 gene expression. Proc. Natl. Acad. Sci. USA 96:10800. 48. Keegan, A. D., K. Nelms, M. White, L. M. Wang, J. H. Pierce, and W. E. Paul. 1994. An IL-4 receptor region containing an insulin receptor motif is important for IL-4-mediated IRS-1 phosphorylation and cell growth. Cell 76:811. 49. Kaplan, M. H., U. Schindler, S. T. Smiley, and M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4:313. 50. Ryan, J. J., L. J. McReynolds, A. Keegan, L. H. Wang, E. Garfein, P. Rothman, K. Nelms, and W. E. Paul. 1996. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor. Immunity 4:123. 51. Rui, L., M. Yuan, D. Frantz, S. Shoelson, and M. F. White. 2002. SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J. Biol. Chem. 277:42394. 52. Wurster, A. L., D. J. Withers, T. Uchida, M. F. White, and M. J. Grusby. 2002. Stat6 and IRS-2 cooperate in interleukin 4 (IL-4)-induced proliferation and differentiation but are dispensable for IL-4-dependent rescue from apoptosis. Mol. Cell. Biol. 22:117.