Androgen receptor variant AR-V9 is co-expressed with AR-V7 in ...

Author Manuscript Published OnlineFirst on May 4, 2017; DOI: 10.1158/1078-0432.CCR-17-0017 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Androgen receptor variant AR-V9 is co-expressed with AR-V7 in prostate cancer metastases and predicts abiraterone resistance Manish Kohli*,1, Yeung Ho*,2 , David W. Hillman3, Jamie L. Van Etten2, Christine Henzler4, Rendong Yang4, Jamie M. Sperger5, Yingming Li2, Elizabeth Tseng6, Ting Hon6, Tyson Clark6, Winston Tan7, Rachel E. Carlson3, Liguo Wang3,8, Hugues Sicotte3, Ho Thai9, Rafael Jimenez10, Haojie Huang8, Peter T. Vedell3, Bruce W. Eckloff11, Jorge F. Quevedo1, Henry C. Pitot1, Brian A. Costello1, Jin Jen10,11,12, Eric D. Wieben11, Kevin A.T. Silverstein4, Joshua M. Lang5, Liewei Wang13, and Scott M. Dehm2,14,15 *Equal contribution 1 Division of Medical Oncology, Department of Oncology, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 2 Masonic Cancer Center, University of Minnesota, Mayo Mail Code 806, 420 Delaware St SE, Minneapolis, MN 55455 3 Division of Biomedical Statistics and Informatics, Department of Health Sciences, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 4 Minnesota Supercomputing Institute, University of Minnesota, 117 Pleasant St SE, Minneapolis, MN 55455 5 Department of Medicine, Carbone Cancer Center, University of Wisconsin-Madison, 1111 Highland Avenue, Madison, WI 53705 6 Pacific Biosciences, 1380 Willow Rd., Menlo Park, CA 94025 7 Department of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224 8 Department of Biochemistry and Molecular Biology, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 9 Department of Medicine, Mayo Clinic, 13400 E. Shea Blvd., Scottsdale, AZ 85259 10 Department of Laboratory Medicine and Pathology, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 11 Medical Genome Facility, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 12 Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 13 Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic, 200 1st St. SW, Rochester, MN, 55905 14 Department of Laboratory Medicine and Pathology University of Minnesota, Minneapolis, MN, 55455 15 Department of Urology, University of Minnesota, Minneapolis, MN, 55455 Running Title: AR-V9 and prostate cancer therapy resistance Key words: androgen receptor variants, castration-resistant prostate cancer, AR-V7, AR-V9, abiraterone acetate, enzalutamide

1

Downloaded from clincancerres.aacrjournals.org on November 2, 2017. © 2017 American Association for Cancer Research.


Financial support: Funding for this study was provided by the Mayo Clinic Center for Individualized Medicine (MC1351 to M.K. and L.W.), Minnesota Partnership for Biotechnology and Medical Genomics (MNP #14.37 to M.K and S.M.D.), DOD W81XWH-15-1-0633 (to S.M.D.), DOD W81XWH-15-1-0634 (to M.K.), DOD W81XWH-12-1-0052 (to J.M.L.), Movember Foundation/Prostate Cancer Foundation Challenge Award (to M.K., H.H., and S.M.D.), NIH R01CA174777 (to S.M.D.), NIH R01CA181648 (to J.M.L.). Corresponding Authors: Scott M. Dehm, Masonic Cancer Center, University of Minnesota, Mayo Mail Code 806, 420 Delaware St. SE, Minneapolis, MN 55455. Phone: 612-625-1504; Fax: 612-626-4915; E-mail: [email protected] Manish Kohli, Mayo Clinic, 200 1st St. SW, Rochester, MN 55905. Phone: 507-266-9160; Fax: 507-284-1803; E-mail: [email protected]

Statement of Translational Relevance An important component of clinical resistance to endocrine therapies for advanced prostate cancer is expression of androgen receptor (AR) variants. Multiple AR variants are expressed in advanced prostate cancer, but developing specific strategies for monitoring and inhibiting AR variant 7 (AR-V7) have emerged as clinical priorities. This study describes single-molecule sequencing of AR isoforms in advanced prostate cancer, leading to the finding that AR variant 9 (AR-V9) is frequently co-expressed with AR-V7. This work re-annotates AR-V9 mRNA structure, and finds that the role of AR-V9 in therapeutic resistance has been obscured by extensive overlap in mRNA sequence with AR-V7. The finding that high AR-V9 mRNA expression in metastases was predictive of primary resistance to the androgen synthesis inhibitor abiraterone indicates that monitoring and inhibition of AR-V9 may be needed to overcome therapeutic resistance.

2



Abstract Purpose: Androgen receptor (AR) variant AR-V7 is a ligand-independent transcription factor that promotes prostate cancer resistance to AR-targeted therapies. Accordingly, efforts are underway to develop strategies for monitoring and inhibiting AR-V7 in castration-resistant prostate cancer (CRPC). The purpose of this study was to understand whether other AR variants may be co-expressed with AR-V7 and promote resistance to AR-targeted therapies. Experimental Design: We utilized complementary short- and long-read sequencing of intact AR mRNA isoforms to characterize AR expression in CRPC models. Co-expression of AR-V7 and AR-V9 mRNA in CRPC metastases and circulating tumor cells was assessed by RNA-seq and RT-PCR, respectively. Expression of AR-V9 protein in CRPC models was evaluated with polyclonal antisera. Multivariate analysis was performed to test whether AR variant mRNA expression in metastatic tissues was associated with a 12-week progression-free survival endpoint in a prospective clinical trial of 78 CRPC-stage patients initiating therapy with the androgen synthesis inhibitor, abiraterone acetate. Results: AR-V9 was frequently co-expressed with AR-V7. Both AR variant species were found to share a common 3’ terminal cryptic exon, which rendered AR-V9 susceptible to experimental manipulations that were previously-thought to target AR-V7 uniquely. AR-V9 promoted ligandindependent growth of prostate cancer cells. High AR-V9 mRNA expression in CRPC metastases was predictive of primary resistance to abiraterone acetate (HR = 4.0, 95% CI = 1.31-12.2, P = 0.02). Conclusions: AR-V9 may be an important component of therapeutic resistance in CRPC.

3



Introduction Prostate cancer is the most frequently diagnosed male cancer in the United States (1). Surgery or radiation are curative treatment options for men with localized disease. For metastatic prostate cancer, androgen deprivation therapy (ADT) is the standard of care. ADT inhibits the androgen receptor (AR), a master transcriptional regulator in normal and cancerous prostate cells (2). The major limitation of ADT is the development of castration-resistant prostate cancer (CRPC), which is almost invariably due to transcriptional re-activation of the AR (2, 3). In some patients, AR transcriptional re-activation can be targeted with second-generation therapies such as abiraterone acetate and enzalutamide (4, 5). However, resistance is frequent and CRPC remains the second-leading cause of male cancer deaths (6). While there is evidence that emergence of AR-null neuroendocrine CRPC accounts for resistance to abiraterone or enzalutamide in a subset of cases (7), AR transcriptional activity persists in the majority of cases (8).

One mechanism of resistance to abiraterone and enzalutamide is expression of truncated AR variants (AR-Vs). AR-Vs lack the COOH-terminal ligand binding domain (LBD) of full-length AR due to splicing of alternative 3’ terminal cryptic exons (9-14). Instead of a LBD, these 3’ terminal cryptic exons encode short carboxyl-terminal extensions. One particular AR-V, AR-V7, arises from contiguous splicing of AR exons 1, 2, 3, and cryptic exon 3 (CE3) (10, 12). Expression of exon CE3 as the 3’ terminal exon of AR-V7 has been exploited for development of reverse transcription (RT)-PCR, in situ hybridization (ISH), and RNA-sequencing (RNA-seq) assays to detect AR-V7 mRNA expression in tissues (10, 12, 15-18), circulating tumor cells (19-25), and blood (26-28) of patients with CRPC. In circulating tumor cells, positivity for AR-V7 expression has been associated with resistance to abiraterone and enzalutamide, but not taxane

4



chemotherapy (19, 20). In line with this, knock-down of AR-V7 using RNA interference targeted to AR exon CE3 has indicated that AR-V7 can sustain AR signaling and thereby promote key features of the CRPC phenotype in models of CRPC (10, 29-31). Collectively, these studies have supported the concept that AR-V7 could serve as a predictive biomarker for treatment selection, and also an important therapeutic target.

Profiling of clinical CRPC tissues by RNA-sequencing (RNA-seq) has indicated that multiple ARV species are expressed in addition to AR-V7 (16, 17). However, the extent to which AR-Vs may be co-expressed and contribute to resistance is not known. One barrier to understanding these relationships is the challenge in inferring expression levels of complete AR and AR-V isoforms from targeted measurements of discrete regions of transcripts, as is the case for shortread RNA-seq data, quantitative RT-PCR with primers flanking splice junctions, or hybridization of probes to single exons. To address this challenge, we utilized single molecule, real-time (SMRT) isoform sequencing (Iso-Seq) (32) to identify the entire exon composition of AR and AR-V isoforms expressed in CRPC, and estimate their abundance. We report that AR-V9, which was previously reported to arise from contiguous splicing of exons 1, 2, 3, and CE5 (14, 33), is frequently co-expressed with AR-V7 in CRPC. We also re-annotate AR exons CE5 and CE3 as a single 3’ terminal exon with two separate splice acceptor sites for synthesis of AR-V9 or AR-V7 mRNA. As predicted by these newly-annotated features, AR-V9 was susceptible to experimental manipulations that had been assumed to target AR-V7 specifically. In a biopsybased clinical trial of metastatic CRPC patients, tumors with high AR-V9 expression displayed an increased risk of progression during treatment with abiraterone. These findings have high significance for design and interpretation of assays interrogating AR-V expression, and implicate AR-V9 as a clinically important AR-V in CRPC.

5



Materials and Methods

Patients and Clinical Specimens RNA from a CRPC liver metastasis and the LuCaP 35-CR and LuCaP 147 patient-derived xenografts (PDX) was kindly provided by Drs. Colm Morrissey, Eva Corey, and Robert Vessella (34, 35). The PROMOTE study (Prostate Cancer Medically-Optimized Genome-Enhanced Therapy, clinicaltrials.gov identifier NCT01953640) was initiated after obtaining approval from Mayo Clinic Institutional Review Board (IRB), which ensures accordance with Belmont Report ethical guidelines. All patients provided written informed consent. Details of the PROMOTE study and bioinformatics methods for analysis of PROMOTE RNA-seq data are included in the Supplementary Methods section.

Circulating Tumor Cell Analysis This was a prospective biomarker study evaluating expression of AR in circulating tumor cells from 12 patients with CRPC who were treated with AR targeted therapies including lyase inhibitors (abiraterone, TAK700 or VT-464) or an AR antagonist (enzalutamide). The study was initiated after obtaining approval by the University of Wisconsin IRB, which ensures accordance with Belmont Report ethical guidelines. All patients supplied written informed consent. Details of circulating tumor cell analysis using the VERSA platform (36) are included in the Supplementary Methods section.

Cell Culture 22Rv1 (ATCC, #CRL-2505), LNCaP (ATCC, #CRL-1740), VCaP (ATCC, #CRL-2876), and DU145 (ATCC, #HTB-81) cells were obtained from American Type Culture Collection (ATCC). ATCC ensures authenticity of these human cell lines using short tandem repeat analysis. 22Rv1, LNCaP, and DU145 cells were maintained in RMPI 1640 (Invitrogen) with 10% fetal 6



bovine serum (FBS), 100 units mL-1 penicillin and 100 µg mL-1 streptomycin (pen/strep) in a 5% CO2 incubator at 37oC. VCaP cells were cultured in DMEM (Invitrogen) with 10% FBS and pen/strep in a 5% CO2 incubator at 37oC. CWR-R1 cells (37) were a kind gift from Dr. Elizabeth Wilson (UNC Chapel Hill) and cultured in RPMI 1640 + 10% FBS and pen/strep. Cell line authentication and mycoplasma monitoring are described in the Supplementary Methods section.

Illumina AR RNA-seq RNA isolated from 22Rv1 cells, CWR-R1 cells, LuCaP 147 PDX tissue, and a CRPC liver metastasis was converted to cDNA using a Clontech Advantage RT kit using both oligo-dT and random hexamer primers as per the manufacturer’s recommendations. cDNA samples were submitted to the University of Minnesota Genomics Center for RNA-seq library preparation and hybrid capture with a custom AR-based SureSelect (Agilent) bait library (30) using the SureSelect QXT reagent kit (Agilent) as per manufacturer’s recommendations. Post-capture sequencing libraries were pooled and diluted to 10 pM for flow cell clustering and sequenced using Illumina HiSeq 2000 with 2X50bp settings. For metastatic biopsy specimens obtained under the PROMOTE trial, RNA sequencing libraries were prepared at the Mayo Clinic Medical Genome Facility according to the manufacturer’s instructions for the TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, CA). The concentration and size distribution of the libraries were determined on an Agilent Bioanalyzer DNA 1000 chip and Qubit fluorometry (Invitrogen, Carlsbad, CA). Libraries were pooled and diluted to 8-10 pM for flow cell clustering and sequenced using an Illumina HiSeq 2000 at 2X101bp settings. Bioinformatics methods for analysis of RNA-seq data are included in the Supplementary Methods section. The RNA-seq data from the PROMOTE study are available through the NCBI database of Genotypes and Phenotypes (dbGaP) under accession phs001141.v1.p1. 7



3’ Rapid Amplification of cDNA Ends RNA extracted from 22Rv1 cells and LuCaP 35-CR PDX tissue was subjected to 3’ rapid amplification of cDNA ends (3’-RACE) using a 2nd generation 5’/3’ RACE kit (Roche) according to manufacturer’s instructions. Briefly, 1 μg total RNA was used for first-strand cDNA synthesis using the oligo(dT)-anchor primer provided in the kit. An aliquot of the cDNA reaction was amplified by PCR using Quanta AccuStart II PCR SuperMix (Quanta Biosciences), a forward primer anchored in AR exon 1 (5’-TTCACCGCACCTGATGTGTG) or AR exon 3 (5’GCTGAAGGGAAACAGAAGTACC) paired with a reverse primer provided by the kit (5’GACCACGCGTATCGATGTCGAC-3’). PCR was performed with an initial melt at 95oC for 2 min, followed by 10 cycles of PCR (95°C for 15 sec, 60°C for 30 sec, and 72°C for 40 sec) and then 26 cycles of PCR (95°C for 15sec, 60°C for 30 sec and 72°C starting at 40 sec for the first cycle increasing 20 sec every additional cycle).

PacBio SMRT Iso-Seq Amplified 3’ RACE products from 22Rv1 cells and LuCaP 35-CR xenografts were converted into SMRTbell sequencing libraries using the SMRTbell Template Prep Kit 1.0 (Pacific Biosciences) per the manufacturer’s recommendations. Amplified products were end repaired and ligated to SMRTbell hairpin adapters. SMRTbell libraries were purified using AMPure PB Beads (Pacific Biosciences). Final libraries were sequenced on the Pacific Biosciences (PacBio) RS II using the P6/C4 sequencing chemistry (Pacific Biosciences). Two SMRT cells were sequenced for each sample. Bioinformatics methods for analysis of PacBio Iso-Seq data are included in the Supplementary Methods section.

Statistical Analysis of PROMOTE Data Composite progression at 12 weeks was categorized as yes/no by evaluating prostate specific antigen (PSA), response evaluation criteria in solid tumors (RECIST), bone scan and symptoms 8



as recommended by Prostate Cancer Working Group-2 (38). mRNA expression levels prior to therapy with abiraterone acetate of full-length AR (ARFL), ARV3, ARV7, ARV9, ARV23, ARV45, Chromogranin-A (CHGA) together with serum PSA, testosterone, serum chromogranin-A (CHGA) levels, Gleason Score (GS) at initial diagnosis, high versus low volume disease, and time from starting hormone therapy to metastatic CRPC stage were evaluated using a logistic regression model for predicting resistance at 12 weeks after starting treatment. Due to the relatively high proportion of patients who did not express individual AR-Vs, a dichotomous cut point was determined by first splitting levels of each AR-V into quartiles or terciles and choosing the cut point that best maximized the difference between responders and non-responders. Levels of AR and AR-V mRNA expression at baseline were tested for associations with composite progression via the Chi-square test. To avoid overparameterization during the multivariate modeling process due to a relatively small number of patients and large number of potential covariates, the final multivariate model fitted only factors with an entry threshold of p ≤ 0.2 in univariate analysis. All possible multivariable models fitting these criteria were considered and the difference in the -2 log likelihoods were determined and tested against the appropriate Chi-square test.

Transient Transfections Details for construction of AR-V9 plasmid are included in the Supplementary Methods section. 22Rv1 and VCaP cells were transfected with two separate small interference RNAs (siRNAs) targeted to AR exon CE3 or three separate siRNAs targeted to exon CE5 as outlined in the Supplementary Methods. Cells were lysed 48hr post-transfection for isolation of total RNA and protein. LNCaP and DU145 cells were transfected with AR-V7 and AR-V9 expression vectors along with AR-responsive luciferase reporter plasmids as described in the Supplementary Methods. Activities of the firefly and Renilla luciferase reporters were assayed using a Dual Luciferase Assay Kit as per the manufacturer’s recommendations. Transfection efficiency was 9



normalized by dividing firefly luciferase activity by Renilla luciferase activity. Data presented represent the mean +/- s.e.m. from three independent experiments, each performed in duplicate.

Lentivirus Infection and Cell Proliferation Assays Details for construction and preparation of lentivirus are included in the Supplementary Methods. LNCaP cells were seeded in 6 cm dishes at 4X105 cells per dish in RPMI with 10% FBS and pen/strep. Cells were transduced the next day by addition of 0.5 μL, 2 μL, 8 μL, 16 μL, or 32 μL of GFP or AR-V9 lentivirus directly to tissue culture medium. Cells were re-seeded 120h post-transduction on 96-well plates in RPMI + 10% CSS + pen/strep and subjected to cell proliferation assays using a BrdU ELISA kit (Roche) according to the manufacturer’s recommendations.

Reverse Transcription-PCR Expression of AR-V7, AR-V9, and full-length AR were assessed by RT-PCR with total RNA extracted from 22Rv1 and VCap cells as described in the Supplementary Methods. Fold change in mRNA expression levels were calculated by the comparative Ct method using the formula 2-(∆∆Ct) and GAPDH as calibrator.

Immunoprecipitation and Western Blot Analysis Lysates from siRNA-transfected 22Rv1 and VCaP cells were subjected to immunoprecipitation with rabbit antisera raised to the unique AR-V9 COOH-terminal peptide (details in the Supplementary Methods), a mouse monoclonal antibody specific for the unique AR-V7 COOHterminal peptide (Cat #: AG10008, Precision Antibody), or rabbit/mouse IgG controls. Immunoprecipitated complexes were boiled in 1X Laemmli buffer and resolved in denaturing

10



gels. Alternatively, transfected cells were harvested in 1X Laemmli buffer and lysates were resolved in denaturing gels. Gels were transferred to nitrocellulose membranes and subjected to western blot analysis as described. Membranes were incubated with primary antibodies (ARN20, Santa Cruz; AR441, Santa Cruz; ERK2-D2, Santa Cruz) diluted 1:1000 overnight at 4°C and then incubated with the appropriate horseradish peroxidase-conjugated secondary antibodies diluted 1:10,000 at room temperature for 2h. Blots were developed by incubation with Super Signal chemiluminescence reagent (Pierce) and exposed to film.

11



Results: RNA-seq Reveals Frequent Co-Expression of AR-V9 and AR-V7 in Prostate Cancer To investigate AR splicing patterns at high depth in prostate cancer, we used a modified RNAseq approach that included an AR sequence enrichment step prior to Illumina paired-end sequencing. We used this approach to analyze RNA from the CRPC 22Rv1 cell line, which is the model in which AR-Vs were first discovered and characterized (9, 10, 12). Visual inspection of RNA-seq reads mapped using the TopHat algorithm (39) confirmed the expected expression of each canonical AR exon 1-8, as well as high expression of a region of the AR gene downstream of exon 3 (Fig. 1A). This is the region of the AR gene where multiple cryptic exons reside, including CE5 and CE3.

Full-length AR is a modular protein encoded by contiguously-spliced exons 1-8. Conversely, AR-V9 and AR-V7 are both encoded by AR exons 1-3, with exons CE5 (14, 33) or CE3 (10, 12) as the 3’ terminal exons, respectively (Fig. 1B). We quantified split reads, defined as RNA-seq reads spanning discrete splice junctions, to infer expression of discrete AR mRNA species. This approach revealed that AR-V9 and AR-V7 isoforms (reads spanning the exon 3/CE5 splice junction and 3/CE3 splice junction, respectively) were abundant AR-Vs. For example, the number of AR-V9 and AR-V7 split reads were 37% and 63%, respectively, of the number of fulllength AR mRNA split reads (reads spanning the exon 3/4 splice junction) (Fig. 1A). Half-lives of exon 3/CE5 and 3/CE3 splice junctions were both longer than 6h, indicating that neither was a splicing intermediate (Supplementary Fig. 1).

12



Attenuation of 22Rv1 RNA-seq read coverage was apparent downstream of exon CE3, which is consistent with termination of the AR-V7 transcript at this location. However, attenuation of 22Rv1 RNA-seq read coverage was not observed for exon CE5 (Fig. 1A). In our analyses, we considered previous studies demonstrating that 22Rv1 cells harbor a 35kb intragenic tandem duplication encompassing AR exon 3, CE5, and CE3, which could confound interpretation of RNA-seq reads mapped to this region (40). We therefore performed similar analysis in CRPC CWR-R1 cells, which do not have a genomic alteration in this exon 3 region of AR (30). Similar to 22Rv1, CWR-R1 cells co-expressed AR-V9 and AR-V7 mRNA. Further, attenuation of RNAseq read coverage was apparent at the end of exon CE3 but not CE5 (Fig. 1C). Similar features of AR-V9 and AR-V7 mRNA expression were noted in RNA from the LuCaP147 PDX and a CRPC liver metastasis obtained from autopsy (Fig. 1D). Overall, these data indicated that the 3’ terminus of AR exon CE5 may not be annotated correctly.

Long-Read Single Molecule Real Time Sequencing of AR Isoforms Reveals a Shared 3’ Terminal Exon for AR-V9 and AR-V7 The short read fragments yielded by Illumina RNA-seq enable quantification of discrete exons as well as discrete splice junctions. However, it is challenging to infer complete mRNAs from 5’ end to 3’ end with these discrete fragments of information, particularly when multiple RNA isoforms exist for a single gene. To address this challenge, we performed 3’ rapid amplification of cDNA ends (RACE) with RNA isolated from 22Rv1 cells using a forward primer anchored in AR exon 1 (Supplementary Fig. 2). 3’RACE reactions were subjected to SMRT Iso-Seq with a PacBio RSII, with the goal of determining the full sequence of each AR mRNA transcript.

13



To interpret SMRT Iso-Seq data, we classified exons contained in 3’ RACE products as “canonical exons“ (exons 1-8 of full-length AR), “annotated cryptic exons” (cryptic exons reported to be expressed in AR-Vs in previous studies), or “PacBio 22Rv1 exons” (novel exons identified in 22Rv1 mRNAs in this study) (Fig. 2A) and developed a visualization scheme to represent the splicing of these exons within each mRNA species. In this visualization scheme, each exon expressed in the context of a specific AR mRNA isoform was denoted by a pixel that was colored based upon whether that exon utilized the exact 5’ and 3’ splice sites annotated for AR exons, the exact 5’ splice site only, the exact 3’ splice site only, or neither of the annotated 5’ or 3’ splice sites (Fig. 2B). To estimate the abundance of each AR mRNA isoform, we counted the number of full-length reads that contained these splicing profiles (Fig. 2B). It should be noted that shorter fragments in a SMRT bell library may be preferentially sequenced by PacBio SMRT cells, which means that comparative levels of full-length AR vs AR-V mRNAs may not be fully quantitative. Nevertheless, an exon 3-duplicated version of full-length AR was the most abundant AR species detected in 22Rv1 cells (Fig. 2B). This finding mitigated concerns about quantitative bias for shorter fragments, as this was the longest PacBio library fragment sequenced and relative quantification appeared to be generally consistent with Illumina split reads spanning the exon 3/4 splice junction of full-length AR (Fig. 1A).

Similar to Illumina sequencing, this SMRT Iso-Seq approach also indicated that AR-V9 was an abundant isoform, with levels comparable to AR-V7. However, while AR-V9 mRNA displayed correct usage of the exon CE5 5’ splice site, the 3’ terminus of this exon appeared to be located at the end of exon CE3, with no splicing events in between (Fig. 2B). This indicated that the 3’ terminal exon CE5 in AR-V9 is approximately 2.4kb, which is much longer than annotated (14, 33), encompassing exons CE5, CE3 and the intervening region. High abundance of AR-V9 relative to AR-V7, as well as a long 3’ terminal exon in AR-V9 mRNA consisting of the 14



contiguous CE5-CE3 segment was confirmed when a forward primer anchored in exon 3 was utilized for 3’ RACE/SMRT Iso-Seq with 22Rv1 mRNA (Fig. 2C, Supplementary Fig. 2). Similarly, the 3’ terminal exon in AR-V9 mRNA had the same identity in the LuCaP 35-CR PDX, although AR-V7 mRNA was more abundant (Figs. 2D&E). Overall, these 3’-RACE/SMRT IsoSeq data were in agreement with coverage data from Illumina short-read sequencing (Fig. 1B), supporting the notion that AR-V9 mRNA is abundant and co-expressed with AR-V7 in CRPC cell line models and PDX tissues.

Co-Expression of AR-V9 and AR-V7 mRNA in Clinical CRPC To test whether AR-V9 is co-expressed with AR-V7 in clinical CRPC tissues, we interrogated RNA-seq data from biopsies of 56 metastatic tissues available from the AACR-PCF Stand-UpTo-Cancer study of CRPC (17). Quantification of split reads spanning the exon 3/CE5 splice junction and 3/CE3 splice junction revealed a positive correlation between AR-V9 and AR-V7 mRNA expression (Fig. 3A). Next, we used RT-PCR to evaluate expression of AR, AR-V7, ARV9, and AR target genes in circulating tumor cells from an independent cohort of 12 patients. AR-V9 was expressed in a subset of patients that received therapy with androgen synthesis inhibitors (abiraterone, VT-464, or TAK700) (8), or enzalutamide (Fig. 3B). All AR-positive patient samples exhibited expression of AR-regulated and prostate cancer-specific genes including NKX3.1 and/or PSMA, TMPRSS2 and KLK2/3. In this small cohort of patients, AR-V9 was frequently co-expressed with AR-V7 in circulating tumor cells.

15



AR-V9 Protein Expression is Inhibited by RNA Interference Targeted to Exon CE3 Previous studies designed to test the functional importance of endogenous AR-V7 in CRPC cell lines utilized siRNA targeted to exon CE3 (10, 29-31). The conclusion that endogenouslyexpressed AR-V7 was driving the CRPC phenotype was based on the assumption these exon CE3-targeted siRNAs were targeting AR-V7 specifically, and not impacting expression of fulllength AR or other AR-Vs. Our finding that AR-V9 and AR-V7 mRNAs both contained the entirety of exon CE3 indicated that both mRNAs may be knocked-down by siRNAs targeted to exon CE3 (Fig. 4A). Indeed, transfection of 22Rv1 and VCaP cell lines with two independent siRNAs targeting AR exon CE3 reduced expression of both AR-V7 and AR-V9 mRNA (Fig. 4B). In contrast, two independent siRNAs targeting AR exon CE5 reduced expression of AR-V9 but not AR-V7 (Fig. 4B).

To test whether these findings extended to endogenous AR-V7 and AR-V9 protein, we raised polyclonal antisera to the COOH-terminal amino acid sequence unique to AR-V9 (Fig. 4C). Polyclonal antibodies affinity purified with an AR-V9 COOH-terminal peptide recognized a single ~75 kDa species in western blots with lysates from LNCaP cells transfected with an AR-V9 expression vector (Supplementary Fig. 3). However, purified AR-V9 polyclonal antibodies also displayed binding to non-AR species in 22Rv1 lysates, indicating this reagent did not have adequate specificity to discriminate endogenous AR-V9 in western blots. To overcome this limitation, we used polyclonal AR-V9 antisera to immunoprecipitate endogenous AR-V9 protein from 22Rv1 and VCaP cells. In these experiments, AR-V9 antibodies immunoprecipitated a ~75 kDa species that was recognized by a monoclonal antibody specific for the AR NTD (Fig. 4D). Consistent with results from RT-PCR experiments, the level of AR-V9 protein in immunoprecipitates was reduced by siRNAs targeted to both AR exons CE5 and CE3 (Fig. 4D).

16



In contrast, the level of AR-V7 protein immunoprecipitated by an antibody specific for the AR-V7 COOH terminus was only reduced by knock-down with siRNA targeted to AR exon CE3 (Fig. 4D). From this, we concluded that AR-V9 protein is expressed endogenously in 22Rv1 and VCaP cells, and can be knocked down with siRNA targeted to AR exon CE3.

High AR-V9 Expression is Associated with Progression During Therapy with Abiraterone Acetate Given our finding that AR-V9 and AR-V7 are frequently co-expressed in CRPC, and that AR-V7 and AR-V9 mRNA both contain exon CE3 at their 3’ termini, we asked whether AR-V9 expression levels were associated with response to abiraterone in CRPC. For this, we analyzed data from a prospective study wherein biopsies of metastatic CRPC tissues were obtained for genomic analysis before patients initiated therapy with abiraterone acetate plus prednisone. Ninety-two patients were enrolled and followed for outcomes with the primary goal of identifying transcriptomic alterations that were predictive of efficacy of treatment. At 12-weeks posttherapy, patients were assessed for disease progression using a 12-week composite progression-free survival (PFS) endpoint as per the recommendations of the Prostate Cancer Working Group-2 (38). The clinicopathological characteristics of the entire cohort are summarized in Supplementary Table 1. There were 78/92 patients enrolled in this study for which RNA-seq and composite PFS outcome were available (Fig. 5A).

The 12-week composite PFS outcomes for these 78 patients included 46/78 responders and 32/78 non-responders. The expression levels for AR and individual AR-Vs were extracted from RNA-seq data by quantifying spliced reads specific to each AR species and normalizing for sequencing depth (Supplementary Table 2). As expected, AR-V7 and AR-V9 mRNA expression 17



levels in pre-treatment metastatic CRPC biopsies were correlated in this cohort (Figs. 5B), with high overlap between top quartiles of AR-V7 and AR-V9 expression (Fig. 5C). Tumor RNA content varied across CRPC biopsies, but samples negative for AR-V7 and AR-V9 did not appear to be due to lack of tumor RNA (Supplementary Fig. 4). The results of univariate Cox regression analysis for 12-week composite PFS are depicted in Fig. 5D. On univariate analysis, expression of AR-V3 (12), AR-V9, and the ratio of AR-V9/full-length AR were significantly correlated with 12-week composite PFS. Multivariate analysis determined that AR-V9 levels in the highest quartile predicted primary resistance to therapy (HR = 4.0, 95% CI = 1.31-12.2, P = 0.02). No multivariable model was significantly better than AR-V9 alone due to the high correlation with other AR-Vs.

AR-V9 is Constitutively Active and Promotes Androgen-Independent Growth AR-V7 has been shown to function as a constitutive effector of the broad androgen/AR signaling program (12, 29, 41). To test whether AR-V9 displays these activities, we transfected cells with an AR-V9 expression vector and AR-responsive promoter-reporter constructs. In AR-positive LNCaP cells (Figs. 6A and B) and AR-negative DU145 cells (Figs. 6C and D), AR-V9 displayed constitutive, ligand-independent transcriptional activity when expressed in isolation, and also when co-expressed with AR-V7. Because abiraterone exerts action at the level of testes, adrenal glands, and tumor cells, this drug is not appropriate for experimental therapy of prostate cancer cells grown in vitro. Therefore, we used enzalutamide as an example of a secondgeneration AR-targeted therapy to test therapeutic sensitivity of AR-V9 transcriptional activity. Similar to AR-V7, constitutive AR-V9 transcriptional activity was insensitive to treatment with enzalutamide (Figs. 6B and D). Consistent with these findings, infection of LNCaP cells with a lentiviral vector harboring AR-V9 resulted in androgen-independent proliferation at lower virus

18



titers, but suppression of proliferation at higher virus titers (Figs. 6E and F), These results resembled the known biphasic effects of AR-V7 and other AR-Vs on LNCaP cell proliferation due to biphasic regulation of proliferation-associated genes (29, 42). Collectively, these functional data support the concept that AR-V9 may play a significant, yet previously unappreciated, role in promoting androgen-independent growth of CRPC cells.

19



Discussion RNA-seq analysis has revealed that multiple AR-Vs are expressed in clinical prostate cancer (16, 17). Among these, AR-V7 is the best-characterized due to frequent detection of the AR exon 3/CE3 splice junction by RNA-seq and RT-PCR (12, 13, 15-17), high expression of exon CE3 measured by RNA-ISH (20, 25, 43), and availability of AR-V7-specific antibodies to interrogate protein expression in tissues (19, 44, 45). In this study, we found that AR-V9 is frequently co-expressed with AR-V7 in CRPC cell lines, PDX tissue, circulating tumor cells, and biopsies of metastatic CRPC. Further, our work with 22Rv1 and VCaP cell lines and LuCaP 35CR PDX tissue revealed that both of these AR-V species contain the entirety of AR exon CE3 nucleotide sequence at their extreme 3’ termini, with AR-V9 mRNA being approximately 1.1 kb longer due to the extended 3’ untranslated region. Analysis of additional samples will be required to conclude whether AR-V9 transcripts always contain this large 3’ untranslated region encompassing CE3.

Our study revealed that high pre-therapy AR-V9 mRNA expression in CRPC metastases was correlated with primary resistance to abiraterone acetate. Limitations include the relatively small patient cohort, use of a 12-week composite PFS endpoint, and exploratory nature of using posthoc cutoffs to define low/high AR-V9 expression. Nevertheless, this finding appears to be aligned with previous RNA-seq studies showing that AR-V9 expression in prostate cancer tissues is highly enriched in CRPC. For example, in The Cancer Genome Atlas (TCGA) study of localized, hormone naïve localized prostate cancer tissue, AR-V9 was detectable in less than 10% of specimens (16, 17). However, in the AACR-PCF Stand-Up-To-Cancer study of CRPC metastases, AR-V9 was expressed in over 75% of specimens (17) In these same studies, AR-

20



V7 expression was detected in over half of therapy naïve localized prostate cancer and nearly all metastatic CRPC (16, 17).

In circulating tumor cells or plasma, AR-V7 mRNA or protein expression is detectable at frequencies ranging from 3-100% depending on treatment history and detection platform (19, 20, 22-24, 26, 27, 46). Moreover, detection of AR-V7 mRNA expression in these blood-based studies was correlated with resistance to therapy with abiraterone or enzalutamide but not taxane chemotherapy (19, 20, 24, 26, 27, 46). Considering these extensive data supporting AR-V7 as a predictive circulating biomarker, it is not clear why high levels of pre-therapy AR-V7 expression in CRPC metastases were not significantly correlated with primary resistance to abiraterone in multivariate analysis. It will be important for future studies to address differences in predictive capacity of AR-V7 signals obtained from blood versus tissues (47).

The newly-annotated features of AR-V7 and AR-V9 transcripts arising from our study have importance for design and interpretation of biomarker assays. For example, signals from RNAISH assays with probes complementary to AR exon CE3 have been utilized to assess AR-V7 mRNA levels in prostate cancer tissues (20, 25, 43). Our data indicate these RNA-ISH signals would represent a composite of AR-V7 and/or AR-V9. Second, our work may provide insight into discordant reports of correlations between AR-V7 mRNA levels in prostatectomy specimens and risk of biochemical recurrence (12, 18). One study supporting a correlation utilized RT-PCR with primers flanking the AR exon 3/CE3 splice junction (12) whereas a study finding no correlation utilized a branched DNA assay with probes targeting a broader region of exon CE3 that may not have discriminated between AR-V7 and AR-V9 (18). It should also be noted that

21



the longer transcript length of AR-V9 relative to AR-V7 could bias reverse transcription reactions utilizing oligo(dT) primers, favoring more efficient detection of AR-V7.

Our findings also have importance for interpreting the functional roles of AR-Vs in prostate cancer. For example, the functional importance of endogenous AR-V7 as a main driver of resistance to AR-targeted therapies has been established with siRNAs targeted to exon CE3 in cell line models such as 22Rv1, CWR-R1, and VCaP (10, 29-31). The main conclusions from these knock-down experiments were that AR-V7 was sufficient to support constitutive transcriptional activation of AR target genes, androgen-independent proliferation, and insensitivity to antiandrogens (10, 29-31). Because our data establish that siRNAs targeted to AR exon CE3 also inhibit expression of AR-V9, it remains unclear whether endogenous AR-V7 is an independent effector of resistance, or requires functional cooperation with AR-V9. Given that AR-Vs require dimerization to support chromatin binding and transcriptional activation of target genes (48-50), it is possible that AR-V7 homodimers, AR-V9 homodimers, and ARV7:AR-V9 heterodimers are all engaged with chromatin in CRPC cells under conditions of fulllength AR inhibition.

In summary, this study used complementary short- and long-read RNA sequencing technologies to identify a common shared 3’ terminal exon as the molecular basis for frequent AR-V7 and AR-V9 co-expression in CRPC. Since AR-V7 and AR-V9 proteins are both constitutively active, the overall levels and functional impact of AR-Vs in prostate cancer may be greater than would be anticipated from analyses of either AR-V alone. Additional studies are warranted to test predictive capacity of AR-V9 in larger cohorts and investigate whether specific targeting of ARV9 in addition to AR-V7 may be needed to overcome drug resistance. 22



Acknowledgements We thank all patients who participated in this study for their selfless contribution in bringing precision medicine to future advanced prostate cancer patients. We appreciate the support of family members as well. We gratefully acknowledge the recruitment efforts of the following physicians who made patient referrals to the PROMOTE program: Sandeep Basu (Mayo Clinic Health Systems), Daniel Burns (Mayo Clinic Health Systems), Kevin Cockerill (Mayo Clinic Health Systems), Alan H. Bryce (Mayo Clinic, Arizona), Sarah Kratz (Mayo Clinic Health Systems), Mohammad Ranginwala (Mayo Clinic Health Systems), Amrit Singh (Mayo Clinic Health Systems), Gautam Jha (University of Minnesota), Badrinath Konety (University of Minnesota), Mir Ali Khan (CGH Medical Center), Ferdinand Addo (Prairie Lakes Healthcare System), Kevin Panico (Altru Health System), and Laura Joque (Essentia Health Brainerd Clinic). We also acknowledge the University of Wisconsin Carbone Cancer Center genitourinary clinical research group. Other contributing groups include the Mayo Clinic Cancer Center, the Pharmacogenomics Research Network (PGRN), A.T. Suharya and Ghan D.H., Joseph and Gail Gassner, Mayo Clinic Schulze Center for Novel Therapeutics in Cancer Research, and the Apogee Enterprises Chair in Cancer Research (to S.M.D.). Janssen Research & Development, LLC provided drug support for patients 45-92 in the PROMOTE trial, and funding support for bioinformatics analysis. We acknowledge the Minnesota Supercomputing Institute for computational resources, storage and systems administration.

23



References 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin 2016;66:7-30. 2. Knudsen KE, Scher HI. Starving the addiction: new opportunities for durable suppression of AR signaling in prostate cancer. Clin Cancer Res 2009;15:4792-8. 3. Shen MM, Abate-Shen C. Molecular genetics of prostate cancer: new prospects for old challenges. Genes Dev 2010;24:1967-2000. 4. Beer TM, Armstrong AJ, Rathkopf DE, Loriot Y, Sternberg CN, Higano CS, et al. Enzalutamide in metastatic prostate cancer before chemotherapy. N Engl J Med 2014;371:424-33. 5. Ryan CJ, Smith MR, de Bono JS, Molina A, Logothetis CJ, de Souza P, et al. Abiraterone in Metastatic Prostate Cancer without Previous Chemotherapy. N Engl J Med 2012;368:13848. 6. Logothetis CJ, Gallick GE, Maity SN, Kim J, Aparicio A, Efstathiou E, et al. Molecular classification of prostate cancer progression: foundation for marker-driven treatment of prostate cancer. Cancer discovery 2013;3:849-61. 7. Beltran H, Prandi D, Mosquera JM, Benelli M, Puca L, Cyrta J, et al. Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer. Nat Med 2016. 8. Watson PA, Arora VK, Sawyers CL. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer. Nat Rev Cancer 2015;15:701-11. 9. Dehm SM, Schmidt LJ, Heemers HV, Vessella RL, Tindall DJ. Splicing of a novel androgen receptor exon generates a constitutively active androgen receptor that mediates prostate cancer therapy resistance. Cancer Res 2008;68:5469-77. 10. Guo Z, Yang X, Sun F, Jiang R, Linn DE, Chen H, et al. A novel androgen receptor splice variant is up-regulated during prostate cancer progression and promotes androgen depletion-resistant growth. Cancer Res 2009;69:2305-13.

24



11. Henzler C, Li Y, Yang R, McBride T, Ho Y, Sprenger C, et al. Truncation and constitutive activation of the androgen receptor by diverse genomic rearrangements in prostate cancer. Nature communications 2016;7:13668. 12. Hu R, Dunn TA, Wei S, Isharwal S, Veltri RW, Humphreys E, et al. Ligand-independent androgen receptor variants derived from splicing of cryptic exons signify hormone-refractory prostate cancer. Cancer Res 2009;69:16-22. 13. Sun S, Sprenger CC, Vessella RL, Haugk K, Soriano K, Mostaghel EA, et al. Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant. J Clin Invest 2010;120:2715-30. 14. Watson PA, Chen YF, Balbas MD, Wongvipat J, Socci ND, Viale A, et al. Constitutively active androgen receptor splice variants expressed in castration-resistant prostate cancer require full-length androgen receptor. Proc Natl Acad Sci U S A 2010;107:16759-65. 15. Hornberg E, Ylitalo EB, Crnalic S, Antti H, Stattin P, Widmark A, et al. Expression of Androgen Receptor Splice Variants in Prostate Cancer Bone Metastases is Associated with Castration-Resistance and Short Survival. PLoS One 2011;6:e19059. 16. Network CGAR. The Molecular Taxonomy of Primary Prostate Cancer. Cell 2015;163:101125. 17. Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, Mosquera JM, et al. Integrative clinical genomics of advanced prostate cancer. Cell 2015;161:1215-28. 18. Zhao H, Coram MA, Nolley R, Reese SW, Young SR, Peehl DM. Transcript levels of androgen receptor variant AR-V1 or AR-V7 do not predict recurrence in patients with prostate cancer at indeterminate risk for progression. J Urol 2012;188:2158-64. 19. Antonarakis ES, Lu C, Luber B, Wang H, Chen Y, Nakazawa M, et al. Androgen Receptor Splice Variant 7 and Efficacy of Taxane Chemotherapy in Patients With Metastatic Castration-Resistant Prostate Cancer. JAMA oncology 2015;1:582-91.

25



20. Antonarakis ES, Lu C, Wang H, Luber B, Nakazawa M, Roeser JC, et al. AR-V7 and Resistance to Enzalutamide and Abiraterone in Prostate Cancer. N Engl J Med 2014;371:1028-38. 21. Bernemann C, Schnoeller TJ, Luedeke M, Steinestel K, Boegemann M, Schrader AJ, et al. Expression of AR-V7 in Circulating Tumour Cells Does Not Preclude Response to Next Generation Androgen Deprivation Therapy in Patients with Castration Resistant Prostate Cancer. Eur Urol 2016. 22. Miyamoto DT, Zheng Y, Wittner BS, Lee RJ, Zhu H, Broderick KT, et al. RNA-Seq of single prostate CTCs implicates noncanonical Wnt signaling in antiandrogen resistance. Science 2015;349:1351-6. 23. Nakazawa M, Lu C, Chen Y, Paller CJ, Carducci MA, Eisenberger MA, et al. Serial bloodbased analysis of AR-V7 in men with advanced prostate cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO 2015;26:1859-65. 24. Onstenk W, Sieuwerts AM, Kraan J, Van M, Nieuweboer AJ, Mathijssen RH, et al. Efficacy of Cabazitaxel in Castration-resistant Prostate Cancer Is Independent of the Presence of AR-V7 in Circulating Tumor Cells. Eur Urol 2015;68:939-45. 25. Saylor PJ, Lee RJ, Arora KS, Deshpande V, Hu R, Olivier K, et al. Branched chain RNA in situ hybridization for androgen receptor splice variant AR-V7 as a prognostic biomarker for metastatic castration-sensitive prostate cancer. Clin Cancer Res 2016. 26. Del Re M, Biasco E, Crucitta S, Derosa L, Rofi E, Orlandini C, et al. The Detection of Androgen Receptor Splice Variant 7 in Plasma-derived Exosomal RNA Strongly Predicts Resistance to Hormonal Therapy in Metastatic Prostate Cancer Patients. Eur Urol 2016. 27. Qu F, Xie W, Nakabayashi M, Zhang H, Jeong SH, Wang X, et al. Association of AR-V7 and prostate specific antigen RNA levels in blood with efficacy of abiraterone acetate and enzalutamide treatment in men with prostate cancer. Clin Cancer Res 2016.

26



28. Todenhofer T, Azad A, Stewart C, Gao J, Eigl BJ, Gleave ME, et al. AR-V7 Transcripts in Whole Blood RNA of Patients with Metastatic Castration Resistant Prostate Cancer Correlate with Response to Abiraterone Acetate. J Urol 2016. 29. Li Y, Chan SC, Brand LJ, Hwang TH, Silverstein KA, Dehm SM. Androgen receptor splice variants mediate enzalutamide resistance in castration-resistant prostate cancer cell lines. Cancer Res 2013;73:483-9. 30. Li Y, Hwang TH, Oseth L, Hauge A, Vessella RL, Schmechel SC, et al. AR intragenic deletions linked to androgen receptor splice variant expression and activity in models of prostate cancer progression. Oncogene 2012;31:4759-67. 31. Yu Z, Chen S, Sowalsky AG, Voznesensky O, Mostaghel EA, Nelson PS, et al. Rapid Induction of Androgen Receptor Splice Variants by Androgen Deprivation in Prostate Cancer. Clin Cancer Res 2014;20:1590-600. 32. Sharon D, Tilgner H, Grubert F, Snyder M. A single-molecule long-read survey of the human transcriptome. Nat Biotechnol 2013;31:1009-14. 33. Hu R, Isaacs WB, Luo J. A snapshot of the expression signature of androgen receptor splicing variants and their distinctive transcriptional activities. Prostate 2011. 34. Morrissey C, Roudier MP, Dowell A, True LD, Ketchanji M, Welty C, et al. Effects of androgen deprivation therapy and bisphosphonate treatment on bone in patients with metastatic castration-resistant prostate cancer: results from the University of Washington Rapid Autopsy Series. J Bone Miner Res 2013;28:333-40. 35. Young SR, Saar M, Santos J, Nguyen HM, Vessella RL, Peehl DM. Establishment and serial passage of cell cultures derived from LuCaP xenografts. Prostate 2013;73:1251-62. 36. Sperger JM, Strotman LN, Welsh A, Casavant BP, Chalmers Z, Horn S, et al. Integrated analysis of multiple biomarkers from circulating tumor cells enabled by exclusion-based analyte isolation. Clin Cancer Res 2016.

27



37. Gregory CW, Johnson RT, Jr., Mohler JL, French FS, Wilson EM. Androgen receptor stabilization in recurrent prostate cancer is associated with hypersensitivity to low androgen. Cancer Res 2001;61:2892-8. 38. Scher HI, Halabi S, Tannock I, Morris M, Sternberg CN, Carducci MA, et al. Design and end points of clinical trials for patients with progressive prostate cancer and castrate levels of testosterone: recommendations of the Prostate Cancer Clinical Trials Working Group. J Clin Oncol 2008;26:1148-59. 39. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 2009;25:1105-11. 40. Li Y, Alsagabi M, Fan D, Bova GS, Tewfik AH, Dehm SM. Intragenic rearrangement and altered RNA splicing of the androgen receptor in a cell-based model of prostate cancer progression. Cancer Res 2011;71:2108-17. 41. Hu R, Lu C, Mostaghel EA, Yegnasubramanian S, Gurel M, Tannahill C, et al. Distinct transcriptional programs mediated by the ligand-dependent full-length androgen receptor and its splice variants in castration-resistant prostate cancer. Cancer Res 2012;72:3457-62. 42. Chan SC, Li Y, Dehm SM. Androgen receptor splice variants activate AR target genes and support aberrant prostate cancer cell growth independent of the canonical AR nuclear localization signal. J Biol Chem 2012;287:19736-49. 43. Guedes LB, Morais CL, Almutairi F, Haffner MC, Zheng Q, Isaacs JT, et al. Analytic Validation of RNA In Situ Hybridization (RISH) for AR and AR-V7 Expression in Human Prostate Cancer. Clin Cancer Res 2016;22:4651-63. 44. Qu Y, Dai B, Ye D, Kong Y, Chang K, Jia Z, et al. Constitutively active AR-V7 plays an essential role in the development and progression of castration-resistant prostate cancer. Scientific reports 2015;5:7654. 45. Welti J, Rodrigues DN, Sharp A, Sun S, Lorente D, Riisnaes R, et al. Analytical Validation and Clinical Qualification of a New Immunohistochemical Assay for Androgen Receptor 28



Splice Variant-7 Protein Expression in Metastatic Castration-resistant Prostate Cancer. Eur Urol 2016. 46. Scher HI, Lu D, Schreiber NA, Louw J, Graf RP, Vargas HA, et al. Association of AR-V7 on Circulating Tumor Cells as a Treatment-Specific Biomarker With Outcomes and Survival in Castration-Resistant Prostate Cancer. JAMA oncology 2016. 47. Daniel M, Dehm SM. Lessons from tissue compartment-specific analysis of androgen receptor alterations in prostate cancer. J Steroid Biochem Mol Biol 2016. 48. Chan SC, Selth LA, Li Y, Nyquist MD, Miao L, Bradner JE, et al. Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies. Nucleic Acids Res 2015;43:5880-97. 49. Xu D, Zhan Y, Qi Y, Cao B, Bai S, Xu W, et al. Androgen Receptor Splice Variants Dimerize to Transactivate Target Genes. Cancer Res 2015;75:3663-71. 50. Zhan Y, Zhang G, Wang X, Qi Y, Li D, Bai S, et al. Interplay Between Cytoplasmic and Nuclear Androgen Receptor Splice Variants Mediate Castration Resistance. Mol Cancer Res 2016.

29



Figure Legends Figure 1. Deep sequencing of AR RNA in castration-resistant prostate cancer. (A) Illumina RNA-seq read coverage along discrete regions of the AR gene in the 22Rv1 cell line. Split RNA-seq reads spanning the exon 3/CE5, 3/CE3, and 3/4 splice junctions were quantified to infer expression of AR-V9, AR-V7, and full-length AR, respectively. (B) Schematic depicting the relationship between AR and AR-V mRNA species and modular domains in AR and AR-V proteins. NTD, amino terminal domain; DBD, DNA binding domain; LBD, ligand binding domain. (C) RNA-seq read coverage within intron 3 of the AR gene in the CWR-R1 cell line. Split RNA-seq reads spanning the exon 3/CE5, 3/CE3, and 3/4 splice junctions were quantified to infer expression of AR-V9, AR-V7, and full-length AR, respectively. (D) RNA-seq read coverage within intron 3 of the AR gene in the LuCaP 147 patient derived xenograft (PDX) and a liver metastasis isolated from rapid autopsy. Split RNA-seq reads spanning the exon 3/CE5 and 3/CE3 splice junctions were quantified to infer expression of AR-V9 and AR-V7, respectively.

Figure 2. Single Molecule Real Time (SMRT) sequencing of AR isoforms in castrationresistant prostate cancer. (A) Schematic of AR gene structure in 22Rv1 cells, which harbor a 35kb AR intragenic tandem duplication (tdup). Discrete exons expressed in AR mRNAs sequenced using Pacific Biosciences single molecule, real-time (SMRT) sequencing are illustrated. Black exons represent AR exons 1-8 (canonical exons), gray exons represent known AR cryptic exons (annotated cryptic exons), and white exons represent new AR exons discovered by SMRT sequencing (PacBio 22Rv1 exons). (B) Exon composition and quantification of the 20 most abundant AR transcripts isolated from 22Rv1 cells by 3’ rapid amplification of cDNA ends (RACE) using a forward primer anchored in AR exon 1. Individual

30



pixels represent discrete exons contained in individual AR transcripts. Pixel colors indicate whether that exon was spliced via both annotated 5’ and 3’ splice sites, the annotated 5’ splice site only, the annotated 3’ splice site only, or neither the annotated 5’ nor 3’ splice sites. Read counts represent the number of single molecule transcripts sequenced that matched the indicated splicing pattern. AR transcripts were inspected manually for predicted translation, and assigned names based on a previous classification system. AR transcripts that had not been identified previously were classified as novel. Asterisks denote transcripts harboring tandem copies of exon 3. (C) Exon composition and quantification of the 20 most abundant AR transcripts isolated from 22Rv1 cells by 3’ RACE using a forward primer anchored in AR exon 3. Data were visualized as described in (B). (D) Schematic of AR gene structure downstream from exon 3 in LuCaP 35 CR patient-derived xenograft tissue. Discrete exons expressed in AR mRNAs sequenced by long-read SMRT sequencing are illustrated. Black exons represent AR exons 3-8 (canonical exons), gray exons represent known AR cryptic exons (annotated cryptic exons), and white exons represent new AR exons discovered by SMRT sequencing (LuCaP 35CR exons). (E) Exon composition and quantification of the 10 most abundant AR transcripts isolated from LuCaP 35 CR tissue by 3’ RACE using a forward primer anchored in AR exon 3. Data were visualized as described in (B).

Figure 3. Co-expression of AR-V9 and AR-V7 mRNA in clinical castration-resistant prostate cancer. (A) Expression of AR-V9 and AR-V7 mRNA in publicly-available Illumina RNA-seq data from 56 AR-positive samples in a biopsy study of CRPC metastases (dbGaP study phs000915.v1.p1, Stand Up To Cancer East Coast Prostate Cancer Research Group). (B) Expression of AR-V9 and AR-V7 mRNA in circulating tumor cells from 12 patients. mRNA was isolated from EPCAM-positive cells isolated from 15 mL of blood. mRNA was analyzed by RT-PCR for expression of AR, AR-V7, AR-V9, AR target genes (KLK2, KLK3, TMPRSS2, 31



PMSA, NKX3.1), the prostate cancer- specific PTPRC gene, and a housekeeping control (RPLOPO). Results from quantitative RT-PCR are presented as heat map of Ct values. For each patient, serum PSA, sites of metastasis (Bn, bone; Br, brain; Liv, liver), disease status, and previous treatment(s) are indicated at the time of the blood draw.

Figure 4. AR-V7 and AR-V9 contain overlap in 3’ untranslated regions. (A) Model for splicing of AR-V9 and AR-V7 derived from analysis of long-read sequence data. The model proposes that AR-V9 and AR-V7 originate from splicing of a common 3’ terminal cryptic exon harboring two splice acceptor sites. (B) 22Rv1 and VCaP cells were transfected with a control (ctrl) siRNA and individual siRNAs targeting previously-annotated AR exons CE3 and CE5 as indicated. RNA isolated from transfected cells were subjected to RT-PCR with primers designed to interrogate the AR exon 3/CE3, 3/CE5, and 3/4 splice junctions as indicated. Bars represent mean and whiskers represent s.d. from 2 independent experiments, one of which was performed in duplicate and one of which was performed in triplicate (n=5). Data were transformed using the differential threshold cycle of amplification (ddCt) method, with expression levels in cells transfected with ctrl siRNA arbitrarily set to 1. (C) Schematic of AR-V9 and AR-V7 proteins consisting of identical NH2-terminal domains (NTD) and DNA binding domains (DBD), but unique carboxyl-terminal extensions. Asterisks indicate translation termination. (D) 22Rv1 and VCaP cells were transfected with a control (ctrl) siRNA or siRNAs targeting previously-annotated AR exons CE3 and CE5 as indicated. Cell lysates were subjected to immunoprecipitation with rabbit (control for AR-V9) or mouse (control for AR-V7) IgG, polyclonal rabbit antisera raised to the unique AR-V9 carboxyl-terminal peptide, or a mouse monoclonal antibody specific for the unique AR-V7 carboxyl-terminal peptide. Immunoprecipitated complexes were subjected to western blot with a mouse monoclonal antibody specific for the AR NTD. 32



Figure 5. High AR-V9 expression in metastatic tissues is associated with disease progression during therapy with abiraterone acetate. (A) CONSORT flow diagram of patients enrolled in PROMOTE. (B) Expression of AR-V7 and AR-V9 in 78 baseline biopsy specimens collected in a prospective clinical trial of patients initiating therapy with abiraterone acetate. Data points are shaded based on the result of each patient’s composite progression free survival (PFS) assessment performed 12-weeks post-therapy. (C) Number of samples characterized as AR-V9-high/AR-V7 high, AR-V9-high/AR-V7-low, AR-V9-low/AR-V7-high, and AR-V9-low-AR-V7-low based on cutoffs imposed at top quartiles. (D) Univariate logistic regression analysis testing associations of molecular and clinical variables collected at baseline with a 12-week composite PFS endpoint. CgA, chromogranin A; Met, metastatic; PSA, prostate specific antigen; T, testosterone.

Figure 6. AR-V9 functions as a constitutively active transcription factor independent of full-length AR. (A and B) AR-positive LNCaP prostate cancer cells were transfected with a PSA-driven luciferase reporter and expression vectors encoding AR-Vs as indicated. Cells were treated with dihydrotestosterone (DHT), enzalutamide (enz), or vehicle controls (ethanol as control for DHT, dimethyl sulfoxide as control for enz) as indicated and subjected to (A) western blot with antibodies specific for the AR NTD or ERK-2 (loading control) or (B), luciferase assay. Luciferase activities are expressed relative to the activity of vehicle-treated LNCaP cells transfected with PSA-luciferase and SV40-Renilla only, which was arbitrarily set to 1. Bars represent mean and whiskers represent s.e.m. from 2 independent experiments, each of which was performed in triplicate (n=6). (C and D) AR-negative DU145 prostate cancer cells were transfected with an androgen response element (ARE)-driven luciferase reporter and expression vectors encoding AR-Vs as indicated. Cells were treated and subjected to (C) western blot with antibodies specific for the AR NTD or ERK-2 (loading control) or (D), luciferase 33



assay. Luciferase activities are expressed relative to the activity of vehicle-treated LNCaP cells transfected with 4XARE-luciferase and SV40-Renilla only, which was arbitrarily set to 1. Bars represent mean and whiskers represent s.e.m. from 2 independent experiments, each of which was performed in triplicate (n=6). (E and F) LNCaP cells were infected with a range of titers of lentivirus encoding GFP (control) or AR-V9 and subjected to (E) western blot with antibodies specific to the AR NTD or ERK-2 (loading control), or (F) and assayed for proliferation by BrdU incorporation assay. Data represent mean +/- s.e.m. from three biological replicate experiments, each performed in triplicate (n=9).

34


Downloaded from clincancerres.aacrjournals.org on November 2, 2017. © 2017 American Associa Research.







Downloaded from clincancerres.aacrjournals.org on November 2, 2017. © 2017 American Associa Research.

Downloaded from clincancerres.aacrjournals.org on Novembe Research.


Androgen receptor variant AR-V9 is co-expressed with AR-V7 in prostate cancer metastases and predicts abiraterone resistance Manish Kohli, Yeung Ho, David W Hillman, et al. Clin Cancer Res Published OnlineFirst May 4, 2017.

Updated version Supplementary Material Author Manuscript

E-mail alerts Reprints and Subscriptions Permissions

Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-17-0017 Access the most recent supplemental material at: http://clincancerres.aacrjournals.org/content/suppl/2017/05/03/1078-0432.CCR-17-0017.DC1 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected].
