RADIATION RESEARCH
165, 546–552 (2006)
0033-7587/06 $15.00 q 2006 by Radiation Research Society. All rights of reproduction in any form reserved.
Angelica sinensis Down-regulates Hydroxyproline and Tgfb1 and Provides Protection in Mice with Radiation-Induced Pulmonary Fibrosis Guang Han, Yun Feng Zhou,1,2 Ming Sheng Zhang, Zhen Cao, Cong Hua Xie, Fu Xiang Zhou, Min Peng and Wen Jie Zhang1 Department of Radio-Chemotherapy, Zhongnan Hospital and Cancer Research Center, Wuhan University, Wuhan, HB 430071, China
to improve the treatment of lung and esophageal cancer (3– 5), because the prevention and treatment of radiation-induced pulmonary fibrosis have long been a clinical challenge in radiotherapy of thoracic malignancies. There is no consensus on the incidence of clinically significant pulmonary fibrosis, which may occur independent of overt pneumonitis (6). The risk of radiation-induced pulmonary fibrosis may increase with increasing radiation dose and irradiated volume and when radiotherapy is combined with chemotherapy. Thus far, the mechanism(s) underlying the pathogenesis of radiation-induced pulmonary fibrosis at the molecular and cellular levels has not been identified. TGFB1 is autoinductive and chemotactic to monocytes and macrophages and may form a positive feedback to promote the production of TGFB1 at the site of injury. TGFB1 is a potent chemoattractant for fibroblasts and stimulates the production of collagen (7, 8). It has been shown to increase extracellular matrix accumulation by inhibiting matrix degradation and to induce a premature terminal differentiation of progenitor fibroblasts into postmitotic fibrocytes. TGFB1 induces the terminal differentiation in the fibroblast/fibrocyte cell system, leading to an accumulation of postmitotic fibrocytes that are capable of enhancing collagen synthesis (9, 10). While TGFB1 has mainly anabolic functions in the fibrotic process, it exerts growth inhibitory actions on bronchiolar epithelium (11, 12). The role of TGFB1 in the formation of fibrosis has been reported in several disease processes including human pulmonary fibrosis and bleomycin-induced pulmonary fibrosis (13, 14). Administration of TGFB1 has been shown to induce fibrosis or production of connective tissue constituents both in vitro and in vivo (15, 16). Since TGFB1 has been reported to be a major contributor to fibrotic reactions in the lung tissue after irradiation (17, 18), it may serve as a useful predictive marker for radiation-induced lung fibrosis (19). Collagen, elastin and a component of complement are the proteins that contain hydroxyproline (20). Since collagen is by far the most abundant protein in the lung, comprising 60–70% of the tissue mass (21), analysis of the hydroxyproline content in lung tissues provides a reliable quantitative index for pulmonary fibrosis (22). The root of Angelica sinensis, known as Danggui in Chi-
Han, G., Zhou, Y. F., Zhang, M. S., Cao, Z., Xie, C. H., Zhou, F. X., Peng, M. and Zhang, W. J. Angelica sinensis Down-regulates Hydroxyproline and Tgfb1 and Provides Protection in Mice with Radiation-Induced Pulmonary Fibrosis. Radiat. Res. 165, 546–552 (2006). Pulmonary fibrosis is a common delayed side effect of radiation therapy, and it has a poor prognosis. Tgfb1 is a potent chemoattractant for fibroblasts and stimulates the production of collagen, the protein that contains hydroxyproline. Since collagen is by far the most abundant protein in the lung, comprising 60–70% of the tissue mass, analysis of the hydroxyproline content in lung tissues provides a reliable quantitative index for pulmonary fibrosis. Thus hydroxyproline and Tgfb1 may be involved in the development of fibrosis. In this study, we investigated radiation-induced pulmonary fibrosis in a mouse model. C57BL/6 mice were assigned into four groups: no treatment, treated with Angelica sinensis treated only, Xirradiated only (a single fraction of 12 Gy to the thorax), and Angelica sinensis treatment plus radiation. We assayed expression of hydroxyproline and the mRNA and protein of Tgfb1 in the four groups. We found that Angelica sinensis down-regulated the production of Tgfb1 and hydroxyproline in mice with radiation-induced pulmonary fibrosis. This study has demonstrated for the first time that Angelica sinensis inhibits the progress of radiation-induced pulmonary fibrosis, possibly by down-regulating the expression of the proinflammatory cytokine Tgfb1. These data suggest that Angelica sinensis may be useful in preventing and/or treating radiationinduced pulmonary fibrosis in the clinic. q 2006 by Radiation Research Society
INTRODUCTION
Radiotherapy is frequently used for treating thoracic malignancies (1). However, radiation-induced pulmonary fibrosis can be a serious complication and may cause severe respiratory distress and sometimes even death (2). Intensive strategies and dose escalation trials are under investigation These authors share senior authorship. Address for correspondence: Department of Radio-Chemotherapy, Zhongnan Hospital, Wuhan University, 169 Dong Hu Road, Wuhan, Hubei 430071, China; e-mail:
[email protected]. 1 2
546
ANGELICA SINENSIS DOWN-REGULATES HYDROXYPROLINE AND Tgfb1
nese, is a popular traditional medicine that is widely used in China for gynecological diseases with clinical efficacy (23). Extracts and compounds purified from Angelica sinensis roots increase myocardial blood flow and reduce radiation-induced tissue damages (24–26). As an empirical practice in recent years, Angelica sinensis has been used in treating cancer patients with radiation-induced pneumonitis and has shown clinical efficacy with little or no toxicity (27). However, it is not known what molecular mechanism(s) may be involved in the clinical efficacy of Angelica sinensis in treating radiation-induced pneumonitis. Using an irradiated mouse model, we have investigated whether Angelica sinensis attenuates radiation-induced pulmonary fibrosis by regulating the expression of Tgfb1 and hydroxyproline, which are suggested to be involved in the promotion and/or development of pulmonary fibrosis. MATERIALS AND METHODS Animals C57BL/6 mice were purchased from Sino-British Sippr/BK Laboratory Animals Ltd. (Shanghai, China). Eight-week-old female mice (approximately 20 g each) were divided into four study groups: (1) no treatment (18 mice); (2) Angelica sinensis treatment (18 mice); (3) radiation (54 mice); and (4) Angelica sinensis plus radiation (54 mice). Angelica sinensis extract (25%, pharmaceutical reagent for human use provided by Zhongnan Hospital, Wuhan University College of Medicine, Wuhan, China) was administered daily i.p. (0.2 ml/10 g day21) in a single injection to the Angelica sinensis and Angelica sinensis/irradiated groups. Mice in the no treatment and irradiated groups received the same volume of 0.9% sodium chloride. The injections were initiated 1 week before thoracic irradiation and continued daily for 2 weeks after irradiation.
547
Tissue Preparation Mice were killed at each time and the lungs were immediately removed after death without perfusion. The left lobes were used for histological, histochemical and hydroxyproline content analyses, and the right lobes were quickly frozen in liquid nitrogen until RNA isolation. Histology Paraffin-embedded tissues were sectioned at an average thickness of 5 mm and stained using Masson stain for collagen. Immunohistochemistry Streptavidin-peroxidase methodology was used for quantifying Tgfb1 protein expression. Anti-mouse Tgfb1 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and goat anti-rabbit secondary antibody was from Maixin Biotechnology (Fuzhou, China). To ensure objectivity, a standardized scoring procedure was established and immunohistochemistry slides were subjected to blinded evaluation by two investigators. The means were used consistently throughout the study, in which 10 representative, non-contiguous and non-overlapping fields (magnification 2003) were systematically selected and analyzed. After an initial qualitative assessment of morphological changes, the types of cells positive for Tgfb1 antibody staining were recorded. Positive cells from 10 microscopic fields were used to calculate the arithmetic means and results were expressed as the average number of cells per field. Hydroxyproline Determination The samples of lung tissue were stored at 2808C until analysis. To measure the content of hydroxyproline in lung tissue, Alkaline Hydrolysis Assay Kits (29) from Jiancheng biological institution (Nanjing, China) were used according to the instructions provided with the kits. The quantity of hydroxyproline was determined based on the following formula: content of hydroxyproline (mg/mg, wet weight) 5 [absorbance(sample) 2 absorbance(blank)]/[absorbance(standard) 2 absorbance (blank)] 3 5 mg/ml 3 10 ml/wet weight(tissue). RT-PCR Analysis
Radiation Schedule All mice underwent actual (radiation and Angelica sinensis/irradiated groups) or sham irradiation (no treatment and Angelica sinensis groups). A dose of 12 Gy to the midplane of the lungs was given in a single fraction at posterior field using a linear accelerator (Siemens Primus-Hi). A plastic jig was used to restrain the mice without anesthesia, and lead blocks were placed to shield the head and abdomen. The characteristics of the radiation were as follows: beam energy, 6 MV photons; dose rate, 2 Gy/min; source–surface distance, 1 m; size of the radiation field, 10 cm 3 10 cm. A source film was taken to ensure full exposure of the lung. Film dosimetry was used to determine the relative dose distribution. Dosimetry was performed with a cylindrical ionization chamber. The depth of the maximum dose of the 6 MV photon beam could be significantly reduced by the tissue-equivalent plastic material (thickness 23 mm) of the restraining jig. Therefore the build-up region of the 6 MV photon beam was located in the plastic material, resulting in an acceptable dose uniformity throughout the thorax of each mouse. After irradiation, mice in all four groups were maintained in a specificpathogen-free (SPF) environment and supplied with standard diet and water. Treated and control mice were killed humanely by cervical dislocation at 1, 24 and 72 h and 1, 2, 4, 8, 16 and 24 weeks postirradiation. For each treatment modality and time, the irradiated and Angelica sinensis/irradiated groups contained six mice/group; the no treatment and Angelica sinensis groups served as the respective controls (n 5 4) (28). The experimental protocols were approved by the Medical Sciences Animal Care Committee of Hubei province, China.
RNA extraction. Total RNA preparations were performed using the TRIZOL Reagent (Invitrogen, Carlsbad, CA). RNA integrity was assessed using denaturing agarose gel electrophoresis. cDNA synthesis. First-strand cDNA was synthesized using a SuperScripty First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad) according to the manufacturer’s protocol. Real-time quantitative reverse transcriptase PCR (RT-PCR). RT-PCR was performed based on previous reports (30, 31) with modifications. PCR primers and probes for murine Tgfb1 and the housekeeping gene Gapd were designed by CASarray Co., Ltd (Shanghai) based on cDNA sequences obtained from the GenBank database (Table 1). RT-PCR amplifications were performed using the LightCycle-FastStart DNA Master Hybridization Probes kit (Roche, Basel, Switzerland) on a Rotor-Gene sequence detector (Corbett Research, Sydney, Australia). For reproducibility within and between PCR amplifications, we used a standard normal cDNA in each PCR amplification. Relative mRNA expression of test cDNA samples was referenced to the standard cDNA and expressed as the ratio of the level of the test mRNA compared to the base mRNA. For example, a relevant mRNA expression (E) 5 [mRNA(test)/Gapd(test)]/ [mRNA(base)/Gapd(base)]. Statistical Analyses Statistical analysis was performed with the SPSS software package (version 11.5) for Windows. All data are expressed as means 6 SD. Comparison of the data among the groups was performed with repeated measures ANOVA (LSD and S-N-K test), and the data for the various
548
HAN ET AL.
TABLE 1 Primer and Probe Sequences for Murine Tgfb1 and Gapd Sequences (59 → 39)
Name Tgfb1 FW Tgfb1 RV Tgfb1 FP Gapd FW Gapd RV Gapd FP
a
a
TGACGTCACTGGAGTTGTACGG GGTTCATGTCATGGATGGTGC TTCAGCGCTCACTGCTCTTGTGACAG TCACCACCATGGAGAAGGC GCTAAGCAGTTGGTGGTGCA ATGCCCCCATGTTTGTGATGGGTGT
Amplicon length 170
168
FW, forward primer; RV, reverse primer; FP, fluorogenic probe, dual-labeled with 59FAM and 39TAMRA.
times were analyzed with Fisher’s exact test. A value of P , 0.05 was considered statistically significant.
RESULTS
Visual Observation The fur on the thoracic area of the mice started to lose color at 4 weeks after irradiation and was completely white at 8 weeks postirradiation. The lungs of the mice in each group were removed and observed at 1, 2, 4, 8, 16 and 24 weeks. At 24 weeks, the lung volumes of the irradiated group had decreased significantly, and the lungs had become dark gray in color. However, the lungs of the Angelica sinensis/irradiated group were similar to those of control mice (no treatment and Angelica sinensis) in both volume and color. Histology Histopathological alterations of radiation-induced lung injury in our experimental mice included edema in the alveolar wall and/or air spaces, desquamation of epithelial cells from the alveolar walls, thickening of the alveoli septa by infiltration of inflammatory cells, collagen deposition, progressive fibrosis of alveolar septa, and obliteration of the alveoli. In this strain of mice, the irradiated group had
larger and greater numbers of focal areas with increased collagen deposition than did the Angelica sinensis/irradiated group, especially between 16 and 24 weeks. In contrast, lungs from control mice in the no treatment and Angelica sinensis groups for the same times were essentially the same and showed no evidence of pulmonary fibrous degeneration or other significant histopathological changes (Fig. 1). Immunohistochemistry The staining patterns of Tgfb1 in lung tissues are shown in Fig. 2. Increased cytokine expression was detected prominently in lungs with histopathological injury after irradiation. At 1 week after irradiation, the irradiated group showed more severe interstitial edema in the alveolar wall and/or air spaces than the Angelica sinensis/irradiated group (Fig. 2). Cells positive for Tgfb1 in the septal walls were seen as early as 1 h (Fig. 3). At the later times (16 and 24 weeks postirradiation), type II pneumocytes and fibroblasts may have served as important sources of Tgfb1 expression. By week 24, there was evidence of interstitial fibrosis with accumulation of elastic fibers, deposition of collagen, and, consequently, destruction of normal tissue architecture (Fig. 1). Differences between experimental groups. Nonirradiated
FIG. 1. Masson staining for collagen in mouse lung tissues at 24 weeks among experimental groups receiving different treatments. Three representative slides are for no treatment (NT), irradiated (XRT) or Angelica sinensis injection prior to irradiation (AS/XRT). In the untreated mouse, the alveoli septa are normal and tissue architecture is intact without obvious collagen deposition (light blue stain). In the irradiated mouse, however, significant thickening is seen for the alveolar septa, and the structural destruction is obvious for alveoli as well as tissue architecture in general. In addition, large amounts of collagen deposits can be observed in the alveoli septa and the bronchiolar area, accompanied by cellular proliferation. It is interesting to note that for Angelica sinensis/irradiated, the pathological alteration is relatively mild with a slight thickening of the alveolar septa and the destruction of the alveoli appears minimal. Furthermore, the tissue architecture for the Angelica sinensis/irradiated mouse appears intact with few collagen deposits in the alveolar septa (light blue stain), similar to that for the untreated mouse. Original magnification 4003.
ANGELICA SINENSIS DOWN-REGULATES HYDROXYPROLINE AND Tgfb1
549
FIG. 2. Differences in immunohistochemistry stains are shown for Tgfb1 expression in mouse lung tissues for different treatments at different times. Six representative slides are shown from irradiated mice (XRT with times specified) and Angelica sinensis-treated mice prior to irradiation (AS/XRT with times specified). The pathological alterations in Angelica sinensis/irradiated mice are relatively mild with slight edema in the alveolar wall and/ or air spaces, compared with irradiated mice at 1 week (1w) after irradiation. In irradiated and Angelica sinensis/irradiated mice, the number of Tgfb1positive cells (brown stain) in the lung parenchyma varies with time. The results are summarized in Fig. 3. Original magnification 4003.
control mice in the no treatment and Angelica sinensis groups were similar and had a few cells that expressed Tgfb1 (Fig. 3). However, significantly increased numbers of Tgfb1-positive cells were seen in irradiated mice compared to the mice in the no treatment and Angelica sinensis groups (P , 0.01). The numbers of Tgfb1-positive cells in the Angelica sinensis/irradiated mice were greater than those in the no treatment and Angelica sinensis mice but were significantly less than those in the radiation-only mice (P , 0.01) (Fig. 3). The numbers of Tgfb1-positive cells in Angelica sinensis/irradiated mice were lower than those in irradiated mice at almost every time, especially at 4 weeks after irradiation (Fig. 3). Measurement of Hydroxyproline Content
FIG. 3. Time course and comparison of Tgfb1-expressing cells in lung tissues from mice receiving different treatments. Numbers of Tgfb1-expressing cells were determined from 1 h to 24 weeks (24w). The results are expressed as Tgfb1-positive cells for each mouse. The vertical bars represent mean 6 SD. For every time, the irradiated (XRT) group (n 5 6) is compared with the Angelica sinensis (AS)/XRT group (n 5 6) or the no treatment (NT) and Angelica sinensis (AS) groups (n 5 4), which served as controls. The results of statistical comparisons are: irradiated and Angelica sinensis/irradiated at 1 h, 24 h, 1 week, 2 weeks, 4 weeks, 8 weeks, 16 weeks and 24 weeks, P , 0.01; irradiated and Angelica sinensis/irradiated at 72 h, P , 0.05; irradiated and no treatment/Angelica sinensis at 1 h, 24 h, 2 weeks, 4 weeks, 8 weeks, 16 weeks and 24 weeks, P , 0.01; irradiated and no treatment/Angelica sinensis at 1 week, P , 0.05.
General measurements. Nonirradiated lung tissues from control animals (no treatment and Angelica sinensis groups) had low levels of hydroxyproline (0.78 6 0.02 mg/mg and 0.75 6 0.03 mg/mg) and showed no differences in the content of hydroxyproline (P . 0.05); however, the content of hydroxyproline in irradiated mice (0.88 6 0.01 mg/mg) was significantly higher than those in control mice of the no treatment and Angelica sinensis groups (P , 0.05), and the content of hydroxyproline in the Angelica sinensis/irradiated group (0.78 6 0.01 mg/mg) was significantly lower compared to that in the irradiated group (P , 0.05). Measurements at different times. Mice in the no treatment and Angelica sinensis groups expressed similar amounts of hydroxyproline, and no differences were observed at any
550
HAN ET AL.
FIG. 4. Time course and comparison of hydroxyproline expression in mouse lung tissues after different treatments. Hydroxyproline expression was determined from 1 h until 24 weeks (24w). The results are expressed as the amount of hydroxyproline (mg) per mg lung tissue for each mouse. The vertical bars represent means 6 SD. For every time, the irradiated (XRT) group (n 5 6) was compared with the Angelica sinensis (AS)/ XRT group (n 5 6) or no treatment (NT) and Angelica sinensis groups (n 5 4), which served as controls. The results of statistical comparisons were obtained as follows: irradiated and Angelica sinensis/irradiated at 4 weeks, 16 weeks, and 24 weeks, P , 0.05; irradiated and no treatment/ Angelica sinensis at 72 h and 16 weeks, P , 0.05; irradiated and no treatment/Angelica sinensis at 24 weeks, P , 0.01.
of the times examined (P . 0.05). However, the mice in the irradiated and Angelica sinensis/irradiated groups expressed significantly increased amounts of hydroxyproline at 16 (P , 0.05) and 24 weeks (P , 0.01), respectively (Fig. 4), compared to mice in the no treatment/Angelica sinensis control groups. RT-PCR Analyses Real-time quantitative RT-PCR was used to measure the relative mRNA expression of Tgfb1 as follows: Analysis of general tendency. Nonirradiated lung tissues of control mice (no treatment and Angelica sinensis groups) exhibited low levels of Tgfb1 expression (relative mRNA expression: 1.32 6 0.06 and 1.25 6 0.06, respectively), with no significant differences (P . 0.05). Significantly higher levels of Tgfb1 were seen in irradiated mice (250. 1 6 16) than in those in the no treatment and Angelica sinensis mice (P , 0.01). The Angelica sinensis/irradiated mice (108 6 10) had significantly lower Tgfb1 levels compared to those exposed to radiation alone (irradiated group) (P , 0.01). Analysis for each time. The no treatment and Angelica sinensis groups showed no differences at any time (P . 0.05). The relative mRNA expression of Tgfb1 in the irradiated group was significantly greater than that in the no treatment and Angelica sinensis control groups at each time (P , 0.01). Tgfb1 expression in the Angelica sinensis/irradiated group was lower than that in the irradiated group at every time except 1 h postirradiation (P , 0.05) (Fig. 5).
FIG. 5. Time course and comparison of Tgfb1 mRNA expression in mouse lung tissues after different treatments. Tgfb1 mRNA expression was determined from 1 h until 24 weeks (24w). The results are expressed as the ratio of Tgfb1 mRNA to Gapd mRNA for each mouse (see the Materials and Methods). The vertical bars represent mean 6 SD. For every time, the irradiated (XRT) group (n 5 6) was compared with the Angelica sinensis (AS)/irradiated group (n 5 6) or no treatment (NT) and Angelica sinensis groups (n 5 4), which served as controls. The results of statistical comparisons were obtained as follows: irradiated and Angelica sinensis/irradiated at 24 h, 2 weeks, 4 weeks, 8 weeks, 16 weeks and 24 weeks, P , 0.01; irradiated and Angelica sinensis/irradiated at 72 h and 1 week, P , 0.05; irradiated and no treatment/Angelica sinensis at 1 h, 24 h, 72 h, 1 week, 2 weeks, 4 weeks, 8 weeks, 16 weeks and 24 weeks, P , 0.01.
These data suggest that Angelica sinensis may play a down-regulatory role in the development of fibrosis in a time-dependent manner during radiation-induced lung injury. DISCUSSION
Radiation-induced pulmonary fibrosis is one of the most severe complications of thoracic radiotherapy. Collagen deposition results in localized areas of fibrosis that are visible on a chest X ray directly within the field of irradiation several months or years after radiotherapy. The clinical manifestations of radiation-induced lung fibrosis may vary depending on individual patients, including dyspnea, cough, fever, pleurisy, chest pain, hypoxia and even death if it is severe (32). The mechanism(s) producing radiationinduced pulmonary fibrosis is unclear, and little can be done when radiotherapy is the only option. Cytokines may play a role in radiation-induced lung fibrosis. Rubin et al. (18) have proposed that a perpetual cascade of cytokines in the lung tissue after irradiation may be involved in radiation-induced lung injury. As discussed previously, TGFB1 may be of particular interest because of its consistent overexpression in areas of histopathological lesions induced by radiation. In the present study, Tgfb1 was shown to be overexpressed in areas of developing fi-
ANGELICA SINENSIS DOWN-REGULATES HYDROXYPROLINE AND Tgfb1
brosis in irradiated mouse lungs. Mice exposed to radiation showed a pattern of Tgfb1 expression at late stages, with a peak at 2–4 weeks, that continued until 24 weeks (Figs. 3, 5). The persistent presence of Tgfb1 in irradiated areas suggests that Tgfb1 may play a role in the development of fibrosis, in keeping with the observations of others (13, 15, 33). TGFB1 is considered to be a potent chemoattractant for fibroblasts. It triggers the expression of extracellular matrix components in pulmonary fibroblasts and stimulates the production of collagen (10, 11). In this study, we found that the peak of the hydroxyproline content in irradiated lung tissues followed the peak of Tgfb1 expression, suggesting a causative relationship. It has traditionally been thought that collagen would initially increase at 24 weeks postirradiation (34). Our data, however, indicated an increase in hydroxyproline at week 16 in irradiated mice. Once the injury occurs, there is no effective regimen to control the formation of pulmonary fibrosis. Adrenal cortical hormones associated with antibiotics and bronchodilators are often used to treat the injury but with little effect since adrenal cortical hormones cannot stop the process of development of fibrosis once it is initiated. Prevention of the development of fibrosis after irradiation may thus be more effective. Traditional Chinese medicine such as Angelica sinensis is a potential candidate given its efficacy in treating patients with radiation-induced pneumonitis and its long history in preventive medicine (27, 35, 36, 37). There are at least seven compounds that have been isolated from Angelica sinensis (38); one, ferulic acid, may be a major component of the clinical effectiveness seen in animal models (39). Pharmacological studies have shown that Angelica sinensis extracts are able to improve local and systemic blood flow, which provides benefits in patients with ulcer, cancer and other diseases (24–26, 40). These studies may explain some if not all of the possible mechanisms that make Angelica sinensis effective in preventing or attenuating radiation-induced lung fibrosis. The present study is the first to demonstrate that Angelica sinensis is capable of attenuating the severity of radiationinduced lung fibrosis at the histopathological and molecular levels. The Angelica sinensis/irradiated mice had fewer areas with collagen deposition than the irradiated group, especially from 16 to 24 weeks. The overall lung damage and other histopathological alterations, which contribute to the pleomorphic picture of radiation fibrosis, revealed apparent differences between the two treatment modalities. In general, Angelica sinensis plays a down-regulatory role in the expression of Tgfb1 at the protein and mRNA levels. It also reduces the content of hydroxyproline in this animal model. At different times, in the irradiated group, the expression of Tgfb1 mRNA was higher than that in the control group. In irradiated mice, Tgfb1 started to increase at week 1 and peaked at week 4. However, the expression of Tgfb1 mRNA in Angelica sinensis/irradiated mice was lower than that in irradiated mice at every time, especially at
551
weeks 2 and 4. A similar expression pattern was observed for numbers of Tgfb1-positive cells. Immediately after the appearance of lung fibrosis, the levels of hydroxyproline in Angelica sinensis/irradiated mice were lower than those in irradiated mice at most times, especially at weeks 16 and 24 postirradiation. In conclusion, we have shown that Angelica sinensis is capable of inhibiting the progress of radiation-induced pulmonary fibrosis first by down-regulating the expression of Tgfb1 and then by reducing hydroxyproline deposition in this animal model. The data suggest that Angelica sinensis may at least partially prevent normal tissues from being damaged during radiotherapy. Other molecules possibly involved in radiation-induced pulmonary fibrosis, such as PDGF and ICAM1, are currently under investigation. ACKNOWLEDGMENT This work was supported by the National Natural Science Foundation of China (NSFC), grant number 30472263. Received: September 26, 2005; accepted: December 12, 2005
REFERENCES 1. F. Morgan, B. Pharm and S. N. Breit, Radiation and the lung: A reevaluation of the mechanisms mediating pulmonary injury. Int. J. Radiat. Oncol. Biol. Phys. 31, 361–369 (1995). 2. B. Movsas, T. A. Raffin, A. H. Epstein and C. J. Link, Pulmonary radiation injury. Chest 111, 1061–1076 (1997). 3. J. D. Cox, N. Azarnia, R. W. Byhardt, K. H. Shin, B. Emami and T. F. Pajak, A randomized phase I/II trial of hyperfractionated radiation therapy with total doses of 60.0 Gy to 79.2 Gy: Possible survival benefit with greater than or equal to 69.6 Gy in favorable patients with Radiation Therapy Oncology Group stage III non-smallcell lung carcinoma: Report of Radiation Therapy Oncology Group 83-11. J. Clin. Oncol. 8, 1543–1555 (1990). 4. B. Jeremic, Y. Shibamoto, L. Acimovic and L. Djuric, Randomized trial of hyperfractionated radiation therapy with or without concurrent chemotherapy for stage III non-small-cell lung cancer. J. Clin. Oncol. 13, 452–458 (1995). 5. M. Murakami, Y. Kuroda, T. Nakajima, Y. Okamoto, T. Mizowaki and F. Kusumi, Comparison between chemoradiation protocol intended for organ preservation and conventional surgery for clinical T1-T2 esophageal carcinoma. Int. J. Radiat. Oncol. Biol. Phys. 45, 277–284 (1999). 6. C. M. Roberts, E. Foulcher, J. J. Zaunders, D. H. Bryant, J. Freund, D. Cairns, R. Penny, G. W. Morgan and S. N. Breit, Radiation pneumonitis: A possible lymphocyte-mediated hypersensitivity reaction. Ann. Intern. Med. 118, 696–700 (1993). 7. J. D. Ritzenthaler, R. H. Goldstein, A. Fine and B. D. Smith, Regulation of the alpha 1 (I) collagen promoter via a transforming growth factor-beta activation element. J. Biol. Chem. 268, 13625–13631 (1993). 8. A. B. Roberts, M. B. Sporn, R. K. Assoian, J. M. Smith, N. S. Roche and L. M. Wakefield, Transforming growth factor type b: Rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc. Natl. Acad. Sci. USA 83, 4167–4171 (1986). 9. H. P. Rodemann and M. Bamberg, Cellular basis of radiation-induced fibrosis. Radiother. Oncol. 35, 83–90 (1995). 10. H. P. Rodemann, A. Binder, A. Burger, N. Gu¨ven, H. Lo¨ffler and M. Bamberg, The underlying cellular mechanism of fibrosis. Kidney Int. 49, S32–S36 (1996).
552
HAN ET AL.
11. A. Magnan, I. Frachon, B. Rain, M. Peuchmaur, G. Monti, B. Lenot, M. Fattal, G. Simonneau, P. Galanaud and D. Emilie, Transforming growth factor b in normal human lung: Preferential location in bronchial epithelial cells. Thorax 49, 789–792 (1994). 12. T. Masui, L. M. Wakefield, J. F. Lechner, M. A. LaVeck, M. B. Sporn and C. C. Harris, Type b transforming growth factor is the primary differentiation-inducing serum factor for normal human bronchial epithelial cells. Proc. Natl. Acad. Sci. USA 83, 2438–2442 (1986). 13. T. J. Broekelmann, A. H. Limper, T. V. Colby and J. A. McDonald, Transforming growth factor b1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis. Proc. Natl. Acad. Sci. USA 88, 6642–6646 (1991). 14. K. Zhang, K. C. Flanders and S. H. Phan, Cellular localization of transforming growth factor-b expression in bleomycin-induced pulmonary fibrosis. Am. J. Pathol. 147, 352–361 (1995). 15. M. S. Anscher, I. R. Crocker and R. L. Jirtle, Transforming growth factor-b1 expression in irradiated liver. Radiat. Res. 122, 77–85 (1990). 16. P. J. Sime, Z. Xing, F. L. Graham, K. G. Csaky and J. Gauldie, Adenovirus-mediated gene transfer of active transforming growth factor-b1 induces prolonged severe fibrosis in rat lungs. J. Clin. Invest. 100, 768–776 (1997). 17. P. Rubin, J. N. Finkelstein and D. Shapiro, Molecular biology mechanisms in the radiation induction of pulmonary injury syndromes: Interrelationship between the alveolar macrophage and the septal fibroblast. Int. J. Radiat. Oncol. Biol. Phys. 24, 93–101 (1992). 18. P. Rubin, C. J. Johnston, J. P. Williams, S. McDonald and J. N. Finkelstein, A perpetual cascade of cytokines post irradiation leads to pulmonary fibrosis. Int. J. Radiat. Oncol. Biol. Phys. 33, 99–109 (1995). 19. M. S. Anscher, F. M. Kong, K. Andrews, R. Clough, L. B. Marks, G. Bentel and R. L. Jirtle, Plasma transforming growth factor b1 as a predictor of radiation pneumonitis. Int. J. Radiat. Oncol. Biol. Phys. 41, 1029–1035 (1998). 20. D. J. Prockop and S. A. Udenfriend, Specific method for the analysis of hydroxyproline in tissues and urine. Anal. Biochem. 1, 228–239 (1960). 21. J. M. Seyer, E. T. Hutcheson and A. H. Kang, Collagen polymorphism in idiopathic chronic pulmonary fibrosis. J. Clin. Invest. 57, 1498–1507 (1976). 22. J. P. Kehrer, Y. C. Lee and S. M. Solem, Comparison of in vitro and in vivo rates of collagen synthesis in normal and damaged lung tissue. Exp. Lung. Res. 10, 197–201 (1986). 23. H. Yamada, H. Kiyohara, J. C. Cyong, Y. Kojima, Y. Kumazawa and Y. Otsuka, Studies on polysaccharides from Angelica acutiloba. Planta. Med. 50, 163–167 (1984). 24. S. H. Kim, S. E. Lee, H. Oh, S. R. Kim, S. T. Yee, Y. B. Yu, M. W. Byun and S. K. Jo, The radioprotective effects of Bu-Zhong-Yi-QiTang: A prescription of traditional Chinese medicine. Am. J. Chin. Med. 30, 127–137 (2002). 25. X. Wang, L. Wei, J. P. Ouyang, S. Muller, M. Gentils, G. Cauchois
26.
27.
28.
29.
30. 31.
32.
33.
34. 35.
36.
37.
38. 39.
40.
and J. F. Stoltz, Effects of an angelica extract on human erythrocyte aggregation, deformation and osmotic fragility. Clin. Hemorheol. Microcirc. 24, 201–205 (2001). F. Xie, X. Li, K. Sun, Y. Chu, H. Cao, N. Chen, W. Wang, M. Liu, W. Liu and D. Mao, An experimental study on drugs for improving blood circulation and removing blood stasis in treating mild chronic hepatic damage. J. Tradit. Chin. Med. 21, 225–231 (2001). H. B. Cai and R. C. Luo, Prevention and therapy of radiation-induced pulmonary injury with traditional Chinese medicine. J. First Mil. Med. Univ. 23, 958–960 (2003). C. E. Rube, F. Wilfert, D. Uthe, K. W. Schmid, R. Knoop, N. Willich, A. Schuck and C. Rube, Modulation of radiation induced tumour necrosis factor a (TNF-a) expression in the lung tissue by pentoxifylline. Radiother. Oncol. 64, 177–187 (2002). M. Lange and M. Malyusz, Improved determination of small amounts of free hydroxyproline in biological fluids. Clin. Chem. 40, 1735– 1738 (1994). C. A. Heid, J. Stevens, K. J. Livak and P. M. Williams, Real time quantitative PCR. Genome Res. 6, 986–994 (1996). L. Overbergh, D. Valckx, M. Waer and C. Mathieu, Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11, 305–312 (1999). A. Pines, N. Kaplinsky, D. Olchovsky, J. Rozenman and O. Frankl, Pleuro-pulmonary manifestations of systemic lupus erythematosus: Clinical features of its subgroups. Chest 88, 129–135 (1985). E. S. Yi, A. Bedoya, H. Lee, E. Chin, W. Saunders, S. J. Kim, D. Danielpour, D. G. Remick, S. Yin and T. R. Ulich, Radiation-induced lung injury in vivo: expression of transforming growth factor-b precedes fibrosis. Inflammation 20, 339–352 (1996). K. R. Trott, T. Herrmann and M. Kasper, Target cells in radiation pneumopathy. Int. J. Radiat. Oncol. Biol. Phys. 58, 463–469 (2004). C. X. Yao, Clinical analysis on shengmai injection in treating radiation pneumonia and pulmonary fibrosis. Chin. J. Radiol. Med. Prot. 24, 52–53 (2004). M. T. Hsieh, Y. T. Lin, Y. H. Lin and C. R. Wu, Radix angelica sinensis extracts ameliorate scopolamine and cycloheximide induced amnesia, but not p-chloroamphetamine-induced amnesia in rats. Am. J. Chin. Med. 28, 263–272 (2000). C. H. Xie, Y. F. Zhou, G. Peng, H. Liu, J. Chen and T. M. Xian, Modulation by Angelica sinensis the expression of tumor necrosis factor a in radiation-induced damage of the lung. Chin. J. Radiat. Oncol. 14, 59–63 (2005). X. H. Lu, J. J. Zhang, H. Liang and Y. Y. Zhao, Chemical Constituents of Angelica sinensis. J. Chin. Pharm. Sci. 13, 1–3 (2004). B. H. Wang, J. P. Ou, Yang, L. Wei, Y. M. Liu, H. Q. Zheng and S. Z. Tu, Modulation role of Angelica sinensis and ferulic acid on expression of cytokine in endothelial cell. Chin. J. Pathophys. 16, 982 (2000). W. H. Huang and C. Q. Song, Progress in research of Angelica sinensis’s chemistry and pharmacology. China J. Chin. Mater. Med. 26, 147–155 (2001).
