Annexin A2 is critical for embryo adhesiveness ... - The FASEB Journal

The FASEB Journal • Research Communication

Annexin A2 is critical for embryo adhesiveness to the human endometrium by RhoA activation through F-actin regulation Tamara Garrido-Gómez, Francisco Dominguez, Alicia Quiñonero, Carlos Estella, Felipe Vilella, Antonio Pellicer, and Carlos Simon1 Fundación IVI, Instituto Universitario IVI, Universidad de Valencia, Fundación Investigación Clínico de Valencia Instituto de Investigacion Sanitaria (INCLIVA), Valencia, Spain Annexin A2 (ANXA2) is present in vivo in the mid- and late-secretory endometria and is mainly localized in the luminal epithelium. Our aim was to evaluate its function in regulating the human implantation process. With an in vitro adhesion model, constructed to evaluate how the mouse embryo and JEG-3 spheroids attach to human endometrial epithelial cells, we demonstrated that ANXA2 inhibition significantly diminishes embryo adhesiveness. ANXA2 is also implicated in endometrial epithelial cell migration and trophoblast outgrowth. ANXA2 was seen to be linked to the RhoA/ROCK pathway and to regulate cell adhesion. We noted that ANXA2 inhibition significantly reduces active RhoA, although RhoA inactivation does not alter the ANXA2 levels. RhoA inactivation and ROCK inhibition also moderate embryo adhesiveness to endometrial epithelial cells. We corroborated that the induction of constitutively active RhoA partially reverses the effects of ANXA2 inhibition on endometrial adhesiveness. These molecules colocalize on the plasma membrane of endometrial epithelial cells, and a large proportion of ANXA2 and RhoA are colocalized in the F-actin networks. The functional effects of ANXA2 inhibition and RhoA/ROCK inactivation are associated with significant alterations in F-actin organization and its depolymerization. ANXA2 may act upstream of the RhoA/ROCK pathway by regulating F-actin remodeling and is a key factor in human endometrial adhesiveness.—Garrido-Gómez, T., Dominguez, F., Quiñonero, A., Estella, C., Vilella, F., Pellicer, A., Simon, C. Annexin A2 is critical for embryo adhesiveness to the human endometrium by RhoA activation through F-actin regulation. FASEB J. 26, 3715–3727 (2012). www.fasebj.org

ABSTRACT

Key Words: cytoskeleton 䡠 implantation 䡠 receptivity 䡠 epithelial cells

Abbreviations: ANXA2, annexin A2; hEEC, human endometrial stromal cell; HEC-1-A, human endometrial carcinoma-1 adenocarcinoma; RBD, Rho binding domain; ROCK, Rhoassociated serine/threonine protein kinase 0892-6638/12/0026-3715 © FASEB

The human reproductive function is an inefficient process and only succeeds in 30% of cycles (1). Early pregnancy losses affect 30% of initially implanted embryos (2), and this figure increases by 10% when assisted reproductive techniques are used (3). Implantation of the human embryo into the maternal endometrium is a pivotal step in establishing successful pregnancy (4). The uterine epithelium’s ability to allow blastocyst adhesion depends on the acquisition of a 2or 3-d transient functional state, referred to as receptivity (5), which is driven by ovarian steroids during the midsecretory phase of the menstrual cycle when the 5-d human embryo is ready to attach (6). Human endometrial epithelial cells (hEECs) undergo a transition from the nonreceptive to the receptive phenotype induced by a specific transcriptional program (7), which includes modifications in the plasma membrane known as plasma membrane transformation (8), primarily resulting from the disruption of the cytoskeleton (9). In addition, remodeling epithelial polarization prepares the apical pole for cell-to-cell adhesion (10). Accumulated evidence indicates the relevance of the membrane-cytoskeleton interface during human endometrial receptive status development (11–13). Specifically, annexin A2 (ANXA2) is a calcium-binding protein associated with actin filaments, which is essential for maintaining the dynamics of membranemembrane and membrane-cytoskeletal interactions (14). By following a comparative proteomic approach, our group has previously identified this protein as a major contributor to the human receptive endometrium (15). Recent data have also identified ANXA2 as a major insulin receptor substrate, which is directly linked to actin rearrangements and cell adhesion (16) and regulates cell migration (17–19). Furthermore, ANXA2 is linked to the Rho/Rho-associated serine/ 1 Correspondence: Fundacion IVI, Instituto Universitario IVI, Universidad de Valencia, C/Catedrático Agustín Escardino, 9. Paterna (Valencia) 46980, Spain. E-mail: carlos. [email protected] doi: 10.1096/fj.12-204008 This article includes supplemental data. Please visit http:// www.fasebj.org to obtain this information.

3715

threonine protein kinase (ROCK) pathway and regulates the actin-mediated changes associated with cell adhesion control (16, 20, 21). Members of the Rho family and their effectors, such as ROCK kinase, play a prominent role as intracellular signaling molecules in regulating the cytoskeletal remodeling required for cell spreading, adhesion, motility, and cell-shape changes (22–24). It is well established that Rho GTPases are involved in local signaling cascades during early implantation in vivo in regulating trophoblast adhesion (25) and migration (26). Furthermore, Rho GTPases regulate the invasion of the human embryo into the endometrial stroma (27) by modulating actin, myosin, and microtubule dynamics (28). In this work, we demonstrate that ANXA2 regulates the adhesiveness of the human endometrial epithelial cells to embryos during the window of implantation through the regulation of the RhoA/ROCK pathway by inducing F-actin rearrangement.

MATERIALS AND METHODS Endometrial biopsies Endometrial biopsies (n⫽30) were acquired for research after obtaining written consent from patients. Endometrial samples were collected from fertile ovum donors aged 18 –32 yr. Women had no underlying endometrial pathology and had regular menstrual cycles of between 25 and 33 d. None of these women had received hormonal preparation in the 3 mo preceding biopsy collection. Endometrial biopsies were obtained by gynecological procedures using Pipelle catheters (Gynetics, Hamont-Achel, Belgium) under sterile conditions to be processed. The epithelial compartment was isolated by mild collagenase digestion, as described previously (29). Endometrial samples were distributed into 4 groups according to the cycle phase: proliferative (d 1–14), early secretory (d 15–18), midsecretory (d 19 –22), and late secretory (d 23–28), and also according to the criteria of Noyes et al. (30). Cell culture and reagents hEEC cultures were obtained from endometrial biopsies and grown using a medium composed of 75% Dulbecco’s modified Eagle’s medium (DMEM) and 25% MCDB-105 (Sigma, Madrid, Spain) containing antibiotics. The homogeneity of the cultures was determined according to the morphological characteristics and was verified by an immunocytochemical localization of cytokeratin and vimentin (31). Confluence was reached on d 4 and 6. Human endometrial carcinoma-1 adenocarcinoma (HEC1-A) cells (HTB-112) and JEG-3 trophoblast-derived cells (HTB-36) were purchased from the American Type Culture Collection (ATCC; Rockville, MD, USA). HEC-1-A cells were grown in McCoy 5A medium, and JEG-3 cells were grown in Eagle’s minimal essential medium (EMEM), all of which were supplemented with 10% charcoal FBS and 0.1% antibiotics (fungizone and penicillin). For the experiments, HEC-1-A and JEG-3 cells were used between passages 2 and 8, and they were seeded in culture-treated plates (Becton Dickinson, Franklin Lakes, NJ, USA). 3716

Vol. 26

September 2012

Expression plasmids, siRNA transfections, and inhibitors ANXA2 silencing was performed using siRNA oligonucleotide with specificity for ANXA2 (CGGCCUGAGCGUCCAGAAATT) and negative control RNA duplexes, both with modification 3=-Alexa Fluor 488 (Qiagen, Valencia, CA, USA). HEC-1-A cells were transfected with ANXA2 siRNA or the siRNA 25-nM negative control. hEECs were transfected with ANXA2 siRNA or the siRNA 100-nM negative control. All the transfection experiments were performed using Hiperfect Transfection Reagent (Qiagen). The GFP-RhoA expression vector set (Cell Biolabs, San Diego, CA, USA) was used to obtain constitutively active and dominant-negative RhoA activity. HEC-1-A cells were transfected with 0.8 ␮g of plasmid pcDNA3-GFP-RhoA (wild-type), pcDNA3-GFP-RhoA T19N (dominant-negative mutant) or pcDNA3-GFP-RhoA Q63L (constitutively active mutant), using Lipofectamine 2000 (Invitrogen, Barcelona, Spain) as a transfection reagent. Transfection efficiency was evaluated as the percentage of the GFP-positive cells, quantified by ImagePro Plus 6.3 software (Media Cybernetics, Silver Spring, MD, USA; Supplemental Fig. S1). HEC-1-A cells were treated with 500 ng/ml Clostridium difficile toxin B (Cytoskeleton, Denver, CO, USA) for 1 h at 37°C to inactivate RhoA activity. Toxin B is a bacterial toxin that irreversibly glucosylates all the Rho GTPase family members to render them functionally inactive (32). HEC-1-A cells were also treated with ROCK inhibitor Y-27632 (Cytoskeleton) to 10 ␮M for 30 min at 37°C to inactivate ROCK activity, the kinase effector of RhoA. The structural ROCK inhibitor acts by potently inhibiting the coiled-coil-forming ROCK family of proteins directly (33). Coculture assay Embryo recovery Studies were carried out using a protocol approved by the Animal Care and Use Committee of the Valencia University School of Medicine and in accordance with U.S. National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. The B6C3F1 mouse strain was purchased from the Charles River Laboratories (Barcelona, Spain). Female mice, aged 6 – 8 wk, were primed to ovulate by administering 10 IU pregnant mare serum gonadotropin (Sigma-Aldrich, Irvine, UK), followed by a 10 IU hCG (SigmaAldrich) administration 48 h later. Females were housed overnight in pairs with a stud male and examined the following morning for the presence of a vaginal plug (d 1 of pregnancy). On d 2 of pregnancy, mice were killed by cervical dislocation, and embryos were flushed from the oviduct with PBS using a blunt 30-gauge needle attached to a 2-ml syringe. Embryos were cultured for 3 d in CCM-30 medium (Vitrolife, Lubeck, Germany). Only expanded blastocysts with a normal morphology were included in the study (400 – 450 mouse embryos in all the experiments). Degenerated embryos or those with hatching defects were discarded. The pellucid zone was not artificially removed. Spheroid culture Ethical aspects and the number of embryos needed for adhesion assays preclude the use of human embryos. JEG-3 spheroids showed a similar morphology and behavior to human embryos, so they were used as an in vitro approach. The JEG-3 human choriocarcinoma cell line was cultured in a single cell suspension in JEG-3 medium in 25-ml Erlenmeyer flasks at a concentration of 6 ⫻ 105 cells/6 ml with

The FASEB Journal 䡠 www.fasebj.org

GARRIDO-GÓMEZ ET AL.

agitation, as described previously (34). The medium was changed after 48 h, and spheroids were harvested 72 h after culture initiation. Adhesion assay Attachment of mouse blastocysts and JEG-3 spheroids in the epithelial cell monolayer assay was measured by a mechanical assay (34). Mouse blastocyst and JEG-3 spheroids were cocultured over confluent monolayers of HEC-1-A cells and hEECs. After a 24-h incubation (37°C, 5% CO2), plates were moved along a 3-cm-diameter circular path at a speed of one rotation per second for ⬃10 s. The embryos floating in the medium were judged to be unattached, while nonfloating embryos were considered attached. Embryos were examined under an inverted microscope (Nikon Diaphot 300; Nikon Corp., Tokyo, Japan). Mouse embryos or JEG-3 spheroids (6 – 8/well) were added to confluent HEC-1-A and hEEC monolayers in 24-well plates; 10 –15 mouse blastocysts or JEG-3 spheroids per condition were used in each experiment. Each adhesion experiment was performed 3 times. Trophoblast outgrowth analysis HEC-1-A cells and hEECs were transfected with ANXA2 siRNA, as described previously, then cocultured in fresh medium with mouse blastocysts until embryo attachment occurred. After the adhesion assay (48 h), the trophoblast outgrowth area of those blastocysts attached to HEC-1-A cells and hEECs was evaluated. Images were acquired immediately after adhesion and after 48 h. The outgrowth area (expressed in pixels) was expressed as the mean ⫾ se values of triplicate sets of measurements from 3 independent experiments. Wound-healing assays HEC-1-A cells and hEECs were seeded onto coverslips, grown to confluence, and treated with an ANXA2 siRNA inhibitor (24 h previously). Each coverslip was scratched with a sterile 200-␮l pipette tip, washed with PBS, and placed into fresh medium. The sites at which wounds were to be measured were marked on the undersurface of wells to ensure that measurements were made at the same place. Wound width was measured by phase-contrast microscopy immediately and after 24 h. Wound closure was calculated and expressed as a percentage of the initial wound width. The data shown represent the means ⫾ se of 10 measurements from 3 independent experiments. Quantitative PCR RNA was extracted using TRIzol LS reagent (Invitrogen, Barcelona, Spain), according to the manufacturer=s instructions. Reverse transcription was performed using 1 ␮g of total RNA, converted into cDNA using the Advantage RT-for-PCR kit (Clontech, Mountain View, CA, USA) following the manufacturer=s instructions. Real-time PCR was performed using SYBR Green for real-time PCR (Roche) in a Light Cycler 480 system (Roche). Transcripts were quantified from the corresponding standard curve using GAPDH as an internal control. Each experiment was run 3 times with each sample in triplicate. The following primers were used: ANXA2 (Fw TGTGCAAGCTCAGCTTGGA, Rv AGGTGTCTTCAATAGGCCCAA), RhoA (Fw GCTTGCTCATAGTCTTCAGCA, Rv TCCTTCTTATTCCCAACCAGGA), and GAPDH (Fw GAAGGTGAAGGTCGGAGTC, Rv GAAGATGGTGATGGGATTTC). ANXA2 IS CRITICAL FOR EMBRYONIC ADHESION VIA F-ACTIN

Immunohistochemistry and immunofluorescence Formalin-fixed and paraffin-embedded endometrial biopsies were sectioned and mounted on glass slides coated with Vectabond (Vector Laboratories, Burlingame, CA, USA). After deparaffinization and rehydratation, sections were rinsed 3 times with PBS for 5 min. Immunohistochemistry was performed on endometrial sections using the LSAB peroxidase kit (Dako, Carpinteria, CA, USA). Nonspecific binding was blocked with 5% BSA in PBS. Sections were incubated for 1 h at room temperature with 1:100 rabbit polyclonal antihuman annexin II (Abcam, Cambridge, UK) and 1:100 mouse monoclonal anti-human RhoA (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted in PBS with 3% BSA. In the absence of antibodies, negative controls were incubated with PBS including 3% BSA. Additional negative and positive control tissues were included for ANXA2 (kidney as the positive control and testicle as the negative control). Secondary antibodies were included in the LSAB peroxidase kit (Dako), valid for rabbit and mouse origin primary antibodies. Staining was achieved with 3,30-diaminobenzidine (DAB) chromogen for a time of between 30 s and 1 min. After counterstaining with hematoxylin for 10 s and washing with distilled water, slides were mounted with entellan (Merck, Darmstadt, Germany). The HEC-1-A epithelial cells and hECCs were cultured in plastic plates to 30 – 40% of confluence. To minimize the effects of epitope masking, we fixed cells with low concentrations of fixative (2–3% paraformaldehyde) blocked with 5% BSA. Primary antibodies included 1:100 rabbit polyclonal anti-human Annexin II (Abcam, Cambridge, UK) and 1:100 mouse monoclonal anti-human RhoA (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted in 3% BSA. Cells were incubated with secondary antibody 1:1000 TRICT anti-rabbit (Invitrogen, Barcelona, Spain) and 1:1000 Alexa Fluor 488 anti-rabbit (Invitrogen) to ANXA2, 1:1000 Alexa Fluor 488 anti-mouse (Invitrogen) to RhoA and 0.1 ␮g/ml phalloidintetramethylrhodamine B isothiocyanate conjugate from Amanita phalloides (Sigma Aldrich) to F-actin for 30 min at room temperature in the dark. The fluorescence confocal images were obtained with a Nikon microscope equipped with a ⫻100 1.45 numerical aperture objective and a Yokogawa spinning-disk confocal unit (PerkinElmer, Waltham, MA, USA). We employed ⱖ3 different tissue preparations for all the immunofluorescence labelings and quantifications. Pulldown and G-LISA RhoA activation assay kit The pulldown assay (Cytoskeleton) used the Rho binding domain (RBD) of the Rho effector protein rhotekin, which has been shown to bind specifically to the GTP-bound, this being the active Rho form. The rhotekin-RBD protein contains aa 7– 89 of Rhotekin RBD, expressed as GST fusion in E. coli, bound to colored glutathione-Sepharose beads. This enables the pulldown of GTP-Rho complexed with rhotekinRBD beads. Finally, the amount of activated Rho was determined by Western blot analysis. The RhoA G-LISA assay (Cytoskeleton) used a Rho-GTPbinding protein linked to the wells of a 96-well plate. The active GTP-bound Rho in cell lysates was attached, while inactive GDP-bound Rho was removed during the washing steps. Bound active RhoA was detected with a RhoA-specific antibody. Absorbance was read at 490 nm. Western blot studies HEC-1-A cells and hEECs were lysed in lysis buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 1% IGEPAL CA 360; 0.5% 3717

Na-DOC; 0.1% SDS; and 0.5 M EDTA). Cell lysates (40 ␮g total protein) were electrophoresed on 12% SDS-PAGE gel and electrophoretically transferred to a hydrophobic polyvinylidene difluoride membrane (Hybond-P; Amersham Biosciences, Piscataway, NJ, USA). Membranes were blocked in PBS-buffered saline with 5% milk and 0.1% Tween. Blots were probed with 1:1000 mouse monoclonal anti-human RhoA (Santa Cruz Biotechnology), 1:1000 rabbit polyclonal antihuman Annexin II (Abcam, Cambridge, UK), and 1:2000 mouse monoclonal anti-human GAPDH (Abcam); incubated overnight; and revealed with horseradish peroxidase-conjugated secondary goat anti-rabbit IgG-HRP and goat antimouse antibodies from Santa Cruz Biotechnology. Antibodyantigen complexes were detected using the ECL Plus reagent (Amersham Biosciences). F-actin/G-actin in vivo assay

Statistical analysis Values are presented as means ⫾ se, with n denoting the number of experiments. Data were analyzed using the t test for the analyzed global intergroup differences. Values of P ⱕ 0.05 were considered significant.

RESULTS

The amount of free monomeric actin (G-actin) content vs. filamentous actin (F-actin) content in the HEC-1-A cells subject to different treatments was determined using the G-actin/F-actin in vivo assay kit (Cytoskeleton). The control, control siRNA- and ANXA2 siRNA treated, control wild-type, and RhoA T19N- and toxin B-treated HEC-1-A cells were homogenized in F-actin stabilization buffer at 37°C. Cell lysates were then cleared of unbroken cells by low-speed centrifuging (2000 rpm). Cleared lysates were centrifuged at 100,000 g to separate soluble G-actin from insoluble F-actin.

A

B

ANXA2 is up-regulated in vivo during endometrial receptivity To demonstrate that ANXA2 is associated with the receptive profile in human endometrium, we first examined the localization and regulation of this protein by immunohistochemistry and Western blotting throughout the menstrual cycle by specifically

C

D ge

st

le

Fractions were then proportionally loaded on a polyacrylamide gel, separated by electrophoresis SDS-PAGE, and transferred to a nitrocellulose membrane for probing with antiactin antibody at the 1:500 dilution (Cytoskeleton). The densitometric quantification of the Western blot determined the G-actin ratio found in the cytosol vs. the F-actin incorporated into the cytoskeleton, normalized with total actin.

ge

ge

st

le

ge

le

le

st

E

F

st

G

H P

ES

MS

LS

ANXA2 GAPDH

I

Figure 1. Immunohistochemistry and Western blot analysis of ANXA2 in the human endometrium. A–G) Staining profile of ANXA2 observed in the proliferative (A), early-secretory (B), midsecretory (C), and late-secretory 5 *** human endometria (D). Five samples of each menstrual phase were analyzed. ** The rabbit polyclonal IgG antibody was substituted as a negative control (E). 4 No signal was observed in human testicle (negative tissue control; F). Strong 3 staining was detected in skin (positive tissue control; G). Endometrial stromal cells (st), the luminal epithelium (le), and glandular epithelium (ge) within 2 the tissue are indicated. H) Total cellular proteins extracted from the biopsy of 1 proliferative (P; d 1–14); early-secretory (ES; d 15–18); midsecretory (MS; d 19 –22); and late-secretory (LS; d 23–28) phase endometria (according to the 0 P ES MS LS criteria of Noyes et al.; ref. 44) were subjected to SDS-PAGE and were immunoblotted with anti-ANXA2 antibody and housekeeping protein GAPDH. The single bands of the ANXA2 and GAPDH proteins with a molecular mass of 37 and 36 kDa, respectively, were detected in all the cell lysates. A band analysis was performed from 3 different experiments and was normalized with GAPDH. I) Densitometric analyses of ANXA2 in the mid-secretory and late-secretory phases compared with the proliferative and early-secretory endometria phases were performed from 3 different experiments and were normalized with GAPDH. **P ⬍ 0.01, ***P ⬍ 0.001. Relative units/GAPDH

6

3718

Vol. 26

September 2012



At 24-h post-transfection, the ANXA2 protein levels were evaluated by Western blot analysis, showing that a significantly reduced protein level in ANXA2 inhibited HEC-1-A cells and hEECs compared to control cells (Fig. 2A, B). The adhesion experiments with mouse blastocysts and JEG-3 spheroids demonstrate that the ANXA2 siRNA-transfected cells significantly reduced mouse blastocyst adhesion when compared to controls (Fig. 2C). When we evaluated the adhesion of JEG-3 spheroids on the ANXA2 siRNA-transfected cells, we also observed a significant reduction in adhesion in both HEC-1-A cells and hEECs in comparison with control cells (Fig. 2D).

comparing the proliferative, early-secretory, midsecretory, and late-secretory phases. ANXA2 showed a slight signal during the proliferative and early-secretory phases in a very small number of stromal and apical epithelial luminal cells. Staining in the midsecretory phase was stronger in stromal and epithelial cells, was more prominently observed in endometrial glands and the luminal epithelium, and was maintained in the late-secretory phase (Fig. 1A–D). No signal was observed in the negative control and testes (negative tissue control), whereas a strong positive signal in the skin epidermis (positive tissue control) was detected (Fig. 1E–G). The Western blot analysis showed the expression of ANXA2 throughout the menstrual cycle (Fig. 1H), while the densitometric analysis corroborated the significantly increased expression in the mid- and late-secretory endometria when compared with the proliferative and earlysecretory endometria (Fig. 1I).

Inhibition of endometrial ANXA2 inhibits trophoblast outgrowth and epithelial reconstitution We decided to extend our observations to the effect of endometrial epithelial ANXA2 inhibition on trophoblast outgrowth. HEC-1-A cells and hEECs were transfected with ANXA2 siRNA, as described previously, to be then cocultured with mouse blastocysts until embryo attachment occurred. After 48 h, ANXA2 siRNA cells showed a marked decrease in trophoblast outgrowth when compared to control cells (Fig. 3A). Quantification revealed that the ANXA2 siRNA-inhibited cells underwent significant reduction in the outgrowth area when compared to the control siRNA-treated cells (Fig. 3B). We performed wound-healing assays to analyze ANXA2’s implication in the epithelial reconstitution process, which occurs when the trophoblast adheres and penetrates the epithelial lining. At 24 h after the functional inhibition of ANXA2 by siRNA, mechanical wounding was introduced into the confluent HEC-1-A

Inhibition of endometrial ANXA2 reduces adhesiveness In order to determine the functionality of epithelial ANXA2 for embryo adhesion/attachment, we tested the effects of ANXA2 inhibition by siRNA in a relevant in vitro model on embryo adhesion. This assay involves the coculture of a confluent monolayer of HEC-1-A cells or primary hEECs with mouse blastocysts or JEG-3 (a human trophoblast-derived cell line) spheroids. We transiently transfected the indicated cell line and hEECs with either a siRNA sequence specific to human ANXA2 (ANXA2 siRNA) or a scrambled sequence for transfection control (control siRNA).

B

C Control Control siRNA ANXA2 siRNA

HEC-1-A ANXA2 Control Control siRNA siRNA

ANXA2 GAPDH

JEG-3 spheroids adhesion (%)

D

hEEC Control ANXA2 Control siRNA siRNA

Relative units/GAPDH

1.40 1.20 1.00 0.80 0.60 0.40

**

0.20

**

0.00

100

Control Control siRNA ANXA2 siRNA

HEC-1-A

hEEC

Mouse blastocyst adhesion (%)

A

100 90 80


70 60 50 40 30

**

20

***

10 0

HEC-1-A

hEEC

Figure 2. Effect of ANXA2 inhibition in HEC-1-A cells and hEECs on adhesiveness on mouse blastocysts and JEG-3 spheroids. A) Protein ANXA2 levels of control cells (nontransfected), cells transfected with a scramble sequence (con70 trol siRNA), or cells transfected with an ANXA2-specific siRNA (ANXA2 siRNA) 60 were evaluated by Western blot analysis. B) Densitometric analyses of ANXA2 50 ** siRNA compared to the HEC-1A and hEEC control siRNA cells from 3 different * 40 experiments were performed and expressed as relative units normalized with 30 GAPDH. ANXA2 protein levels were significantly lowered in the ANXA220 10 inhibited cells. C, D) Adhesion is expressed as the percentage of seeded mouse 0 blastocyst (C) and JEG-3 spheroids (D) on HEC-1-A and hEEC-treated cells. hEEC HEC-1-A ANXA2 inhibition by siRNA significantly reduced adhesiveness. Values represent means ⫾ se of 3 independent experiments (n⫽10 –15 mouse blastocysts or JEG-3 spheroids per condition in each experiment). *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001. 90 80

ANXA2 IS CRITICAL FOR EMBRYONIC ADHESION VIA F-ACTIN

3719

A

Control

Control siRNA

B

ANXA2 siRNA

48 h

0h

Outgrowth area (in pixels x105)

90

Control siRNA

70

ANXA2 siRNA

60 50 40 30

Control

Control siRNA

ANXA2 siRNA

*** ***

20 10 0

C

Control

80

D

Hec-1-A

hEEC

Control 100 90

Control siRNA ANXA2 siRNA

24 h

Wound closure (%)

0h

80 70 60 50 40

*

*

30 20 10 0

Hec-1-A

hEEC

Figure 3. ANXA2 inhibition effect on mouse blastocyst outgrowth and epithelial reconstitution. A) hEECs were transfected with ANXA2 siRNA to be then cocultured with mouse blastocyst until embryo attachment occurred. After 48 h, mouse blastocyst outgrowth on hEECs was encircled with white line. B) Area of mouse embryo outgrowth (expressed in pixels) in HEC-1-A cells and hEECs was evaluated, and a significant reduction in ANXA2 siRNA cells was observed when compared to control cells. Values are represented as means ⫾ se of 3 different experiments. C) Wound-healing assay on controls and ANXA2-inhibited hEECs. Wound width was measured at 0 and 24 h after wounding. D) Percentage of wound closure was determined by an image analysis, and a significant reduction in the ANXA2 siRNA HEC-1-A cells and hEECs was noted in comparison to control cells. Values are means ⫾ se of 10 measurements from 3 different experiments. *P ⬍ 0.05, ***P ⬍ 0.001.

and hEEC monolayers (Fig. 3C). Wound widths were measured immediately and after 24 h, and the percentage of wound closure was determined (Fig. 3D). Wound closure in the ANXA2 siRNA-inhibited cells was significantly reduced in both the HEC-1-A cells and hEECs vs. controls. Therefore, a significant decrease in epithelial cell reconstitution/migration was observed when ANXA2 was inhibited. ANXA2 inhibition affects RhoA activity Since accumulated evidence suggests that ANXA2 is linked to the RhoA/ROCK pathway by regulating cell adhesion (16, 20, 21), we decided to examine the effects of ANXA2 inhibition on the levels of total or activated RhoA. The levels of total RhoA were analyzed by Western blotting in the ANXA2 siRNA-inhibited HEC-1-A cells and hEECs (Fig. 4A). We found no significant changes in total RhoA among the ANXA2 siRNA-transfected cells when comparing them to con3720

Vol. 26

September 2012

trol cells (Fig. 4B). We also examined the activation status of RhoA in both HEC-1-A cells and hEECs by a G-LISA assay. Unlike the previous experiment, we observed that the levels of active RhoA significantly lowered in ANXA2 siRNA cells if compared to control cells (Fig. 4C). RhoA was inactivated by cell transfection with a dominant-negative mutant (RhoA T19N). We also tested the effect of RhoA inactivation on the ANXA2 protein levels by Western blotting in HEC-1-A cells (Fig. 4D). In this experiment, no significant changes in ANXA2 levels among the control, control of transfection (wild-type) and RhoA T19N-transfected cells was noted (Fig. 4E). To test whether these results depended on transfection efficiency or not, the percentage of the GFP-positive cells was evaluated by image analyses (Supplemental Fig. S1). Therefore, we conclude that ANXA2 inhibition significantly lowers RhoA activity; in contrast, RhoA inactivation does not affect the ANXA2 expression.



B Control

hEEC

Control ANXA2 Control Control ANXA2 siRNA siRNA siRNA siRNA

Total RhoA GAPDH


HEC-1-A

0.8 0.6 0.4 0.2 HEC-1-A


100

1

0

E

D

Relaive units/GAPDH

1.2

HEC-1-A

C 120


RhoA active (%)

A

hEEC

80

***

*

60 40 20 0

HEC-1-A

hEEC

Figure 4. ANXA2 inhibition by siRNA induces reduced RhoA activity. A) Total RhoA levels of the control and 1 ANXA2-inhibited HEC-1-A cells and hEECs were evalu0.8 ated by Western blotting. B) A densitometric analysis of ANXA2 0.6 the bands from 3 different experiments was performed 0.4 and expressed as relative units normalized with GAPDH. 0.2 GAPDH Results demonstrate that total RhoA content was not 0 Control Wild type RhoA T19N affected by ANXA2 inhibition. C) The active RhoA form was analyzed by a G-LISA assay in HEC-1-A cells and hEECs. Values represent means ⫾ se of a percentage of RhoA activity in 3 different experiments. G-LISA analysis shows significantly reduced RhoA activity in the ANXA2-inhibited siRNA cells compared to control cells. D) Total lysates of control, transfection control (wild-type), and the negative RhoA mutant (RhoA T19N) from HEC-1-A cells were immunoblotted for ANXA2 and GAPDH. Western blot analysis shows no differences in the ANXA2 expression in the RhoA T19N-transfected cells compared to control cells. E) Densitometric analyses of ANXA2 in the RhoA T19N-transfected cells in relation to the control band were done from 3 different experiments and expressed as relative units normalized with GAPDH. *P ⬍ 0.05, ***P ⬍ 0.001. Control

Wild Type

RhoA T19N

1.4 1.2

RhoA activity in endometrial epithelial cells affects their adhesiveness capability ANXA2 inhibition led to a decrease in active RhoA, suggesting that this protein may be associated with embryonic adhesion ability in the endometrium. Therefore, we examined both RhoA localization and regulation at the protein level throughout the menstrual cycle. Total RhoA staining displayed a similar pattern in the proliferative, early-secretory, midsecretory, and late-secretory phases (Fig. 5A–D). A Western blotting assay (Fig. 5E) demonstrated that the total RhoA levels showed no significant changes among the different menstrual cycle phases (Fig. 5F). In contrast, the active RhoA form was analyzed by a G-LISA assay throughout the menstrual cycle, and had significantly increased in the midsecretory phase if compared to the proliferative, early-secretory and late-secretory phases (Fig. 5G). Once again, this indicates a compatible phenotype with the endometrial window of implantation. Furthermore, we investigated the functional implication of RhoA/ROCK activity on embryo adhesiveness in the HEC-1-A epithelial cell line. Primary hEECs were not amenable for transfection; therefore, we undertook subsequent studies using the HEC-1-A cell line. HEC1-A cells were transfected with either a dominantnegative RhoA mutant (RhoA T19N) or a constitutive active RhoA mutant (RhoA Q63L). We also inactivated RhoA by treating HEC-1-A cells with toxin B from C. difficile, which irreversibly glucosylates the RhoA protein and triggers its functional inactivation. Furthermore, HEC-1-A cells were treated with ROCK inhibitor Y-27632, which acts by inhibiting the downstream RhoA effector. ANXA2 IS CRITICAL FOR EMBRYONIC ADHESION VIA F-ACTIN

To confirm the correct activation/inactivation of RhoA, a pulldown assay was carried out. The active RhoA levels increased when a constitutive active RhoA Q63L plasmid was used, but they lowered when utilizing a dominant-negative RhoA T19N or toxin B treatment, while total RhoA remained unchanged (Fig. 6A, B) in all the treatments. These active RhoA regulation results were also quantified by a G-LISA assay (Fig. 6C). To test the ROCK inhibitor Y-27632 effect, the F-actin network was analyzed by rhodamine-phalloidin staining. The rounded control cells exhibited extensive actin stress fibers, whereas treatment with different Y-27632 doses reduced fibers stress density, and cells underwent a morphological change (Supplemental Fig. S2). Mouse blastocyst adhesion to the epithelial HEC-1-A cell line significantly diminished when RhoA was either inactivated with negative mutant RhoA T19N or treated with toxin B (Fig. 6D). We also noticed how adhesion ability significantly diminished when the ROCK kinase effector was inhibited (Fig. 6D). One interesting finding was that transfection with constitutive active mutant RhoA Q63L significantly improved embryo adhesion to the HEC-1-A cell line. When cells were transfected with RhoA T19N or treated with toxin B or the ROCK inhibitor, a dramatic decrease in JEG-3 spheroids adhesion was also confirmed (Fig. 6E). These results indicate that the activation status of RhoA and its action through the ROCK kinase effector are involved in endometrial epithelial adhesiveness. Active RhoA acts downstream of ANXA2 and colocalizes at the plasma membrane We examined the possible link between ANXA2 and RhoA activity by investigating the adhesiveness effect of 3721

E

P

ES

MS

LS

Total RhoA

F

A

B


GAPDH

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

C

D

RhoA active (Relative units)

P

G

ES

MS

LS

2.5

*

2.0 1.5 1.0 0.5 0.0

P

ES

MS

LS

Figure 5. Immunohistochemistry and Western blot analysis of total RhoA and the G-LISA analysis of active RhoA in total human endometrium. A–D) Staining profile of the total RhoA content observed in the proliferative (A), early-secretory (B), midsecretory (C), and late-secretory endometria (D). E) Total cellular proteins extracted from biopsies of the proliferative (P), early-secretory (ES), midsecretory (MS), and late-secretory (LS) endometria were subjected to SDS-PAGE, and immunoblotted with anti-RhoA antibody and housekeeping protein GAPDH. F) Densitometric analyses of RhoA-GTP in the MS phase, compared with the P, ES, and LS endometria phases, were performed from 3 different experiments and normalized with GAPDH. G) RhoA activity in the P, ES, MS, and LS endometria was measured by the G-LISA analysis. Absorbance was read at 490 nm. Values represent mean ⫾ se percentage of activity in the MS phase compared with the P, ES, and LS endometria phases in the 3 different experiments performed. P, proliferative; ES, early-secretory; MS, midsecretory; LS, late-secretory. *P ⬍ 0.05.

ANXA2 inhibition combined with RhoA inactivation/ activation in HEC-1-A cells (Fig. 7A). Our results demonstrate that the double inhibition/inactivation of ANXA2 siRNA and RhoA T19N significantly diminished adhesion when compared to controls, although no significant differences were found when compared with individual treatments (ANXA2 siRNA or RhoA T19N). However, when cells were ANXA2-inhibited and RhoA was activated (RhoA Q63L), the percentage of JEG-3 spheroids adhesion was similar to control cells, indicating that constitutively active RhoA partially reverses the effects of ANXA2 inhibition on endometrial adhesiveness. To understand the relation between ANXA2 and RhoA in endometrial epithelial cells, we performed double immunocytochemistry in the HEC-1-A cell line. ANXA2 staining vastly accumulated in the plasma membrane, where it colocalized with RhoA (Fig. 7B). Total RhoA was also distributed in the cytoplasm compartment. This localization pattern has been reported in other epithelial cell types (35). Therefore, these proteins were present in a similar localization. ANXA2 and RhoA regulate the F-actin fibers rearrangement in the cytoskeleton ANXA2 and RhoA have been shown to regulate the actin cytoskeleton in epithelial cells (14, 36). It has also 3722

Vol. 26

September 2012

been demonstrated that ANXA2 and RhoA function in dynamic F-actin restructuring, which is required for trophoblast adhesion and epithelial cell reconstitution (12). Therefore, we analyzed the subcellular localization of ANXA2 and RhoA and their possible colocalization with F-actin, a major target for these molecules. After undertaking a double immunocytochemistry of HEC-1-A cells, we observed that ANXA2 and total RhoA staining were predominantly distributed along the membrane domain of endometrial epithelial cells, where they colocalized with the F-actin network (Fig. 8A). We also examined the effects of ANXA2 inhibition (siRNA) and RhoA inactivation (negative-mutant RhoA T19N and toxin B treatment) on the F-actin architecture in HEC-1-A cells. The reduction in the ANXA2 levels and RhoA inactivation induced significant modifications in the F-actin architecture, which was visualized with rhodamine-phalloidin staining (Fig. 8B). Control cells presented a rounded morphology with a well-developed network of actin filaments distributed over the whole cell surface, which were more abundant on the cell periphery. In contrast, ANXA2 inhibition and RhoA-inactivated cells presented a minor density of well-spread stress fibers within the cytoplasmic compartment, with a flattened cellular phenotype. Some irregularly sized aggregates of actin and F-actin fibers were separated by a variable space.



B HEC-1-A GDP

GTPyS

Wild RhoA RhoA Toxin B Type T19N Q63L

Active RhoA Total RhoA

C 2.5 2.0 1.5 1.0

**

0.5

**

0.0

300 250 200 150 100

**

**

50 0

80 70 60

*

50 40 30 20

*

10

*

*

0

Control Wild Type RhoA Q63L

RhoA T19N

Toxin B Y-27632


E

D Mouse blastocyst adhesion (%)

*

350

*

RhoA active (%)

RhoA active/RhoA total

A

80 70 60 50 40

*

*

*

30 20 10 0

Control Wild Type RhoA Q63L

RhoA T19N

Toxin B Y-27632

Figure 6. RhoA activation/inactivation and ROCK inhibition effects on the adhesion of mouse blastocyst and JEG-3 spheroids to HEC-1-A cells. A) The active RhoA form in control and treated HEC-1-A cells was assessed by the Rhotekin pulldown assay, and the results were observed by Western blot analysis. Extract from HEC-1-A cells was loaded with GTP␥S or GDP to generate a positive and negative control. B) Densitometric analyses of active RhoA in transfected RhoA mutants in relation to control cells were performed with 3 different experiments and normalized to total RhoA protein. C) Cell lysates of both control and treated HEC-1-A cells were also subjected to the G-LISA assay. Active RhoA showed a significant reduction in the RhoA T19N and toxin B-treated cells and a significant increase in the RhoA Q63L-transfected cells. Absorbance was read at 490 nm. Values represent mean ⫾ se percentage of activity in relation to control cells in 3 different experiments performed. D, E) Percentage of adhesion of mouse embryos (D) and JEG-3 spheroids (E) in control and treated HEC-1-A cells revealed significantly diminished adhesion when RhoA and ROCK activity lowered. Values represent means ⫾ se of 3 independent experiments. (n⫽10 –15 mouse blastocysts or JEG-3 spheroids per condition in each experiment). *P ⬍ 0.05, **P ⬍ 0.01.

To support our morphological observations, we analyzed actin cytoskeleton reorganization after ANXA2 inhibition or RhoA inactivation. We did an assay to study the ratio of the free monomeric G-actin found in the cytosol when compared to the F-actin incorporated into the cytoskeleton (Fig. 8C). This assay was done in the control, ANXA2-inhibited (ANXA2 siRNA-), and RhoA-inactivated (RhoA T19N and toxin B) cells. The average G/F-actin ratio was 1:1 in control cells, whereas the ANXA2-inhibited cells revealed a significant increase in the monomeric G-actin content if compared to F-actin (a ratio of 6:1 in the ANXA2 siRNA cells; Fig. 8D). Similar results were obtained in the RhoA-inactivated cells, where levels of monomeric G-actin significantly increased when compared with filamentous F-actin (a ratio of 3:1 in the RhoA T19N cells and 4:1 in the toxin B-treated cells; Fig. 8D). This experiment demonstrates that ANXA2 inhibition or RhoA inactivation causes not only actin filament depolymerization, but also a significant increase in the G-actin monomeric fraction. Taken together, the morphological and biochemical changes identify significant F-actin fiber dis-

organization when ANXA2 is inhibited or RhoA is inactivated.


3723

DISCUSSION It is known that rearrangement of the cytoskeleton (12), destabilization of apico-basal polarity (37), and redistribution of different molecules in endometrial epithelial cells (38) are required for the formation of the stable bonds between epithelial and trophoblast cells during the implantation process. In our previous study (15), we identified ANXA2 as an important marker in the receptive human endometrium. ANXA2 was also identified among dysregulated proteins in women with endometriosis (39). In this work, we extend our previous studies by corroborating the presence of ANXA2 in the mid- and late-secretory endometria, which is strongly expressed in endometrial glands and the luminal epithelium. This evidence suggests that the endometrial epithelium is where ANXA2 performs its main function. We also observed an intense expres-


A

B

ANXA2

RhoA

Merge

90 80 70 60 50 40

*

**

*

30 20 10 0

XZ

Figure 7. Effect of ANXA2 inhibition combined with RhoA activation/inactivation in JEG-3 spheroids on HEC-1-A cells. A) Analysis of JEG-3 spheroid adhesion on HEC-1-A cells transfected with ANXA2 siRNA, RhoA T19N, RhoA Q63L plasmids or a combination of ANXA2 siRNA/RhoA T19N and ANXA2 siRNA/RhoA Q63L. B) HEC-1-A epithelial cells were double-labeled for ANXA2 (TRITC) and RhoA (Alexa Fluor 488), and a clear colocalization along the membrane domain was observed (merge) in confluent and subconfluent cells. XZ section showed the lateral and apical colocalization of the ANXA2 and RhoA proteins. *P ⬍ 0.05, **P ⬍ 0.01.

sion in stromal cells, where ANXA2 could be implicated in the regulation of the decidualization process, which depends on actin cytoskeleton reorganization (40). To test its in vivo functional relevance, an endometrial nonreceptive model induced by intrauterine device (IUD) insertion into fertile patients was used. This study demonstrates that the endometrial epithelial ANXA2 expression dramatically diminishes in the presence of an IUD, (15), suggesting lack of functional annexin A2 in a refractory endometrium. An in vitro adhesion model was employed in the present research work: mouse blastocyst and human trophoblastoid JEG-3 spheroids over the monolayers of the epithelial cell line HEC-1-A and primary hEEC cells were used to mimic the in vivo embryo adhesion process. We proceeded with the specific inhibition of ANXA2 by siRNA, demonstrating significantly diminished embryo adhesiveness. Therefore, the functional inhibition of ANXA2 at the transcription level induces a defective adhesiveness of the primary endometrial epithelium in culture. Once the blastocyst adheres to epithelial cells, the trophectoderm spreads out (41), and invasion through stromal cells starts. Our results demonstrate that trophoblast outgrowth lessens when ANXA2 is inhibited. This fact could reflect defective interaction and lack of flexibility between trophoblast and maternal epithelial cells due to the cytoskeleton’s restructuration inability. The attached blastocyst penetrates the epithelial lining when endometrial epithelial cells initiate a closure process to seal the luminal epithelium (42). Using a wound-closure assay, we demonstrated that the migration capacity of the epithelial cells in culture significantly lowers when ANXA2 is knocked down. This phenomenon could be ascribed to the impaired formation of the intracellular structures 3724

Vol. 26

September 2012

required for cell movement, typically the focal adhesion and actin stress fibers, which are regulated by the ANXA2 protein (14). ANXA2 appears to function by supporting the assembly of membrane lipids and/or by recruiting the factors that initiate actin-remodeling events, such as Rho family GTPases (16). An analysis of the functional relation among these proteins in our system demonstrates that ANXA2 inhibition does not affect the levels of total RhoA but significantly reduces active RhoA. This protein, along with its downstream ROCK kinase effector, is also implicated in embryo adhesiveness to epithelial cell lines (25, 43, 44, 45). Our results reveal that active RhoA and its action through the ROCK kinase are required for adequate embryo adhesion. The RhoA protein, which acts as an on/off switch, could be a good candidate to promote the trophoblast adhesive properties of the cell surface of endometrial epithelial cells. Induction of constitutively active RhoA partially reverses the effects of ANXA2 inhibition on endometrial adhesiveness. However, inactivation of RhoA does not alter the ANXA2 levels, suggesting that ANXA2 acts by participating upstream in the induction of an active RhoA form. The possible relation between the ANXA2 and RhoA proteins is further reinforced by our observation of the colocalization of these molecules along the plasma membrane of epithelial cells in culture, which is consistent with our hypothesis of there being a pathway where ANXA2 and RhoA perform an action on F-actin cytoskeleton rearrangement. This idea is supported by previous studies describing how ANXA2 recruits other proteins, such as SHP-2 tyrosine phosphatizes and Rac-1 (46, 47). It is also known that ANXA2 and RhoA are associated with F-actin fibers organization by means of a number of different mech-



A

ANXA2

Actin

Merge

RhoA

Actin

Merge

C

B

Control

Control siRNA

ANXA2 siRNA

Control (Wild Type)

RhoA T19N

Toxin B

D 8


G/F Actin Ratio

7

Control (Wild Type)

6 5 4 3 2 1

RhoA T19N Toxin B

0

Control

Control siRNA

ANXA2 siRNA

Control (Wild Type)

RhoA T19N

Toxin B

Figure 8. F-actin remodeling when ANXA2 was inhibited and RhoA was inactivated. A) ANXA2 (Alexa Fluor 488) and RhoA (Alexa Fluor 488) were colocalized with F-actin fibers (rhodamine-phalloidin) in the HEC-1-A epithelial cells (Scale bar⫽5 ␮m). B) F-actin architecture in the control, ANXA2-inhibited, and RhoA-inactivated HEC-1-A cells was visualized by a rhodaminephalloidin stain. C) G-actin (soluble), F-actin (filamentous), and total actin fractions were analyzed by an in vivo assay, and the results were observed by Western blot analysis in the ANXA2-inhibited and RhoA-inactivated HEC-1-A cells. D) Densitometric analysis was performed from 3 different experiments, expressed as the G/F actin ratio, and normalized with total actin. Results reveal a significant increase in the G/F actin ratio in the ANXA2-inhibited and RhoA-inactivated cells, compared with control cells. No changes in total actin were observed in the various samples investigated.

anisms (48, 49). By conducting localization studies, we revealed that a large proportion of ANXA2 and RhoA colocalizes in the F-actin network. Furthermore, the functional adhesion effects of ANXA2 inhibition and RhoA inactivation were associated with significant alterations in F-actin organization and their subsequent depolymerization. These results are consistent with a former study in which the adhesiveness of endometrial epithelial cells lowered by treatment with cytochalasin D, a drug that produces a high actin depolymerization rate (12). We also tested the effect of ANXA2 inhibition or RhoA activation on the F-actin architecture, and we observed a large proportion of free monomeric G-actin in both cases. These results suggest that ANXA2 and RhoA play a functional role in determining F-actin organization through direct interactions with polymerized and monomeric actin in epithelial endometrial

cells. Recently, some authors (20) have shown that ANXA2-knockdown cells result in a lower density of F-actin bundles if compared with control untransfected cells, which supports our findings. Furthermore, these authors also found that ANXA2 inhibition significantly reduces cell adhesion and migration. Another work (14), however, postulated that AnxA2 knockdown results in not only an accumulation of actin filaments (stress fibers), but also in the loss of protrusive and retractile cell activity. In fact, ANXA2 regulates F-actin cytoskeleton reorganization; however, the polymerization/depolymerization mechanism requires further research. It is, therefore, possible that ANXA2 per se remodels actin fibers or, alternatively, that it mediates the activation of other structural proteins such as RhoA, which directly modulates this process. Extrapolating the in vivo situation would imply that an actively regu-


3725

lated modulation of the actin cytoskeleton must occur when the endometrial epithelium enters the state of receptivity. The ANXA2 and the RhoA/ROCK pathway could be involved in signaling and effectors mechanisms, which specifically control actin rearrangement in endometrial epithelial cells. In summary, our results demonstrate that ANXA2 performs an important function upstream of the RhoA/ROCK pathway in regulating F-actin remodeling, a key human endometrial adhesiveness factor. On the basis of the results presented herein, we suggest that the ANXA2/RhoA pathway is a potential target to explore the translational application to improve embryo implantation rates in IVF or for its use as a nonhormonal interceptive strategy.

15.

The authors are especially grateful to S. K. Dey (Department of Pediatrics, Vanderbilt University Medical Center, Nashville, TN, USA) for his critical review of this paper. The authors declare no conflicts of interest.

20.

REFERENCES 1. 2. 3.

4.

5. 6. 7.

8. 9.

10.

11. 12.

13. 14.

3726

September 2012

17. 18.

19.

21.

22.

Wilcox, A. J., Weinberg, and C. R., O’Connor, J. F. (1988) Incidence of early loss of pregnancy. N. Engl. J. Med. 319, 189 –194 Wilcox, A. J., Baird, D. D., and Weinberg, C. R. (1999) Time of implantation of the conceptus and loss of pregnancy. N. Engl. J. Med. 340, 1796 –1799 Simón, C., Landeras, J., Zuzuarregui, J. L., Martín, J. C., Remohí, J., and Pellicer, A. (1999) Early pregnancy losses in in vitro fertilization and oocyte donation. Fertil. Steril. 72, 1061– 1065 Dominguez, F., Yáñez-Mó, M., Sanchez-Madrid, F., and Simón, C. (2005) Embryonic implantation and leukocyte transendothelial migration: different processes with similar players? FASEB J. 19, 1056 –1060 Psychoyos, A. (1986) Uterine receptivity for nidation. Ann. N. Y. Acad. Sci. 476, 36 –42 Simon, C., Domínguez, F., Valbuena, D., and Pellicer, A. (2003) The role of estrogen in uterine receptivity and blastocyst implantation. Trends Endocrinol. Metab. 14, 197–199 Horcajadas, J. A., Mínguez, P., Dopazo, J., Esteban, F. J., Domínguez, F., Giudice, L. C., Pellicer, A., and Simón, C. (2008) Controlled ovarian stimulation induces a functional genomic delay of the endometrium with potential clinical implications. J. Clin. Endocrinol. Metab. 93, 4500 –4510 Murphy, C. R. (2000) The plasma membrane transformation of uterine epithelial cells during pregnancy. J. Reprod. Fertil. 55, 23–28 Martin, J. C., Jasper, M. J., Valbuena, D., Meseguer, M., Remohi, J., Pellicer, A., and Simon, C. (2000) Increased adhesiveness in cultured endometrial-derived cells is related to the absence of moesin expression. Biol. Reprod. 63, 1370 –1376 Thie, M., Harrach-Ruprecht, B., Sauer, H., Fuchs, P., Albers, A., and Denker, H. W. (1995) Cell adhesion to the apical pole of epithelium: a function of cell polarity. Eur. J. Cell Biol. 66, 180 –191 Hitt, A. L., and Luna, E. J. (1994) Membrane interactions with the actin cytoskeleton. Curr. Biol. 6, 120 –130 Thie, M., Herter, P., Pommerenke, H., Dürr, F., and Sieckmann, F. (1997) Adhesiveness of the free surface of a human endometrial monolayer for trophoblast as related to actin cytoskeleton. Mol. Hum. Reprod. 3, 275–283 Murphy, C. R. (1995) The cytoskeleton of uterine epithelial cells: a new player in uterine receptivity and the plasma membrane transformation. Hum. Reprod. Update 1, 567–580 Hayes, M. J., Shao, D., Bailly, M., and Moss, S. E. (2006) Regulation of actin dynamics by annexin 2. EMBO J. 25, 1816 –1826

Vol. 26

16.

23. 24.

25.

26.

27.

28. 29.

30. 31. 32. 33.

34. 35. 36.

Dominguez, F., Garrido-Gomez, T., Lopez, J. A., Camafeita, E., Quinonero, A., Pellicer, A., and Simón, C. (2009) Proteomic analysis of the human receptive versus non-receptive endometrium using differential in-gel electrophoresis and MALDI-MS unveils stathmin 1 and annexin A2 as differentially regulated. Human Reprod. 24, 2607–2617 Rescher, U., Ludwig, C., Konietzo, V., Kharitonenkov, A., and Gerke, V. (2008) Tyrosine phosphorylation of annexin A2 regulates Rho-mediated actin rearrangement and cell adhesion. J. Cell Sci. 121, 2177–2185 Gerke, V., and Moss, S. E. (1997) Annexins and membrane dynamics. Biochim. Biophys. Acta 1357, 129 –154 Oliferenko, S., Paiha, K., Harder, T., Gerke, V., Schwarzler, C., Schwarz, H., Beug, H., Günthert, U., and Huber, L. A. (1999) Analysis of CD44-containing lipid rafts: recruitment of annexin II and stabilization by the actin cytoskeleton. J. Cell Biol. 146, 843–854 Filipenko, N. R., and Waisman, D. M. (2001) The C terminus of annexin II mediates binding to F-actin. J. Biol. Chem. 276, 5310 –5315 Babbin, B., Parkos, C., Mandell, K., Winfree, M., Laur, O., Ivanoc, A. I., and Nusrat, A. (2007) Annexin 2 regulates intestinal epithelial cell spreading and wound closure through Rho-related signaling. Am. J. Pathol. 170, 951–966 Babiychuk, E. B., Monastyrskaya, K., Burkhard, F. C., Wray, S., and Draeger, A. (2002) Modulating signaling events in smooth muscle: cleavage of annexin 2 abolishes its binding to lipid rafts. FASEB J. 16, 1177–1184 Hall, A. (1990) The cellular functions of small GTP-binding proteins. Science 249, 635–640 Ridley, A. J., and Hall, A. (1992) The small GTP-binding protein Rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389 –339 Wang, D. S., Dou, K. F., Li, K. Z., and Song, Z. S. (2004) Enhancement of migration and invasion of hepatoma cells via a Rho GTPase signaling pathway. World J. Gastroenterol. 10, 299 – 302 Heneweer, C., Kruse, L., Kindhaüser, F., Schmidt, M., Jakobs, K. H., Denker, H. W., and Thie, M. (2002) Adhesivenees of human uterine epithelial RL95-2 cells to trophoblast: Rho protein regulation. Mol. Hum. Reprod. 11, 1014 –1022 Shiokawa, S., Iwashita, M., Akimoto, Y., Nagamatsu, S., Sakai, K., Hanashi, H., Kabir-Salmani, M., Nakamura, Y., Uehata, M., and Yoshimura, Y. (2002) Small guanosine triphospatase RhoA and RhoA-associated kinase as regulators of trophoblast migration. J. Clin. Endocrinol. Metab. 87, 5808 –5816 Grewal, S., Carver, J., Ridley, A., and Mardon, H. (2008) Implantation of the human embryo requires Rac1-dependent endometrial stromal cell migration. Proc. Natl. Acad. Sci. U. S. A. 105, 16189 –16194 Ettiene-Manneville, S., and Hall, A. Rho GTPases in cell biology (2002). Nature 2002, 629 –6325 Simón, C., Mercader, A., Garcia-Velasco, J., Nikas, G., Moreno, C., Remohí, J., and Pellicer, A. (1999) Coculture of human embryos with autologous human endometrial epithelial cells in patients with implantation failure. J. Clin. Endocrinol. Metab. 84, 2638 –2646 Noyes, R. W., Hertig, A. T., and Rock, J. (1975) Dating the endometrial biopsy. Am. J. Obstet. Gynecol. 122, 262–263 Mercader, A., Valbuena, D., and Simon, C. (2006) Human embryo culture. Methods Enzymol. 420, 3–18 Genth, H., Dreger, S. C., Huelsenbeck, J., and Just, I. (2008) Clostridium difficile toxins: more than mere inhibitors of Rho proteins. Int. J. Biochem. Cell Biol. 40, 592–597 Ishizaki, T., Uehata, M., Tamechika, I., and Keel, J. (2000) Nonomura, K., Maekawa, M., Narumiya, S. Pharmacological properties of Y-27632, a specific inhibitor of rho-associated kinases. Mol. Pharmacol. 57, 976 –8346 Nancy, J., Manuela, L., and Hans-Werner, D. (1993) Quantitation of Human choriocarcinoma spheroid attachment to uterine epithelial cell monolayers. In Vitro Cell. Dev. Biol. 29, 461–468 Yonemura, S., Hirao-Minakuchi, K., and Nishimura, Y (2006) Rho localization in cells and tissues. 295, 300 –314 Heneweer, C., Adelmann, H. G., Kruse, L. H., Denker, H. W., and Thie, M. (2003) Human uterine epithelial RL95-2 cells reorganize their cytoplasmic architecture with respect to Rho



37.

38. 39.

40. 41. 42. 43.

protein and F-actin in response to trophoblast binding. Cells Tissues Organs 175, 1–8 Simón, C., Martin, J. C., Meseguer, M., Caballero-Campo, P., Valbuena, D., and Pellicer, A. (2000) Embryonic regulation of endometrial molecules in human implantation. J. Reprod. Fertil. 55, 43–53 Lindenberg, S. (1991) Experimental studies on the initial trophoblast endometrial interaction. Dan. Med. Bull. 38, 371– 380 Fowler, P. A., Tattum, J., Bhattacharya, S., Klonisch, T., Hombach-Klonisch, S., Gazvani, R., Lea, R. G., Miller, I., Simpson, W. G., and Cash, P. (2007) An investigation of the effects of endometriosis on the proteome of human eutopic endometrium: a heterogeneous tissue with a complex disease. Proteomics 7, 130 –142 Ihnatovych, I., Livak, M., Reed, J., Lanerolle, P., and Strakova, Z. (2009) Manipulating actin dynamics affects human in vitro decidualization. Biol. Reprod. 81, 222–230 Van Blerkom, J., and Chavez, D. J. (1981) Morphodynamics of outgrowths of mouse trophoblast in the presence and absence of a monolayer of uterine epithelium. Am. J. Anat. 162, 143–155 Aplin, J. D. (2007) Embryo implantation: the molecular mechanism remains elusive. Reprod. Biomed. Online 1, 49 –55 Heneweer, C., Schmidt, M., Denker, H. W., and Thie, M. (2005) Molecular mechanism in uterine epithelium during trophoblast


44. 45.

46.

47.

48. 49.

binding: the role of small GTPase RhoA in human uterine Ishikawa cells. J. Exp. Clin. Assist. Reprod. 9, 2–4 Lock, F. E., Ryan, K. R., Poulter, N. S., Parsons, M., and Hotchin, N. A. (2012) Differential regulation of adhesion complex turnover by ROCK1 and ROCK2. PLoS One 7, 31423 Xu, B., Song, G., Ju, Y., Li, X., Song, Y., and Watanabe, S. (2012) RhoA/ROCK, cytoskeletal dynamics, and focal adhesion kinase are required for mechanical stretch-induced tenogenic differentiation of human mesenchymal stem cells. J. Cell. Physiol. 227, 2722–2729 Burkar, A., Samii, B., Corvera, S., and Shpetner, H. S. (2003) Regulation of the SHP-2 tyrosine phosphatase by a novel cholesterol and cell confluence dependent mechanism. J. Biol. Chem. 278, 18360 –18367 Hansen, M. D., Ehrlich, J. S., and Nelson, W. J. (2002) Molecular mechanism for orienting membrane and actin dynamics to nascent cell-cell contacts in epithelial cells. J. Biol. Chem. 277, 45371–45376 Gerke, V., and Moss, S. E. (2002) Annexins: from structure to function. Physiol. Rev. 82, 331–371 Filipenko, N. R., and Waisman, D. M. (2001) The C terminus of annexin II mediates binding to F-actin. J. Biol. Chem. 276, 5310 –5453 Received for publication January 30, 2012. Accepted for publication May 8, 2012.

3727