Antibiotic resistance and virulence of enterococci

Antibiotic resistance and virulence of enterococci isolates from healthy humans in Tunisia Rym Ben Sallem, Naouel Klibi, Amira Klibi, Leila Ben Said, Raoudha Dziri, Abdelatif Boudabous, Carmen Torres & Karim Ben Slama Annals of Microbiology ISSN 1590-4261 Volume 66 Number 2 Ann Microbiol (2016) 66:717-725 DOI 10.1007/s13213-015-1157-3

1 23

Your article is protected by copyright and all rights are held exclusively by SpringerVerlag Berlin Heidelberg and the University of Milan. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to selfarchive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.

1 23

Author's personal copy Ann Microbiol (2016) 66:717–725 DOI 10.1007/s13213-015-1157-3

ORIGINAL ARTICLE

Antibiotic resistance and virulence of enterococci isolates from healthy humans in Tunisia Rym Ben Sallem 1 & Naouel Klibi 1 & Amira Klibi 1 & Leila Ben Said 1 & Raoudha Dziri 1 & Abdelatif Boudabous 1 & Carmen Torres 2,3 & Karim Ben Slama 1,4

Received: 5 March 2015 / Accepted: 14 September 2015 / Published online: 2 October 2015 # Springer-Verlag Berlin Heidelberg and the University of Milan 2015

Abstract The aim of this work was to determine the occurrence of different enterococcal species and the prevalence of antimicrobial resistance and virulence genes in enterococci isolates recovered from faecal samples of 98 healthy human volunteers in Tunisia. Isolates were tested for antibiotic resistance phenotypes, genotypes and virulence genes. In addition, high-level aminoglycoside resistant (HLAR) Enterococcus faecalis and Enterococcus faecium isolates were tested for clonal diversity by pulsed field gel electrophoresis (PFGE). The following species were detected among the 98 enterococci obtained: 51 Enterococcus faecalis, 40 Enterococcus faecium, 4 Enterococcus mundtii and 3 Enterococcus gallinarum. Antibiotic resistance was detected as follows (% in E. faecalis/E. faecium): erythromycin (51 %/55 %), tetracycline (51 %/15 %), pristinamycin (51 %/27.5 %), gentamicin (19.6 %/10 %), kanamycin (25.5 %/12.5 %), streptomycin (29.4 %/7.5 %), chloramphenicol (7.8 %/2.5 %). The tet(M)+/ −tet(L) genes were found in 92 % and 83 % of tetracyclineresistant E. faecalis and E. faecium isolates, respectively. High-level resistance for kanamycin and gentamicin was Rym Ben Sallem and Naouel Klibi contributed equally to this work. * Karim Ben Slama [email protected] 1

Laboratoire des Microorganismes et Biomolécules actives, Faculté de Sciences de Tunis, Université de Tunis El Manar, 2092 Tunis, Tunisie

2

Área de Bioquímica y Biología Molecular, Universidad de La Rioja, Logroño, Spain

3

Área de Microbiología Molecular, Centro de Investigación Biomédica de La Rioja, Logroño, Spain

4

Institut Supérieur des Sciences Biologiques Appliquées de Tunis, Université de Tunis El Manar, 2092 Tunis, Tunisie

mediated by aph(3′)-IIIa and aac(6′)-aph(2″) genes. Of erythromycin-resistant enterococci, 85 % harboured the erm(B) gene. The erm(C) gene was found in one erythromycin-resistant E. mundtii isolate. Most high-level gentamicin and/or streptomycin E. faecalis and E. faecium isolates showed unrelated patterns by PFGE. Fifty-two percent of enterococci showed a multidrug-resistant phenotype. The following virulence genes were detected among the 98 enterococci: gelE (13.2 %), esp (20.4 %), cyl (9 %, showing haemolytic activity), ace (48.9 %), and hyl (0 %). In conclusion, E. faecalis and E. faecium are the predominant enterococcal species in the faecal environment of healthy humans, and they present high rates of resistance for antibiotics of clinical relevance, such as aminoglycosides. Keywords Enterococci . Healthy humans . Tunisia . Antibiotic resistance . Virulence genes

Introduction The high use of antimicrobial agents, in both human and animal medicine, is recognised as an important risk factor for the increase in antibiotic resistance by helping to select resistant bacteria and also inducing substantial responsive changes in the natural microbiota of human and animal intestinal tracts (Acar and Rostel 2001; Hammerum 2012). The human intestinal tract harbours a complex and dynamic microbiota representing about 1011 bacteria per gram stool. Over 1000 species are represented within the intestinal microbiota of humans (Bik 2009), including opportunistic pathogens such as enterococci, which are natural members of the gut microbiota but capable of acquiring virulence and antibiotic resistance genes (Fisher and Phillips 2009; Clementi and Aquilanti 2011). Enterococci are found in high concentrations

Author's personal copy 718

in human faeces and can serve as a reservoir for cycles of transmission and spread of antibiotic resistance determinants (Boehm and Sassoubre 2014). The level of antibiotic resistance in faecal enterococci is considered a good indicator of the selective pressure exerted by antibiotic use (Fisher and Phillips 2009; Clementi and Aquilanti 2011; Nilsson 2012; Lebreton et al. 2013). Due to their ubiquity in human faeces and persistence in the environment, enterococci are also considered as good indicators of faecal pollution (Boehm and Sassoubre 2014). Enterococci have been recognised as a leading cause of nosocomial infections, the majority of which are caused by the species Enterococcus faecalis and Enterococcus faecium, although other enterococcal species may also cause infections (Cetinkaya et al. 2000; Fisher and Phillips 2009). These bacteria are responsible for diverse types of infections, such as endocarditis, urinary tract infections or hospital acquired bacteraemia, among others (Fisher and Phillips 2009). Enterococci can show intrinsic or acquired resistance to several antimicrobials, such as glycopeptides, β-lactams, and fluoroquinolones, and can exhibit high levels of resistance (HLR) to aminoglycosides (e.g. gentamicin and streptomycin), leading to drastically reduced therapeutic options for patients infected with these microorganisms. Thus, these bacteria are regarded as important opportunistic pathogens of clinical relevance (Arias et al. 2010; Clementi and Aquilanti 2011). The problem of antimicrobial resistance in enterococci is not only restricted to the clinical setting but also to other environments such as the intestinal tract of animals or food of animal origin (Silva et al. 2012; Klibi et al. 2013, 2015), and thus may be transferred to humans, either by ingestion of contaminated food or from the environment (Donabedian et al. 2003; Heuer et al. 2006). Subsequent emergence of infections in humans caused by resistant bacteria that originate from the animal reservoir is of great concern. In fact, results from previous studies showed that transfer of resistance genes from enterococci of animal origin to enterococci of human origin occurs through the food chain (Wegener et al. 1999; Donabedian et al. 2003; Lester et al. 2006). Different studies have been performed in different countries in which antibiotic resistance of faecal enterococci of healthy humans have been analysed (Aarestrup et al. 2000; Del Campo et al. 2003; Poeta et al. 2006; Novais et al. 2006; López et al. 2013). These studies have revealed that commensal enterococci isolated from gut microbiota form a large reservoir of antibiotic resistance genes. Genes providing resistance to different antibiotic classes such us tetracycline (tetM, tetL), vancomycine (vanC, vanA), pristinamycin (vatD, vatE), and erythromycin (ermB, ermC) are present in faecal

Ann Microbiol (2016) 66:717–725

samples collected from healthy individuals in Spain, Denmark and Portugal. The current study is the first to assess resistance phenotypes and resistance genes in Enterococcus spp. from healthy humans in Tunisia.

Materials and methods Samples and bacterial isolates Faecal samples of 98 human volunteers (age range: 6 months to 70 years) were collected during December 2009 to March 2010. Individuals tested were living in five different urban areas of Tunisia (city/location/number of samples): Tunis/North-Eastern/ 57, Sfax/South-Eastern/16, El Kef/ North-Western/12, Gafsa/South-Eastern/10, and Kairouan/ North-Central/3). None of the individuals included in the study suffered infections or had taken antibiotics during the 3 months prior to sample collection, and all gave their consent for participation in this study. Nine of the individuals were farmers or veterinarians and six were medical doctors or sanitary personnel related with hospitals. The remaining 83 healthy individuals had no connection with the animal or the hospital environment (Table 1). Sample swabs were inoculated into 3 mL sterile saline solution, and an aliquot of 100 μL was seeded onto SlanetzBartley (SB) agar plates. These plates were incubated for 48 h at 37 °C, and colonies with a typical enterococcal morphology were identified by both classical biochemical methods (Gram staining, bile-esculin and hypersaline reaction) and by PCR using specific primers for the different enterococcal species (Table 2). Antibiotic susceptibility testing Susceptibility testing for 12 antibiotics was performed by the disc diffusion method as previously recommended (CLSI 2015; CA-SFM 2015). Antimicrobials tested were as follows (microgram per disc): vancomycin (30), teicoplanin (30), ampicillin (10), chloramphenicol (30), tetracycline (30), erythromycin (15), pristinamycine (15) and trimethoprim–sulfamethoxazole [SXT] (1.25+23.75). Detection of high-level aminoglycoside resistance (HLAR) was performed with high charge disks of gentamicin (Gen, 500 μg), kanamycin (Kan, 1000 μg) and streptomycin (Str, 500 μg) (CA-SFM 2015). Minimal inhibitory concentrations (MIC) of vancomycin, teicoplanin, ampicillin and erythromycin were also determined by the agar dilution method. The strain E. faecalis ATCC 29212 was used as quality control for all susceptibility testing. The β-lactamase activities produced by all ampicillinresistant isolates were analyzed with nitrocefin paper disks

Author's personal copy Ann Microbiol (2016) 66:717–725 Table 1

719

Characteristics of 98 human volunteers

Date of isolation

Number of individuals tested Age range

Sex

City

Individuals having relation with the animal or the hospital environment

28 December 2009 9

5–70

Male (n=5); female (n=4) Tunis

Veterinarian (n=2) ; anesthesia technician (n=1)

3 January 2010

10

1–55

Male (n=3); female (n=7) Sfax

Doctors (n=3)

5 January 2010 7 January 2010

6 4

8–43 20–43

Female (n=6) Sfax Male (n=2); female (n=2) Tunis

– Farmer (n=1)

9 January 2010 15 January 2010

10 7

20–58 8–68

Male (n=7); female (n=3) Tunis Male (n=5); female (n=2) Tunis

Farmers (n=6) – –

29 January 2010

12

6–52

Male (n=5); female (n=7) Kef

5 February 2010 7 February 2010

5 3

1–60 5–33

Male (n=4); female (n=1) Gafsa Nurse (n=1) Male (n=2); female (n=1) kairouan

12 February 2010

8

6 months–5 years Male (n=4); female (n=4) Tunis

–

27 February 2010

4

33–36

Nurse (n=1)

5 February 2010 17 February 2010 24 February 2010

10 5 5

15–42 21–30 1–56

Male (n=2); female (n=2) Tunis Male (n=5); female (n=5) Tunis Male (n=1); female (n=4) Gafsa Male (n=4); female (n=1) Tunis

(BioMérieux, Marcy L’Étoile, France). Staphylococcus aureus ATCC 29213 was used as a positive control.

PCR reactions were performed using positive and negative controls.

Detection of antibiotic resistance genes by PCR

Production of gelatinase and haemolysin

The presence of antibiotic resistance encoding genes was analysed by PCR in all enterococcal isolates using specific primers as described previously (Portillo et al. 2000; Klibi et al. 2013). The genomic DNA of enterococci was obtained with a commercial system (Instagene Matrix, Bio-Rad; http:// www.bio-rad.com). The genes studied were the following: aac(6′)-aph(2″), aph(3′)-IIIa, ant(6)-Ia, erm(A), erm(B), erm(C), msrA, tet(M), tet(L),tet(K), vat(D) and catpIP501. All

To detect gelatinase activity, enterococci were inoculated on blood agar plates containing 3 % gelatin (Difco, Detroit, MI), which were then incubated at 37 °C for 24 h. Gelatinase activity was observed as a transparent halo around the colonies after the plate was flooded with Frazier solution (Klibi et al. 2007). To investigate haemolysin production, isolates were streaked onto fresh horse blood agar plates and grown overnight at 37 °C. A clear zone of beta-haemolysis around the

Table 2

Primers used in PCR reactions for identification of enterococcal species

Primer name

Sequence (5′→3′)

Amplicon (bp)

Reference

Enterococcus faecalis; ddl

F: ATCAAGTACAGTTAGTCT R: ACGATTCAAAGCTAACTG F: TAGAGACATTGAATATGCC R: TCGAATGTGCTACAATC F: CGTCAGTACCCTTCTTTTGCAGAGTCGTGGTTG R: GCATTATTTACCAGTGTTA F: AACAGCTTACTTGACTGGACGC R: GTATTGGCGCTACCCCGTAC F: GGTATCAAGGAAACCTC R: CTTCCGCCATCATAGCT F: CTCCTACGATTCTCTTG R: CGAGCAAGCAATTTAAG F: CAGACATGGATGCATTTCCATCT R: GCCATGATTTTCCAGAAGAAT

941

Dutka-Malen et al. 1995

550


500

Arias et al. 2006

177

Arias et al. 2006

822


439


98

Jackson et al. 2004

Enterococcus faecium; ddl Enterococcus hirae; mur-2 Enterococcus durans; mur2ed Enterococcus gallinarum; VanC1 Enterococcus casseliflavus; VanC2/C3 Enterococcus mundtii; MU


streak was considered a positive reaction for haemolysin production. Detection of virulence genes by PCR Specific primers were used in this study for amplification by PCR of gelE (gelatinase), ace (adhesion to collagen of E. faecalis), cyl (cytolysin), esp (enterococcal surface protein) and hyl (glycosil-hydrolase) genes encoding virulence factors (Klibi et al. 2007). Pulsed-field gel electrophoresis Genomic DNA of high-level gentamicin and/or streptomycin resistant (HLR-Gen and HLR-Str, respectively) E. faecium and E. faecalis strains was prepared as described previously (Klibi et al. 2013). One colony of the tested isolate was incubated on 1 mL BHIA at 37 °C for 24 h, 200 μL of the suspension was centrifuged for 5 min at 8000 rpm/min, and 1 mL TE was added to the precipitate. The suspension was then mixed with an equal volume of 2 % pulsed-field certified agarose gel (Bio-Rad) and poured into a mould to obtain the block. For restriction endonuclease digestion of whole genomic DNA, small slices of agarose blocks were placed in a mixture containing 88 μL distilled water, 11 μL 10x reaction buffer and 10 U SmaI. The preparations were incubated overnight at 25 °C. After digestion and washing, the blocks were placed in wells containing 1.2 % pulsed-field-certified agarose gel made with 0.5x Tris-borate-EDTA buffer. The gel was electrophoresed with a clamped homogeneous electric field using a CHEF-DR-III apparatus (Bio-Rad). The total run time was 23 h, the switch time was 5 s to 40 s, and the voltage for the run was 6 V/cm. The gel was stained with ethidium bromide and photographed using a UV light source. Banding patterns were compared by visual analysis and through the use of GelCompar II program (version 6.5 Applied Maths, Ghent, Belgium) (Turabelidze et al. 2000). Lambda Ladder (BioLabs, https://www.neb.com) was used as a pulsed-field gel electrophoresis (PFGE) marker.

Results and discussion The 98 enterococci recovered in this study were identified as follows: E. faecalis and E. faecium were the predominant species (51 and 40 isolates, respectively) followed by E. mundtii (4 isolates) and E. gallinarum (3 isolates). These results are consistent with previous reports performed in healthy humans (Poeta et al. 2006; Novais et al. 2006; Barreto et al. 2009; Mitsou et al. 2010; Kirtzalidou et al. 2012; Birri et al. 2013). It is significant that E. faecium and E. faecalis are the most predominant species among enterococci causing human

Ann Microbiol (2016) 66:717–725

diseases. These two species have also developed resistance to a wide variety of clinically important antibiotics, and are a leading cause of healthcare-associated infections. All the other enterococcal species together, including E. gallinarum, E. casseliflavus, E. avium and E. mundtii, constitute less than 5 % of enterococcal infections (Klibi et al. 2006; Fisher and Phillips 2009). Table 3 shows the percentages of resistance to 12 antibiotics in the series of enterococcal isolates according to species. The presence of antibiotic resistance genes as determined by PCR in all resistant enterococci is presented in Table 4. Most of our erythromycin-resistant enterococci carried the erm(B) gene (44 of 52 isolates, 84.6 %), and one E. mundtii isolate harboured the erm(C) gene. Meanwhile the erm(A) and msr(A) genes were not identified in our enterococcal collection. The erm(B) gene has also been found frequently by other authors in erythromycin-resistant enterococcal isolates of different species and origins. Thus, its acquisition can occur through the transfer of broad host range plasmids, or through the movement of transposons, and could play a predominant role in the development of high-level erythromycin resistance in Enterococcus (Novais et al. 2006; Barreto et al. 2009; Mitsou et al. 2010; Klibi et al. 2012, 2013, 2015). Among 26 E. faecalis showing phenotypic resistance to tetracycline, 18 (70 %) were positive for the gene encoding the ribosomal protection protein tet(M); this gene was also found alone in two (33.5 %) of the six E. faecium isolates and in the unique tetracycline resistant E. gallinarum analysed. The gene tet(L), which encode a tetracycline efflux pump, was amplified in association with the gene tet(M) in six E. faecalis and in three E. faecium isolates. This association was also observed previously in enterococci isolated from healthy growing children (Barreto et al. 2009) and from food-producing animals (Klibi et al. 2015). The tet(K) gene was not detected in our collection. Tetracycline and erythromycin have been used frequently for treatment of humans in hospital and in the community, which explains the frequent occurrence of resistance to these antimicrobial agents (Mitsou et al. 2010; Birri et al. 2013). Regarding resistance to pristinamycin, we found a low resistance rate among E. faecium (n=11) and E. mundtii isolates (n = 1). The vat(D) gene was detected in 4 of the 11 pristinamycin-resistant E. faecium isolates (36.5 %), and the vat(E) gene was absent in all the pristinamycin-resistant enterococci. Other mechanisms of resistance could be involved in those pristinamycin resistant E. faecium isolates with no resistance genes detected, as is also suggested by other authors (Klibi et al. 2013). All chloramphenicol-resistant E. faecalis isolates (n=4) harbored the catpIP501 gene; this gene was not detected in the unique E. faecium resistant isolate. This resistance gene seems to be widespread in enterococci of different origins (Aarestrup et al. 2000; Poeta et al. 2006; Klibi et al. 2006, 2013; Barreto

Author's personal copy Ann Microbiol (2016) 66:717–725 Table 3

721

Percentage of antibiotic resistancea in the series of 98 enterococci recovered from healthy humans

Antimicrobial agent

Percentage (%) of antibiotic resistance E. faecalis (n=51)

E. faecium (n=40)

Other species (n=7)

Ampicillin Tetracycline

0 51

2.5 15

14.3 14.3

Chloramphenicol Erythromycin

7.8 51

2.5 55

0 57

Pristinamycin

51

27.5

14.3

Trimethoprim-sulfamethoxazole

72.5

77.5

71.4

Vancomycin Teicoplanin

0 0 19.6 29.4 25.5

0 0 10 7.5 12.5

3b 0 0 14.3 0

41.2

42.5

0

Gentamicinc Streptomycinc Kanamycinc Ciprofloxacin a

Resistance was detected by disk diffusion method

b

Three E. gallinarum isolates showed vancomycin MICs of 8 μg/mL

c

High level resistance (HLR)

et al. 2009). Ampicillin resistance was detected in only two isolates (one E. faecium and one E. gallinarum) and none of these produced β-lactamase activity. Two mechanisms of beta-lactam resistance have been reported in enterococci: (1) beta-lactamase production, although this is very unusual in enterococci (Mazzulli et al. 1992); and (2) a change in the affinity of penicillin-binding proteins for beta-lactams or overproduction of specific penicillin-binding proteins (PBPs) (Klibi et al. 2008). Our ampicillin-resistant enterococci did not produce beta-lactasmases, and the most probable mechanism of resistance could be related to modifications in PBPs. Very high percentages of resistance to trimethoprimsulfamethoxazole (73.8 %) were demonstrated among all enterococcal species, similar to those reported in previous works (Del Campo et al. 2003; Barreto et al. 2009). A total of 38 isolates was resistant to ciprofloxacin (21 E. faecalis and 17 E. faecium). High-level gentamicin, streptomycin or kanamycin resistance was observed at a high rate among our E. faecium (10, 7.5 and 12.5 %, respectively), and E. faecalis (19.60, 29.41 and 25.5 %, respectively) isolates. The predominant aminoglycoside-resistant phenotype found in E. faecalis and E. faecium isolates was StrR-KanR (25.5 % and 7.5 %, respectively) followed by StrR-KanR-GenR (19.6 % and 10 %, respectively). These data are especially relevant considering the importance of aminoglycosides in the treatment of severe enterococcal infections. HLR for aminoglycosides in enterococci varies substantially in other studies depending on the geographic location and the setting; in this sense, frequencies of 2 % have been reported for HLR-Gen in stool samples from healthy humans in Portugal and frequencies of 4 % for HLR-

Str (Poeta et al. 2006). However, our results are similar to those reported in clinical strains in Tunisia (Klibi et al. 2006). All 14 of our HLR-Gen E. faecalis and E. faecium isolates harbored the aac(6′)-aph(2″) gene (Table 4). The aph(3′)-IIIa and ant(6)-Ia genes were identified in 44.5 % and 31.57 % of HLR-Kan and HLR-Str isolates, respectively. The aac(6′)aph(2″), aph(3′)–IIIa and ant(6)-Ia genes were found together in six isolates exhibiting a phenotype of resistance that included StrR-GenR-KanR. The aac(6′)-aph(2″) gene has been demonstrated previously as a common mechanism of HLR-Gen in enterococci (Aarestrup et al. 2000; Del Campo et al. 2003; Barreto et al. 2009). The combination of different genes encoding aminoglycoside modifying enzymes in enterococci is relatively frequent as has been reported previously (Del Campo et al. 2003; Novais et al. 2006). The absence of common resistance genes in some isolates resistant to streptomycin, pristinamycin, chloramphenicol, tetracycline and erythromycin suggests that other unknown resistance mechanisms may exist in the community that should be evaluated in the future. Resistance to at least one agent in three or more antimicrobial classes defining multidrug resistance (MDR) (Magiorakos et al. 2012) was found in 52 % (51/98) of our enterococci. The most common MDR phenotype corresponded to pristinamycin, erythromycin, trimethoprim-sulfamethoxazole and tetracycline noted in six enterococci (11.76 %) followed by resistance to pristinamycin, erythromycin, trimethoprim-sulfamethoxazole, tetracycline and ciprofloxacin, which was noted in four enterococci (7.8 %). Resistance to erythromycin and to trimethoprimsulfamethoxazole was found in 22 of 51 MDR isolates (43.1 %). Similarly, 37.2, 35.3, 31.7, and 11.76 % of MDR

Author's personal copy 722 Table 4 Antibiotic resistance genes detected by PCR in the series of 98 Enterococcus isolates according to their antibiotic resistance patterns

Ann Microbiol (2016) 66:717–725

Resistance to:

Species

Number of isolates

Erythromycin

erm(A)

erm(C)

NDa

26

25

–

–

1

E.faecium Others

22 4

16 3

– –

– 1

6 0

E. faecalis E.faecium

26 6

Others

tet(M)

tet(M)+tet(L)

ND

18 2

6 3

2 1

1

1

–

– ND

E. faecalis

4

cat 4

E.faecium Others

1 0

–

1

10 4

– –

Chloramphenicol

Gentamicin

aac(6′)-aph(2″) E. faecalis E.faecium

10 4

Others E. faecalis

0 aph(3′)-IIIa 13

E.faecium Others

5 0

E. faecalis E.faecium

15 3

Others E. faecalis E.faecium Others

Kanamycin

Streptomycin

a

erm(B) E. faecalis

Tetracycline

Pristinamycin

Resistance genes detected by PCR

ND

6

aac(6′)-aph(2″) 10

2

4

ND

ant(6)-Ia 6 –

ND 9 3

1

– vatD

1 ND

26 11 1

17 4 1

9 7 –

No studied genes were detected

isolates showed resistance to ciprofloxacin, pristinamycin, tetracycline and gentamicin, respectively. This finding is of particular concern since the high prevalence of colonisation and/or infection with MDR enterococci has reduced treatment options for these bacteria. Others studies referred to the occurrence of MDR phenotype in enterococci of human and animal origin (Poeta et al. 2005; Novais et al. 2006). Three E. gallinarum isolates were identified in our collection of enterococci. Similar to previous works in Tunisia (Klibi et al. 2006, 2013, 2015), no enterococci with acquired mechanisms of glycopeptides resistance were identified in this study. Some previous reports referred the presence of enterococci with intrinsic mechanisms of resistance in healthy children (Barreto et al. 2009; Kirtzalidou et al. 2012), and some others noted the occurrence of acquired vancomycin-resistant enterococci in healthy humans (Del Campo et al. 2003; Poeta et al. 2005; Novais et al. 2006; Freitas et al. 2011). Several virulence determinants, such as surface antigens, adhesins, pheromones and cytolysin production, have been

identified and analysed in enterococci from different origins (clinical, food and animal sources). However, there appears to be little information about their occurrence among the human intestinal enterococci (Creti et al. 2004; Klibi et al. 2007, 2013). Previous studies have shown that the presence of virulence genes in commensal isolates might be part of a survival mechanism that ensures greater genetic diversity, increasing their survival capability in the host animal (Chapman et al. 2006). In our study, virulence factors were detected frequently and at higher frequency frequency in E. faecalis isolates (79 %) than among E. faecium isolates (46.5 %) (Table 5). Eight E. faecalis and one E. gallinarum isolates that showed haemolytic activity harboured all the cyl genes. Haemolysin is a cytolytic protein capable of lysing human, horse and rabbit erythrocytes. Haemolysin-producing strains are found associated with increased severity of infections (Van Tyne et al. 2013). The detection of gelatinase activity was not correlated strictly with the amplification of the gelE gene, as this gene

Author's personal copy Ann Microbiol (2016) 66:717–725 Table 5 Detection of virulence genes among the 98 enterococci of healthy humans

723

Virulence gene

E. faecalis (n=51)

E. faecium (n=40)

E. gallinarum (n=3)

E. mundtii (n=4)

gelE esp

10 13

3 7

0 0

0 0

cyl (M, A, B) ace

8 33

0 14

1 0

0 1

hyl

0

0

0

0

gelE+esp+ace

3

0

0

0

was amplified by only 12 of 26 (46.15 %) strains that exhibited gelatinase activity. It is interesting to note that gelatinase activity could not be detected in 1 out of the 13 strains possessing the gelE determinants, thus suggesting the presence of silent gelE genes. In this case, the presence of gelE is apparently not enough for gelatinase activity, and a complete fsr operon seems to be essential for gelE expression. This finding agrees with previous results showing that the loss of expression of this virulence factor under laboratory conditions was correlated with the loss of one or more genes of the fsr operon involved in the regulation of gelE expression (Klibi et al. 2007). The hyl.gene was absent from our entire enterococci collection. According to previous studies (Laverde Gomez et al. 2010), this gene is located on a megaplasmid that is distributed widely among clinically associated E. faecium isolates and seems to be restricted to this species. The low frequency of haemolytic and gelatinase activities found, as well as the absence of the hyl gene in our study seems to differentiate the intestinal isolates from clinical strains (Klibi et al. 2007; López et al. 2013). Interestingly,the esp gene was relatively frequent among our isolates (25.5 % E. faecalis isolates, and 17.5 % in E. faecium). In contrast, other authors reported that clinical strains showed high production of biofilm and esp gene in comparison with commensal enterococcal isolates (Upadhyaya et al. 2011). Similarly, the ace gene, which codes for a putative protein with characteristics similar to those of a % similarity

strain

collagen-binding protein of Staphylococcus aureus, was present in 64.7 % of our E. faecalis isolates and in 35 % of E. faecium isolates. The fact that esp and ace genes seem to be rather common in food-related Enterococcus could contribute to their occurrence also in intestinal strains (Franz et al. 2001; Klibi et al. 2013). In this study, we have not noted any correlation between virulence factors, multiresistance patterns and the origin of samples. The genetic diversity of the 14 E. faecalis and 4 E. faecium isolates tha exhibited HLAR, was analyzed by PFGE using the SmaI restriction enzyme. A high diversity of PFGE patterns was detected among these enterococcal isolates. All four E. faecium isolates showed unrelated PFGE-patterns. In relation to the 14 E. faecalis isolates, they were differentiated into 13 types (Fig. 1); showing less than 80 % similarity except for two isolates with possibly related PFGE patterns. According to these results, HLAR enterococci show a high genetic diversity. This is not the result of the dissemination of specific clones among the community but probably derives rather from the dissemination of plasmids harbouring the genes encoding aminoglycoside-modifying enzymes in diverse enterococcal clones. Further studies would allow the characterisation of these plasmids carrying aminoglycoside resistance genes of clinical relevance, as aph(2″)-aac(6′), in enterococci of different origins. In summary, healthy individuals are colonised frequently by enterococci enriched in antibiotic resistance genes and in

Resistance phenotypes

Fig. 1 Dendrogram obtained by the unweighted pair group method with arithmetic mean (UPGMA) showing the different pulse field gel electrophoresis (PFGE)-SmaI patterns of the 14 Enterococcus faecalis

Resistance genes

Virulence genes

strains of healthy humans which showed high-level resistance to aminoglycosides, in relation to the antibiotic resistance phenotype and genotype and the carriage of virulence genes of isolates


virulence determinants and the potential impact on human health of this reservoir of genes should be evaluated in the future. Acknowledgements This work was supported partially by a Project from the Tunisian Ministry of Higher Education and Scientific Research. The authors thank the Dr. Oussama Bouallegue for help with sample collection.

References Aarestrup FM, Agerso Y, Gerner-Smidt P, Madsen M, Jensen LB (2000) Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn. Microbiol Infect Dis 37:127–137 Acar J, Rostel B (2001) Antimicrobial resistance: an overview. Rev Sci Tech 20:797–810 Arias CA, Robredo B, Singh KV, Torres C, Panesso D, Murray BE (2006) Rapid identification of Enterococcus hirae and Enterococcus durans by PCR and detection of a homologue of the E. hirae mur2 gene in E. durans. J Clin Microbiol 44:1567–1570 Arias CA, Contreras GA, Murray BE (2010) Management of multidrugresistant enterococcal infections. Clin Microbiol Infect 16:555–562 Barreto A, Guimarães B, Radhouani H, Araújo C, Gonçalves A, Gaspar E, Rodrigues J, Igrejas G, Poeta P (2009) Detection of antibiotic resistant E. coli and Enterococcus spp. in stool of healthy growing children in Portugal. J Basic Microbiol 49:503–519 Bik EM (2009) Composition and function of the human-associated microbiota. Nutr Rev 67(Suppl 2):S164–S171 Birri DJ, Brede DA, Tessema GT, Nes IF (2013) Bacteriocin production, antibiotic susceptibility and prevalence of haemolytic and gelatinase activity in faecal lactic acid bacteria isolated from healthy Ethiopian infants. Microb Ecol 65:504–516 Boehm AB, Sassoubre LM (2014) Enterococci as indicators of environmental fecal contamination. In Gilmore MS, Clewell DB, Ike Y, Shankar N (eds). Enterococci: from commensals to leading causes of drug resistant infection [Internet]. Massachusetts Eye and Ear Infirmary, Boston, Available from: http://www.ncbi.nlm.nih.gov/ books/NBK190421/ CA-SFM (2015) Comité de l’Antibiogramme de la Société Française de Microbiologie. Edition Janvier 2015 Cetinkaya Y, Falk P, Mayhall C (2000) Vancomycin-resistant enterococci. Clin Microbiol Rev 13:686–707 Chapman TA, Wu XY, Barchia I, Bettelheim KA, Driesen S, Trott D, Wilson M, Chin JJ (2006) Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine. Appl Environ Microbiol 72:4782–4795 Clementi F, Aquilanti L (2011) Recent investigations and updated criteria for the assessment of antibiotic resistance in food lactic acid bacteria. Anaerobe 17:394–398 CLSI (2015) Performance Standards for antimicrobial susceptibility testing; twenty-second informational Supplement. In: CLSI document M100-S22. Clinical and Laboratory Standards Institute, Wayne, PA Creti R, Imperi M, Bertuccini L, Fabretti F, Orefici G, Di Rosa R, Baldassarri L (2004) Survey of virulence determinants among Enterococcus faecalis isolated from different sources. J Med Microbiol 53:13–20 Del Campo R, Ruiz-Garbajosa P, Sanchez-Moreno MP, Baquero F, Torres C, Canton R, Coque TM (2003) Antimicrobial resistance in recent fecal enterococci from healthy volunteers and food handlers in Spain: genes and phenotypes. Microb Drug Resist 9:47–60

Ann Microbiol (2016) 66:717–725 Donabedian SM, Thal LA, Hershberger E, Perri MB, Chow JW, Bartlett P, Jones R, Joyce K, Rossiter S, Gay K, Johnson J, Mackinson C, Debess E, Madden J, Angulo F, Zervos MJ (2003) Molecular characterization of gentamicin-resistant enterococci in the United States: evidence of spread from animals to humans through food. J Clin Microbiol 41:1109–1113 Dutka-Malen S, Evers S, Courvalin P (1995) Detection of glycopeptides resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol 33:24–27 Fisher K, Phillips C (2009) The ecology, epidemiology and virulence of Enterococcus. Microbiology 155:1749–1757 Franz CM, Muscholl-Silberhorn AB, Yousif NM, Vancanneyt M, Swings J, Holzapfel WH (2001) Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl Environ Microbiol 67:4385–4389 Freitas AR, Coque TM, Novais C, Hammerum AM, Lester CH, Zervos MJ, Donabedian S, Jensen LB, Francia MV, Baquero F, Peixe L (2011) Human and swine hosts sharevancomycin-resistant Enterococcus faecium CC17 and CC5 and Enterococcus faecalis CC2 clonal clusters harboring Tn1546 on indistinguishable plasmids. J Clin Microbiol 49(3):925–931 Hammerum AM (2012) Enterococci of animal origin and their significance for public health. Clin Microbiol Infect 18:619–625 Heuer OE, Hammerum AM, Collignon P, Wegener HC (2006) Human health hazard from antimicrobial-resistant enterococci in animals and food. Clin Infect Dis 43:911–916 Jackson CR, Fedorka-Cray PJ, Barrett JB (2004) Use of a genus and species-specific multiplex PCR for identification of enterococci. J Clin Microbiol 42:3558–3565 Kirtzalidou EI, Mitsou EK, Pramateftaki P, Kyriacou A (2012) Screening faecal enterococci from Greek healthy infants for susceptibility to antimicrobial agents. Microb Drug Resist 18:578–585 Klibi N, Gharbi S, Masmoudi A, Ben Slama K, Poeta P, Zarazaga M, Fendri C, Boudabous A, Torres C (2006) Antibiotic resistance and mechanisms implicated in clinical Enterococci in a Tunisian hospital. J Chemother 18(1):20–26 Klibi N, Ben Slama K, Sáenz Y, Masmoudi A, Zanetti S, Sechi LA, Boudabous A, Torres C (2007) Detection of virulence factors in high-level gentamicin-resistant Enterococcus faecalis and Enterococcus faecium isolates from a Tunisian hospital. Can J Microbiol 53:372–379 Klibi N, Sáenz Y, Zarazaga M, Ben Slama K, Masmoudi A, Ruiz-Larrea F, Boudabous A, Torres C (2008) Polymorphism in pbp5 gene detected in clinical Enterococcus faecium strains with different ampicillin MICs from a Tunisian hospital. J Chemother 20:436–440 Klibi N, Ben Slimen N, Fhoula I, López M, Ben Slama K, Daffonchio D, Boudabous A, Torres C, Ouzari H (2012) Genotypic diversity, antibiotic resistance and bacteriocin production of enterococci isolated from rhizospheres. Microb Environ 27:533–537 Klibi N, Ben Said L, Jouini A, Ben Slama K, López M, Ben Sallem R, Boudabous A, Torres C (2013) Species distribution, antibiotic resistance and virulence traits in enterococci from meat in Tunisia. Meat Sci 93:675–680 Klibi N, Aouini R, Borgo F, Ben Said L, Ferrario C, Dziri R, Boudabous A, Torres C, Ben Slama K (2015) Antibiotic resistance and virulence of faecal enterococci isolated from food-producing animals in Tunisia. Ann Microbiol 65:695–702. doi:10.1007/s13213-0140908-x Laverde Gomez JA, Van Schaik W, Freitas AR, Coque TM, Weaver KE, Francia MV, Witte W, Werner G (2010) Multiresistance megaplasmid pLG1 bearing a hylEfm genomic island in hospital Enterococcus faecium isolates. Int J Med Microbiol 301:165–175 Lebreton F, Van Schaik W, McGuire AM, Godfrey P, Griggs A, Mazumdar V, Corander J, Cheng L, Saif S, Young S, Zeng Q, Wortman J, Birren B, Willems RJ, Earl AM, Gilmore MS (2013)

Author's personal copy Ann Microbiol (2016) 66:717–725 Emergence of epidemic multidrug-resistant Enterococcus faecium from animal and commensal strains. mBio 4:1–10 Lester CH, Frimodt-Moller N, Sorensen TL, Monnet DL, Hammerum AM (2006) In vivo transfer of the vanA resistance gene from an Enterococcus faecium isolate of animal origin to an E. faecium isolate of human origin in the intestines of human volunteers. Antimicrob Agents Chemother 50:596–599 López M, Tenorio C, Torres C (2013) Study of vancomycin resistance in faecal enterococci from healthy humans and dogs in Spain a decade after the avoparcin ban in Europe. Zoonoses Public Health 60:160– 167 Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL (2012) Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18:268–281 Mazzulli T, King SM, Richardson SE (1992) Bacteremia due to betalactamase producing Enterococcus faecalis with high-level resistance to gentamicin in a child with Wiskott-Aldrich syndrome. Clin Infect Dis 14:780–781 Mitsou EK, Kirtzalidou E, Pramateftaki P, Kyriacou A (2010) Antibiotic resistance in faecal microbiota of Greek Healthy infants. Benefic Microbes 1:297–306 Nilsson O (2012) Vancomycin resistant enterococci in farm animals— occurrence and importance. Infect Ecol Epidemiol 2:1–8 Novais C, Coque TM, Sousa JC, Peixe LV (2006) Antimicrobial resistance among faecal enterococci from healthy individuals in Portugal. Clin Microbiol Infect 12:1131–1134

725 Poeta P, Costa D, Rodrigues J, Torres C (2005) Study of faecal colonization by vanA-containing Enterococcus strains in healthy humans, pets, poultry and wild animals in Portugal. J Antimicrob Chemother 55(2):278–280 Poeta P, Costa D, Rodrigues J, Torres C (2006) Antimicrobial resistance and the mechanisms implicated in faecal enterococcal strains from healthy humans, poultry and pets in Portugal. Int J Antimicrob Agents 27:131–137 Portillo A, Ruiz-Larrea F, Zarazaga M, Alonso A, Martinez JL, Torres C (2000) Macrolide resistance genes in Enterococcus spp. Antimicrob Agents Chemother 44(4):967–971 Silva N, Igrejas G, Gonçalves A, Poeta P (2012) Commensal gut bacteria: distribution of Enterococcus species and prevalence of E. coli phylogenetic groups in animals and humans in Portugal. Ann Microbiol 62:449–459 Turabelidze D, Kotetishvili M, KregerA MJ, Sulakvelidze A (2000) Improved pulsed-field gel electrophoresis for typingvancomycinresistant enterococci. J Clin Microbiol 38:4242–4245 Upadhyaya GP, Lingadevaru UB, Ligegowda RK (2011) Comparative study among clinical and commensal isolates of Enterococcus faecalis for presence ofesp gene and biofilm production. J Infect Dev Ctries 28:365–369 Van Tyne D, Martin MJ, Gilmore MS (2013) Structure, function, and biology of the Enterococcus faecalis cytolysin. Toxins 5(5):895– 911 Wegener HC, Aarestrup FM, Jensen LB, Hammerum AM, Bager F (1999) Use of antimicrobial growth promoters in food animals and Enterococcus faecium resistance to therapeutic antimicrobial drugs in Europe. Emerg Infect Dis 5:329–335