APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 2006, p. 3046–3049 0099-2240/06/$08.00⫹0 doi:10.1128/AEM.72.4.3046–3049.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Vol. 72, No. 4
Antimicrobial Susceptibility and Characterization of Salmonella Isolates from Processed Bison Carcasses Qiongzhen Li,1 Jerod A. Skyberg,2 Mohamed K. Fakhr,1 Julie S. Sherwood,1 Lisa K. Nolan,2 and Catherine M. Logue1* Department of Veterinary and Microbiological Sciences, North Dakota State University, Fargo, North Dakota 58105,1 and Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, Iowa 500112 Received 7 September 2005/Accepted 17 January 2006
Seventeen Salmonella enterica serovar Hadar isolates recovered from bison were found to possess a range of virulence genes and resistance to tetracycline, gentamicin, sulfamethoxazole, and streptomycin simultaneously. A 1-kb class 1 integron containing the aadA1 gene was identified in all isolates. Pulsed-field gel electrophoresis found that all isolates were closely related, indicating the possibility of cross-contamination during processing. agnostics, Westlake, OH). Table 1 shows the recommended resistance breakpoints (22) and results of antimicrobial susceptibility testing for all isolates tested. All 17 Salmonella serovar Hadar isolates displayed multiresistance to tetracycline, gentamicin, streptomycin, and sulfamethoxazole. No isolates were resistant to the other 14 agents tested. MIC50s, MIC90s, and the range of MICs were calculated to describe the antimicrobial susceptibility profiles observed. It was interesting to note that all the antimicrobial agents tested except ciprofloxacin and gentamicin had the same MIC50 and MIC90. Ceftriaxone, ciprofloxacin, and trimethoprim-sulfamethoxazole were the most active antimicrobial agents against strains tested, with MIC90s of ⱕ0.25, 0.06, and ⱕ0.12 g/ml, respectively. Ampicillin, ceftiofur, and nalidixic acid also exhibited good activity against Salmonella, with MIC90s lower than 2 g/ml. Ciprofloxacin is the drug of choice for treating potentially life-threatening Salmonella infections caused by the multidrugresistant strains in adult persons (16). Recent studies have documented the emergence of ciprofloxacin resistance in Salmonella from foods (20, 24), with nalidixic acid resistance indicated as a first step in the development of resistance to ciprofloxacin (31). Nalidixic acid-resistant Salmonella serovar Hadar usually displayed decreased susceptibility to ciprofloxacin, with MIC90s up to 1 g/ml (31, 32). In our study, both nalidixic acid and ciprofloxacin were highly active against the Salmonella isolates, with MIC90s of ⱕ2 and 0.06 g/ml, respectively. Extended-spectrum cephalosporins, especially ceftriaxone, are also important antimicrobial agents for treating invasive salmonellosis, according to Yan et al. (33). Our study found that all the Salmonella serovar Hadar isolates tested were susceptible to the cephalosporins, with a MIC90 value for ceftriaxone of less than 0.25 g/ml. These findings suggest that resistance among Salmonella organisms from bison is limited to specific drugs but that those used to treat human illness are still effective. The emergence and development of antimicrobial resistance have been linked to the wide use of antimicrobials in veterinary practice (15, 18, 21, 30). In the present study, all the Salmonella serovar Hadar isolates exhibited resistance to tetracycline, gen-
Bison meat is a relatively new, emerging meat species available in U.S. and European meat markets. Our laboratory recently reported the prevalence of Salmonella enterica serovar Hadar, Escherichia coli O157:H7, and Listeria monocytogenes on bison carcasses (19). Compared to other meat species, bison are typically not subjected to subtherapeutic doses of growthpromoting hormones or antibiotics (12), which suggests that microorganisms from bison may have different antimicrobial resistance profiles. In the present study, the antimicrobial susceptibility profiles of Salmonella isolates recovered from bison were determined. The presence and the location of the class 1 integron, as well as the ability to donate resistance genes to other isolates, were also investigated in antimicrobial-resistant isolates. The prevalence of virulence genes, pulsed-field gel electrophoresis (PFGE) profiles, and plasmid profiles were also investigated. (Portions of the data from this study were presented at the 85th Conference of Research Workers in Animal Disease [CRWAD], Chicago, Ill., November 2004.) Seventeen Salmonella serovar Hadar isolates included in this study were recovered from 703 carcass surface swabs as described previously (19). Three isolates were from preevisceration, three were from post-USDA inspection, four were from postwashing, and seven were from carcasses chilled for 24 h. All isolates were collected in the same sampling visit and from bison carcasses processed on two consecutive days. Presence of antimicrobial resistance among Salmonella from bison carcasses. The emergence of multidrug resistance among Salmonella spp. is an increasing concern. Salmonella serovar Hadar has been reported as one of the most resistant Salmonella serotypes (9, 31, 32). Resistance to ampicillin, streptomycin, nalidixic acid, kanamycin, and tetracycline is observed most frequently. In the present study, antimicrobial MICs of all Salmonella isolates were determined using the National Antimicrobial Resistance Monitoring System (NARMS) panel (CMV5CNCD) (Trek Di* Corresponding author. Mailing address: Department of Veterinary and Microbiological Sciences, 130 A Van Es Hall, North Dakota State University, Fargo, ND 58105. Phone: (701) 231-7962. Fax: (701) 231-9692. E-mail:
[email protected]. 3046
CHARACTERIZATION OF SALMONELLA FROM BISON CARCASSES
VOL. 72, 2006
3047
TABLE 1. Antimicrobial resistance phenotypes of Salmonella isolates recovered from bison Concn (g/ml)
Breakpoint (g/ml)
MIC50 (g/ml)
MIC90 (g/ml)
2–32 0.5–32
ⱖ32 ⱖ32/16
ⱕ2 2
ⱕ2 2
1–32 4–32 0.5–16 0.25–64
ⱖ32 ⱖ32 ⱖ8 ⱖ64
4 ⱕ4 1 ⱕ0.25
4 ⱕ4 1 ⱕ0.25
Chloramphenicol
4–32
ⱖ32
ⱕ4
ⱕ4
ⱕ4–8
0 (0)
Tetracycline
4–32
ⱖ16
⬎32
⬎32
⬎32
17 (100)
ⱕ4 4 16 ⱕ16 128
ⱕ4 4 ⬎16 ⱕ16 128
ⱕ4–8 4 ⱖ16 ⱕ16 64–128
0 (0) 0 (0) 17 (100) 0 (0) 17 (100)
Antimicrobial
Penicillins Ampicillin Amoxicillin-clavulanic Cephalosporins Cephalothin Cefoxitin Ceftiofur Ceftriaxone
Aminoglycosides Amikacin Apramycin Gentamicin Kanamycin Streptomycin
4–32 2–32 0.25–16 16–64 32–256
ⱖ64 ⱖ32 ⱖ16 ⱖ64 ⱖ64
Folate pathway inhibitors Sulfamethoxazole Trimethoprim-sulfamethoxazole
128–512 0.12–4
ⱖ512 ⱖ4/76
0.015–4 2–256
ⱖ4 ⱖ32
Quinolones-fluoroquinolones Ciprofloxacin Nalidixic acid
tamicin, streptomycin, and sulfamethoxazole, which are widely used in other animal production environments for the treatment and prevention of disease and growth promotion. The results of this study suggest the persistence of antimicrobial resistance in the absence of selection pressure, which is in agreement with previous studies (1, 23). Presence of class 1 integrons, conjugation experiments, and Southern hybridization. Integrons are mobile DNA elements that can capture and integrate antimicrobial resistance gene cassettes via a site-specific recombination event (2, 14). Class 1 integrons are considered most common in clinical isolates (8, 25). PCR assays were carried out to determine the presence of class 1 integrons (conserved sequence) and integrase (intI) with primers (Table 2) and conditions described previously (1). Results showed that all Salmonella isolates were positive for integrase (intI) and possessed 1 kbp of class 1 integron amplicon. DNA sequencing showed that the integrons contained aadA1 genes, which confer streptomycin-spectinomycin resistance (5). Studies have reported that class 1 integrons were located on a transmissible plasmid and could donate resistance to other isolates (7, 34). Conjugation studies were conducted (4) to determine whether the class 1 integrons were transferable to Salmonella serovar Typhimurium strain 475 by using two antimicrobialresistant Salmonella serovar Hadar strains (35-32 and 36-1) as donors. Results showed that both of the donor strains could not transfer the class 1 integrons to the recipient. Further analysis with Southern hybridization (26, 29) confirmed that the class 1 integron was not located on a plasmid. Similar results have been described by other investigators (10, 27).
MIC range (g/ml)
ⱕ2 ⬍0.5–2 2–4 ⱕ4 1 ⱕ0.25
No. (%) of resistant isolates
0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
⬎512 ⱕ0.12
⬎512 ⱕ0.12
⬎512 ⱕ0.12–0.25
17 (100) 0 (0)
0.03 ⱕ2
0.06 ⱕ2
0.015–0.06 ⱕ2
0 (0) 0 (0)
Presence of 17 virulence genes associated with the pathogenesis of Salmonella. The presence of 17 genes associated with the pathogenesis of Salmonella was detected using PCR assays and the primers (Table 2) and conditions described previously (28). Fourteen genes assayed in this study, including invA, orgA, prgH, spaN (invJ), tolC, sipB, pagC, msgA, spiA, sopB, lpfC, pefA, spvB, and sifA, encode products associated with cellular invasion, survival within a cell, adhesin, or pilus production (28). The remaining genes are associated with other traits important in Salmonella pathogenesis, such as iron acquisition (iroN and sitC) (3, 17) and toxin biosynthesis (cdtB) (13). PCR assays showed that 14 of the 17 genes tested (invA, prgH, orgA, spaN, tolC, sipB, sopB, sitC, sifA, lpfC, iroN, pagC, msgA, and spiA) were found in all of the Salmonella serovar Hadar isolates from bison carcasses. None of the serovar Hadar isolates possessed the spvB, cdtB, or pefA gene. One possible reason for the discrepancy is that all 12 of the genes detected are located on the Salmonella chromosome, while spvB and pefA are located on the Salmonella virulence plasmid (11). A similar study examined the distribution of these 17 virulence genes in Salmonella isolates from sick and healthy birds (28) and found no significant difference in the rates of occurrence of these genes, suggesting that these virulence genes are widely distributed among Salmonella (28). The present study used the same gene panel and also found that Salmonella isolates from bison appear to possess pathogenic potential similar to those of avian species, supporting the wide distribution of these genes.
3048
LI ET AL.
APPL. ENVIRON. MICROBIOL. TABLE 2. Primers for virulence genes, class 1 integrons, and integrase used in this study Primer sequence (5⬘–3⬘)
Gene cdtB lpfC invA orgA pefA prgH sopB tolC msgA pagC spiA spaN
sipB
iroN sitC sifA spvB int1 Conserved sequence
Forward
Reverse
Size (bp)
Reference
ACAACTGTCGCATCTCGCCCCGTCATT GCCCCGCCTGAAGCCTGTGTTGC CTGGCGGTGGGTTTTGTTGTCTTCTCTATT TTTTTGGCAATGCATCAGGGAACA GCGCCGCTCAGCCGAACCAG GCCCGAGCAGCCTGAGAAGTTAGAAA CGGACCGGCCAGCAACAAAACAAGAAGAAG TACCCAGGCGCAAAAAGAGGCTATC GCCAGGCGCACGCGAAATCATCC CGCCTTTTCCGTGGGGTATGC CCAGGGGTCGTTAGTGTATTGCGTGAGATG AAAAGCCGTGGAATCCGTTAGTGAAGT
CAATTTGCGTGGGTTCTGTAGGTGCGAGT AGGTCGCCGCTGTTTGAGGTTGGATA AGTTTCTCCCCCTCTTCATGCGTTACCC GGCGAAAGCGGGGACGGTATT GCAGCAGAAGCCCAGGAAACAGTG TGAAATGAGCGCCCCTTGAGCCAGTC TAGTGATGCCCGTTATGCGTGAGTGTATT CCGCGTTATCCAGGTTGTTGC GCGACCAGCCACATATCAGCCTCTTCAAAC GAAGCCGTTTATTTTTGTAGAGGAGATGTT CGCGTAACAAAGAACCCGTAGTGATGGATT CAGCGCTGGGGATTACCGTTTTG
268 641 1,070 255 157 756 220 161 189 454 550 504
28 28 28 28 28 28 28 28 28 28 28 28
GGACGCCGCCCGGGAAAAACTCTC
ACACTCCCGTCGCCGCCTTCACAA
875
28
ACTGGCACGGCTCGCTGTCGCTCTAT CAGTATATGCTCAACGCGATGTGGGTCTCC TTTGCCGAACGCGCCCCCACACG
CGCTTTACCGCCGTTCTGCCACTGC CGGGGCGAAAATAAAGGCTGTGATGAAC GTTGCCTTTTCTTGCGCTTTCCACCCATCT
1,205 768 449
28 28 28
CTATCAGCCCCGCACGGAGAGCAGTTTTTA CCTCCCGCACGATGATC GGCATCCAAGCAGCAAG
GGAGGAGGCGGTGGCGGTGGCATCATA TCCACGCACTGTCAGGC AAGCAGACTTGACCTGA
717 280 Varied
28 2 2
Function Host recognition/invasion Host recognition/invasion Host recognition/invasion Host recognition/invasion Host recognition/invasion Host recognition/invasion Host recognition/invasion Host recognition/invasion Survival within macrophage Survival within macrophage Survival within macrophage Entry into nonphagocytic cells, killing of macrophages Entry into nonphagocytic cells, killing of macrophages Iron acquisition Iron acquisition Filamentous structure formation Growth within host Class 1 integrase Class 1 integrons
PFGE and plasmid analysis. PFGE and plasmid profile analysis are useful epidemiological tools with which to investigate Salmonella-related outbreaks and trace the origins of the organism. PFGE analysis with the XbaI restriction enzyme (6) revealed four different banding patterns among the 17 isolates, which were grouped into two closely related genetic clusters
(groups A and B) with a similarity of greater than 85%. Group A was seen in 15 of the 17 isolates (88.2%). Group B was seen in 2 of the 17 isolates (Fig. 1). PFGE patterns showed no relationship with the sampling sites where the isolates were recovered. As with the PFGE profiles, the plasmid profiles of all isolates fell into two groups. Fifteen of the 17 isolates
FIG. 1. Genetic relatedness of Salmonella isolates recovered from processed bison carcasses.
VOL. 72, 2006
CHARACTERIZATION OF SALMONELLA FROM BISON CARCASSES
possessed two plasmids with sizes of 3.7 and 70 kb, respectively, while 2 isolates contained four plasmids with sizes of 4.3, 5.7, 63, and 78 kb, respectively (Fig. 1). Further analysis with restriction enzymes EcoRI and HindIII showed that all the isolates that possessed the same plasmid profiles exhibited identical restriction patterns (results not shown). The addition of plasmid profile analysis with PFGE allowed the PFGE patterns to be differentiated into five subgroups, suggesting that plasmid analysis may provide additional information during epidemiological investigations. It was interesting to note that 13 of 17 Salmonella serovar Hadar isolates exhibited very similar PFGE patterns (similarity, ⬎90%), antimicrobial susceptibilities, plasmid profiles, distributions of virulence genes, and class 1 integrons. It appears that cross-contamination most likely occurred during processing and handling, which would account for the isolation of the organism at different stages of processing from different carcasses. However, cross-contamination cannot be the only explanation, as the isolates were recovered from samples processed on two consecutive production days. The bison slaughter line visited in this study was very slow, processing approximately 60 bison per day. Therefore, it is also likely that all of the bison sampled were probably from the same ranch or infected from the same source. This study further concludes that slaughter hygiene practices are critical areas for ensuring the safety of processed bison. We gratefully acknowledge the financial support of USDA CSREES NRICGP project 2002-35207-11574. REFERENCES 1. Aalbaek, B., J. Rasmussen, B. Nielsen, and J. E. Olsen. 1991. Prevalence of antibiotic-resistant Escherichia coli in Danish pigs and cattle. APMIS 99: 1103–1110. 2. Bass, L., C. A. Liebert, M. D. Lee, A. O. Summers, D. G. White, S. G. Thayer, and J. J. Maurer. 1999. Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance in avian Escherichia coli. Antimicrob. Agents Chemother. 43:2925–2929. 3. Ba ¨umler, A. J., T. L. Norris, T. Lasco, W. Voigt, R. Reissbrodt, W. Rabsch, and F. Heffron. 1998. IroN, a novel outer membrane siderophore receptor characteristic of Salmonella enterica. J. Bacteriol. 180:1446–1453. 4. Brackelsberg, C. A., L. K. Nolan, and J. Brown. 1997. Characterization of Salmonella dublin and Salmonella typhimurium (Copenhagen) isolates from cattle. Vet. Res. Commun. 21:409–420. 5. Carattoli, A., L. Villa, C. Pezzella, E. Bordi, and P. Visca. 2001. Expanding drug resistance through integron acquisition by IncFI plasmids of Salmonella enterica Typhimurium. Emerg. Infect. Dis. 7:444–447. 6. Centers for Disease Control and Prevention. 2000. Standardized molecular subtyping of foodborne bacterial pathogens by pulsed-field gel electrophoresis: a manual. National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Ga. 7. Chen, S., S. Zhao, D. G. White, C. M. Schroeder, R. Lu, H. Yang, P. F. McDermott, S. Ayers, and J. Meng. 2004. Characterization of multipleantimicrobial-resistant Salmonella serovars isolated from retail meats. Appl. Environ. Microbiol. 70:1–7. 8. Collis, C. M., G. Grammaticopoulos, J. Briton, H. W. Stokes, and R. M. Hall. 1993. Site-specific insertion of gene cassettes into integrons. Mol. Microbiol. 9:41–52. 9. Cruchaga, S., A. Echeita, A. Aladuen ˜ a, J. Garcı´a-Pen ˜ a, N. Frias, and M. A. Usera. 2001. Antimicrobial resistance in salmonellae from humans, food and animals in Spain in 1998. J. Antimicrob. Chemother. 47:315–321. 10. Daly, M., J. Buckley, E. Power, C. O’Hare, M. Cormican, B. Cryan, P. G. Wall, and S. Fanning. 2000. Molecular characterization of Irish Salmonella enterica serotype Typhimurium: detection of class I integrons and assessment of genetic relationships by DNA amplification fingerprinting. Appl. Environ. Microbiol. 66:614–619.
3049
11. D’Aoust, J.-Y., J. Maurer, and J. Stan Bailey. 2001. Salmonella species, p. 141–178. In M. P. Doyle, L. R. Beuchat, and T. J. Montville (ed.), Food microbiology: fundamentals and frontiers, 2nd ed. ASM Press, Washington, D.C. 12. Food Safety and Inspection Service, U. S. Department of Agriculture. 2003. Focus on bison. [Online.] http://www.fsis.usda.gov/OA/pubs/focusbison.htm. 13. Haghjoo, E., and J. E. Gala ´n. 2004. Salmonella typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterialinternalization pathway. Proc. Natl. Acad. Sci. USA 101:4614–4619. 14. Hall, R. M., and C. M. Collis. 1995. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15:593–600. 15. Holmberg, S. D., M. T. Osterholm, K. A. Senger, and M. L. Cohen. 1984. Drug-resistant Salmonella from animals fed antimicrobials. N. Engl. J. Med. 311:617–622. 16. Hsueh, P., L. Teng, S. Tseng, C. Chang, J. Wan, J. Yan, C. Lee, Y. Chuang, W. Huang, D. Yang, J. Shyr, K. Yu, L. Wang, J. Lu, W. Ko, J. Wu, F. Chang, Y. Yang, Y. Lau, Y. Liu, C. Liu, S. Ho, and K. Luh. 2004. Ciprofloxacinresistant Salmonella enterica Typhimurium and Choleraesuis from pigs to humans, Taiwan. Emerg. Infect. Dis. 10:60–68. 17. Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol. Microbiol. 35:1146–1155. 18. Levy, S. B., G. B. FitzGerald, and A. B. Macone. 1976. Changes in intestinal flora of farm personnel after introduction of a tetracycline-supplemented feed on a farm. N. Engl. J. Med. 295:583–588. 19. Li, Q., J. S. Sherwood, and C. M. Logue. 2004. The prevalence of Listeria, Salmonella, Escherichia coli and E. coli O157:H7 on bison carcasses during processing. Food Microbiol. 21:791–799. 20. Mayrhofer, S., P. Peter, F. J. M. Smulders, and F. Hilbert. 2004. Antimicrobial resistance profile of five major food-borne pathogens isolated from beef, pork and poultry. Int. J. Food Microbiol. 97:23–29. 21. McEwen, S. A., and P. J. Fedorka-Cray. 2002. Antimicrobial use and resistance in animals. Clin. Infect. Dis. 34:S93–S106. 22. NCCLS. 2002. Performance standards for antimicrobial susceptibility testing, vol. 22, p. 42–46. 12th information supplement. M100-S12. NCCLS, Wayne, Pa. 23. Nijsten, R., N. London, A. van den Bogaard, and E. Stobberingh. 1996. Antibiotic resistance among Escherichia coli isolated from faecal samples of pig farmers and pigs. J. Antimicrob. Chemother. 37:1131–1140. 24. Olah, P. A., J. S. Sherwood, L. M. Elijah, M. R. Dockter, C. Doetkott, and Z. Miller. 2004. Comparison of antimicrobial resistance in Salmonella and Campylobacter isolated from turkeys in the Midwest USA. Food Microbiol. 21:779–789. 25. Recchia, G. D., and R. M. Hall. 1995. Gene cassettes: a new class of mobile elements. Microbiology 141:3015–3027. 26. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 27. Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterization of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104. FEMS Microbiol. Lett. 160:37–41. 28. Skyberg, J. A., C. M. Logue, and L. K. Nolan. Virulence genotyping of Salmonella spp. with multiplex PCR. Avian Dis., in press. 29. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503–517. 30. Threlfall, E. L., L. R. Ward, J. A. Frost, and G. A. Willshaw. 2000. The emergence and spread of antibiotic resistance in food-borne bacteria. Int. J. Food Microbiol. 43:625–635. 31. Van Looveren, M., M. L. Chasseur-Libotte, C. Godard, C. Lammens, M. Wijdooghe, L. Peeters, and H. Goossens. 2001. Antimicrobial susceptibility of nontyphoidal Salmonella isolated from humans in Belgium. Acta Clin. Belg. 56:180–186. 32. Wybot, I., C. Wildemauwe, C. Godard, S. Bertrand, and J. M. Collard. 2004. Antimicrobial drug resistance in nontyphoid human Salmonella in Belgium: trends for the period 2000-2002. Acta Clin. Belg. 59:152–160. 33. Yan, J. J., W. C. Ko, C. H. Chiu, S. H. Tsai, H. M. Wu, and J. J. Wu. 2003. Emergence of ceftriaxone-resistant Salmonella isolates and rapid spread of plasmid-encoded CMY-2-like cephalosporinase, Taiwan. Emerg. Infect. Dis. 9:323–328. 34. Zhao, S., S. Qaiyumi, S. Friedman, R. Singh, S. L. Foley, D. G. White, P. F. McDermott, T. Donkar, C. Bolin, S. Munro, E. J. Baron, and R. D. Walker. 2003. Characterization of Salmonella enterica serotype Newport isolated from humans and food animals. J. Clin. Microbiol. 41:5366–5371.
