Clin. Lab. 2014;60:1383-1392 ©Copyright
ORIGINAL ARTICLE
Application of Immunohistochemistry in the Diagnosis of Small Round Blue-Cell Tumors of Soft Tissue QIAOXIN LI 1, 2, *, WENLI CUI 1, 2, *, GULINAER ABULAJIANG 1, YUQING MA 1, XIA LIU 1, WEI ZHANG 1, XINXIA LI 1, * 1
* Co-first authors Department of Pathology, the First Affiliated Hospital, Xinjiang Medical University, Urumqi 830054, China 2 Cancer Research Laboratory, Fudan University Shanghai Cancer Institute, Shanghai, China
SUMMARY Background: Small round blue-cell tumors (SRBCTs) of soft tissue, which mainly include rhabdomyosarcoma (RMS), synovial sarcoma (SS), and Ewing’s sarcoma/peripheral primitive neuroectodermal tumors (EWS/ pPNETs), are malignancies with overlapping morphological and immunohistochemical characteristics. Immunohistochemistry is one of the most prevalent and convenient methods for pathological diagnosis; however, differentiation between SRBCT subtypes in the absence of valid diagnostic markers is still very challenging. The purpose of the present study was to investigate diagnostic immunohistochemistry for subtyping soft tissue SRBCTs. Methods: Seventeen RMS, 25 SS, and 14 EWS/pPNETs were investigated. Reverse transcription RT-PCR and immunohistochemistry was performed to determine a diagnosis. Also, the expression of CD99, FLI1, PAX5, myogenin, and Keratin/EMA was assessed between subtypes. The sensitivity and specificity test was performed to evaluate their diagnostic significance. Results: The sensitivity and specificity of the target markers were evaluated as follows. FLI1 and CD99 expression displayed strong associations in EWS/pPNETs, with OR (95% CI) and p values of 3.82 (1.23 - 11.94), p = 0.021 and 123.50 (12.63 - infinity), p < 0.001, respectively. Keratin/EMA expression did not support the diagnosis of EWS/pPNETs [OR (95% CI) = 0.06 (0.01 - 0.53), p = 0.011]. Myogenin expression displayed strong association with RMS, with high sensitivity and specificity of 94.1% and 100%, respectively. Membrane expression of CD99 did not support the diagnosis of RMS [OR (95% CI) = 0.09 (0.01 - 0.75), p = 0.026]. Keratin/EMA expression strongly indicated SS [OR (95% CI) = 345.00 (29.44 - infinity), p = 0.0001]. A ROC curve value of 0.94 indicated that keratin/EMA expression might be a promising biomarker for SS, while separate expression of FLI1 and CD99 did not support the diagnosis of SS. Similarly, myogenin expression in RMS might be a promising biomarker for RMS with a ROC curve value of 0.97. Conclusions: Diagnosis of SRBCTs should be based on a comprehensive analysis involving morphology and immunoreactivity to a panel of markers. (Clin. Lab. 2014;60:1383-1392. DOI: 10.7754/Clin.Lab.2013.130909) LIST OF ABBREVIATIONS
KEY WORDS
SRBCTs - small round blue-cell tumors RMS - rhabdomyosarcoma SS - synovial sarcoma EWS/pPNET - Ewing’s sarcoma/peripheral primitive neuroectodermal tumors ROC - receiver operating characteristic OR - odds ratio 95% CI - 95% confident intervals
sarcoma, diagnosis, immunohistochemistry
_____________________________________________ Manuscript accepted October 8, 2013
Clin. Lab. 8/2014
1383
QIAOXIN LI et al.
nodes, macroscopic extent, and procedure treatment were obtained from the surgical document. The tumor size was determined grossly for excised specimens, or evaluated using imaging data (for example from computed tomography [CT] or magnetic resonance imaging [MRI]) for specimens obtained via core biopsy or incisional biopsy. In addition, written informed consent was obtained after a face-to-face interview, and the research was approved by the hospital’s ethics committee.
INTRODUCTION Small round blue-cell tumors (SRBCTs) of soft tissue mainly consist of rhabdomyosarcoma (RMS), synovial sarcoma (SS), and Ewing’s sarcoma/peripheral primitive neuroectodermal tumors (EWS/pPNETs). They are considered to be a heterogeneous group of tumors and routine light microscopic morphology alone provides little or no evidence of differentiation [1]. In most instances further sampling or ancillary tests help the identification of specific tumor types. For treatment purposes, it is crucial to determine the lineage differentiation [2,3]. Recently, although molecular genetic aberrations in several SRBCTs, such as the PAX-FKHR fusion gene in rhabdomyosarcoma [4], the SYT-SSX fusion gene in synovial sarcoma [5,6] and the EWS-FLI1 fusion gene in Ewing’s sarcoma/peripheral primitive neuroectodermal tumor [7], enable efficient and specific diagnosis, the application of these molecular genetic tests has been limited because of cost or resource reasons. Immunohistochemistry has been a prevalent and convenient method for pathological diagnosis; however, confusing immunostaining results for certain tumors can be difficult for surgical pathologists to interpret, even among surgical pathologists in the same department [8]. Ideally, each tumor requires an ‘‘individually constructed panel’’ composed of carefully selected antibodies that recognize all reasonable diagnostic possibilities in the context of the tumor’s morphology, anatomic site, and clinical/radiological findings. In this study, we throw light on some of the most commonly used, yet controversial antibodies, including CD99, FLI1, PAX5, myogenin, and Keratin/EMA, to explore their diagnostic significance in SRBCTs.
Reverse-transcription polymerase chain reaction For PCR analysis, total RNA was extracted from 10 to 15, 10 µm FFPE sections by a single-step phenol and guanidinium isothiocyanate procedure, using Trizol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). RNA purity and concentration were determined by UV spectrophotometry, and RNAs were stored separately at -80°C until use. Briefly, primary PAX3/7FKHR, SYT-SSX, and EWS-FLI1 chimeric mRNAs were detected using the One-Step RT-PCR Kit (Bca BEST RNA PCR Kit Ver.11; Takara Dalian, China), followed by a semi-nested or nested PCR to obtain more precise products. RT-PCR and sequencing analysis was performed as previously described [10] and as shown in Supplementary Figure 1. Positive and negative controls were routinely included. Primer sequences and the reaction conditions for each fusion gene are displayed in Table 1. Immunohistochemistry Immunohistochemistry was performed on FFPE tissue sections using steam heat-induced epitope retrieval and the Dako Envision detection system. Staining was performed with the following antibodies: FLI1 (MRQ-1; 1:25; nucleus), CD99 (12E7; 1:100; membrane/cytoplasm), myogenin (F5D; 1:50; nucleus), PAX5 (SP34; 1:80; nucleus), Cytokeratin pan (AE1/AE3; 1:100; cytoplasm), and EMA (E29; 1:200; cytoplasm). All of these antibodies were mouse monoclonal anti-human antibodies and were purchased from Dakocytomation, (Carpinteria, CA, USA). Also used in this study were antibodies against smooth muscle actin, desmin, h-caldesmon, CD34, HMB45, S-100, neuron specific enolase (NSE), and leukocyte common antigen (LCA). Cases were scored as “negative”, 1+ (0% - 25% positive cells), 2+ (26% - 50% positive cells), and 3+ (> 51% positive cells). Appropriate positive and negative controls were performed.
MATERIALS AND METHODS Samples were formaldehyde-fixed, paraffin-embedded (FFPE) tissues from the Department of Pathology in the First Affiliated Hospital of Xinjiang Medical University, archived between January 2003 and February 2011. All of the archival slides were reviewed independently by two senior pathologists (QXL and WLC) according to the latest WHO classification of soft tissue tumors [9]. Histological subtype was determined based on morphological, immunohistochemical and molecular genetic findings. Pathological grade and clinical TNM stage was conducted according to the French Federation of Cancer Centers Sarcoma Group (FNCLCC) system [9] and the Union International Center Cancer (UICC) system [9], respectively. Fifty six cases were recruited in this study, including 17 RMS, 25 SS, and 14 EWS/ pPNET cases. Characteristics of these tumors were collected according to the College of American Pathologists’ (CAP) website server (www.cap.org > cancer protocols > soft tissue). Briefly, information of specimen integrity, histological subtype, regional lymph
Statistical Analysis Statistical analysis was performed using SAS 9.2 statistical software (SAS, Cary, NC, USA). Group comparisons were evaluated using Fisher’s exact or Pearson’s chi-square test. All findings were assessed using the specificity and sensitivity test. The reliability of the results was determined using receiver operating characteristic (ROC) curves with a probability level of 0.3. For comparisons among all three tumors, two-sided p-values less than 0.05 were considered to be statistically
1384
Clin. Lab. 8/2014
IMMUNOHISTOCHEMISTRY AND SRBCTS
logically, the cases can be subdivided into three groups, including biphasic (6 cases), monophasic fibrous (15 cases), and poorly differentiated subtypes (4 cases). No monophasic epithelial subtype was observed in the current study. As previously reported, no significantly different histopathological features (tumor location, structural pattern, necrosis, mitosis, grade and stage parameters) between SS cases with or without SYT-SSX fusion gene expression were observed. As predicted, no fusion gene expression was detected in RMS or EWS/PNETs tumors. Based on the FNCLCC grading system, 11 cases were scored as Grade 2 and 14 cases as Grade 3.
significant, and for comparisons between pairs of tumors, a p value of less than 0.025 was significant. RESULTS Clinicopathological results All of the 56 cases studied were mainly characterized by diffusely arranged, closely packed, undifferentiated tumor cells that could not be identified easily by morphology alone and needed further validation using immunohistochemistry and/or molecular genetic tests. The RT-PCR procedure was successfully performed in 35 cases, including four RMS cases showing PAX3/7FKHR fusion gene expression [alveolar subtype (ARMS), 66.7% (4/6); embryonic (ERMS), 0% (0/4)], 19 SS cases showing SYT-SSX fusion gene expression (86%, 19/22), and 12 EWS/pPNETs cases showing EWS-FLI1 fusion gene expression (92%, 12/13). Unfortunately, we failed to observe chimeric gene expression status in 11 cases because of insufficient tissue or poor quality RNA sample provided (seven RMS, three SS, and one EWS/PNETs).
Ewing’s sarcoma/peripheral primitive neuroectodermal tumor Among the 14 EWS/pPNET cases (mean age: 18, range: 2 to 35 years), more female than male cases were observed (5 vs. 9). According to the radiographic and post-operative records, six cases involved tumors in the lower extremities with an average diameter of 5.8 cm (range: 3 to 11 cm), three cases involved tumors in the head and neck region with an average diameter of 5.4 cm (range: 2.6 to 7.3 cm), five cases involved tumors in the trunk region with an average diameter of 8.6 cm (range: 6.8 to 12.5 cm). There were no significantly different histopathological features (tumor location, structural pattern, necrosis, mitosis, grade and stage parameters) between EWS/pPNETs cases with or without EWS-FLI1 fusion gene expression. As previously reported, no fusion gene expression was detected in RMS or SS tumors. Based on the FNCLCC grading system, 2 cases were scored as Grade 2 and 12 cases as Grade 3.
Rhabdomyosarcoma Among the 17 RMS cases (mean age: 14, range: 2 to 56 years), no gender tendency was observed. According to the radiographic and post-operative records, 13 cases involved tumors in the head and neck region with an average diameter of 4.3 cm (range: 1.5 to 6 cm), three cases involved tumors in the spermatic cord with an average diameter of 4.7 cm, and one involved a tumor in the bladder with a diameter of 2.8 cm. Among these, six cases were defined as alveolar subtype and 11 as embryonic subtype, on the basis of the latest WHO criteria. The PAX3/7-FKHR fusion gene expression was observed in ARMS but not in ERMS cases; however, no significant differences in histopathological features (tumor location, structural pattern, necrosis, mitosis, grade and stage parameters) were observed between ARMS cases with or without PAX3/7-FKHR fusion gene expression. As predicted, no fusion gene expression was detected in SS or EWS/PNETs tumors. Based on the FNCLCC grading system, 14 cases were scored as Grade 2 (9 ERMS, 5 ARMS), and three cases as Grade 3 (1 ERMS, 2 ARMS).
Immunohistochemistry results To evaluate the significance of FLI1, CD99, myogenin, keratin/EMA, and PAX5 expression in the diagnosis of SRBCTs, we detected these markers in EWS/pPNETs, RMS, and SS tumors. The immunohistochemistry results are summarized in Figure 1, Table 2, and Table 3. FLI1 expression Friend leukemia integration 1 (FLI1) is an Ets family member that was originally identified as a proto-oncogene and an essential protein for embryonic development [11,12]. Nilsson et al. [13] first observed the expression of FLI1 in EWS/pPNETs, and predicted that FLI1 might serve as a diagnostic marker of EWS/ pPNETs. However, recent studies show nuclear expression of FLI1 in several human malignancies other than EWS/pPNETs [14]. In the present study, 85.7% (12/14), 40.0% (6/17), and 28% (7/25) of cases were observed with FLI1 expression in EWS/pPNETs, RMS, and SS, respectively. Statistically, the expression of FLI1 in EWS/pPNETs was significantly higher than that in RMS (p < 0.025) and SS (p < 0.025). There was no significant difference between RMS and SS (p > 0.025). The score for FLI1 expression in EWS/pPNETs was slightly lower than that in endothelial cells, indicating
Synovial sarcoma Among the 25 SS cases (mean age: 34, range: 14 to 74 years), more female cases than male cases were observed (8 vs. 17). According to the radiographic and post-operative records, 12 cases involved tumors in the lower extremities with an average diameter of 7.3 cm (range: 3.5 to 12 cm), 10 cases involved tumors in the trunk region with an average diameter of 4.6 cm (range: 2.8 to 7.5 cm), two cases involved tumors in the head and neck region with an average diameter of 3.5 cm (range: 2.6 to 4.3 cm), and one case involved a tumor in the upper extremities with a diameter of 2.3 cm. Histo-
Clin. Lab. 8/2014
1385
QIAOXIN LI et al. Table 1. The sequence of the primers and the reactive conditions for each fusion gene. Fusion gene
Primer pair
SYT-SSX
5'CCA GGG CAG CAA GGT TAC3'
Annealing temperature (°C) 57
Fragment length (bp) 203
59
174
59
178
60
147
60
155-270
62
155-270
57
234
5'TTCGTCCTCTGCTGGCTTC3' SYT-SSX (S-N)
5'CAGGGCTACGGTCCTTCAC3' 5'TTCGTCCTCTGCTGGCTTC3'
PAX3-FKHR
5'AGCTATACAGACAGCTTTG3' 5'CTCTGGATTGAGCATCCACC3'
PAX3-FKHR (S-N)
5'AGCTATACAGACAGCTTTG3'
EWS-FLI1
5'TCCTACAGCCAAGCTCCAAGTC3'
EWS-FLI1 (N)
5'CCAACAGAGCAGCAGCTACG3'
β-actin
5'GAGCGGGAAATCGTCCGTGACATT3'
5'TCCAGTTCCT TCATTCTGCA3' 5'ACTCCCCGTTGGTCCCCTCC3' 5'GGTGATACAGCTGGCGTTGG3' 5'GATGGAGTTGAAGGTAGTTTCGTG3' N - nested RT-PCR; S-N - semi-nested RT-PCT.
Table 2. Relationships between mainly target protein overexpression and small round blue-cell tumors in this study. Tumor
Paf
Pbg
Pcg
Pdg
EWS/PNET
RMS
SS
N = 14
N = 17
N = 25
FLI1
12 (85.7)
6 (40.0)
7 (28.0)
0.0021
0.0046
0.0005
0.6157
CD99
13 (92.9)
1 (5.9)
3 (15.8)
< 0.0001
< 0.0001
< 0.0001
0.2596 e
Myogenin
0 (0.0)
16 (94.1)
0 (0.0)
< 0.0001
< 0.0001
-
< 0.0001
Pax5
2 (14.3)
3 (17.7)
0 (0.0)
0.1036
1.0000
0.1228 e
0.0592 e
keratin/EMA
1 (7.1)
0 (0.0)
23 (92.0)
< 0.0001
0.4516 e
< 0.0001
< 0.0001
Positive result: nucleus expression for FLI1, myogenin, and Pax5 antibody; cytoplasmic expression for keratin; membranous expression for CD99 and EMA antibody. a: Two-sided Pearson's chi square test for distributions between different histologic subtype tumors in this study. b: Two-sided Pearson's chi square test for distributions between EWS/PNET and RMS. c: Two-sided Pearson's chi square test for distributions between EWS/PNET and SS. d: Two-sided Pearson's chi square test for distributions between RMS and SS. e: Two-sided Fisher's exact test for distributions between tumors. f: The results were in bold, if p < 0.05. g: The results were in bold, if p < 0.025.
EWS/pPNETs cases showed membranous expression. This was different from SS cases, 84.2% (16/19) of which showed cytoplasmic expression and 15.8% (3/19) of which showed cytoplasmic and membranous expression. As indicated, EWS/pPNETs had the highest rate of membranous CD99 expression at 92.2% (13/14), much higher than that of SS (15.8%, 3/25), but we observed no CD99 membranous expression in RMS. Statistically, CD99 membranous expression was significantly higher in EWS/pPNETs compared with that in
potentially different mechanisms for the FLI1 antigen between normal endothelial and EWS/pPNETs cells. CD99 expression CD99, encoded by the MIC2 gene, is a cell surface glycoprotein that displays diffuse membranous expression in more than 95% of EWS/pPNETs [15-17]. However, in the current study the expression of CD99 was observed in SRBCT subtypes with various expression staining patterns. For instance, all of the CD99 positive 1386
Clin. Lab. 8/2014
IMMUNOHISTOCHEMISTRY AND SRBCTS Table 3. Immunostaining score for different small round blue-cell tumors in this study. Antibody/Score
EWS/PNET
RMS
SS
N = 14
N = 17
N = 25
FLI1 -
2 (14.3%)
11 (64.7%)
18 (72.0%)
1+
2 (14.3%)
5 (29.4%)
5 (20.0%)
2+
3 (21.4%)
1 (5.9%)
2 (8.0%)
3+
7 (50.0%)
0 (0)
0 (0)
-
1 (7.1%)
16 (94.1%)
20 (80.0%)
1+
1 (7.1%)
1 (5.9%)
2 (8.0%)
2+
2 (14.3%)
1 (4.0%)
1 (4.0%)
3+
10 (71.4%)
0 (0)
0 (0)
-
14 (100%)
0 (0)
25 (100%)
1+
0 (0)
0 (0)
0 (0)
2+
0 (0)
0 (0)
0 (0)
3+
0 (0)
17 (100%)
0 (0)
CD99
a
myogenin
Pax5 -
12 (85.7%)
14 (82.4%)
25 (100%)
1+
2 (14.3%)
2 (11.8%)
0 (0)
2+
0 (0)
1 (5.9%)
0 (0)
3+
0 (0)
0 (0)
0 (0)
Keratin/EMA
a
-
13 (92.9%)
17 (100%)
2 (8.0%)
1+
1 (7.1%)
0 (0)
22 (88.0%)
2+
0 (0)
0 (0)
1 (4.0%)
3+
0 (0)
0 (0)
0 (0)
: membranous express fashion.
patchy staining) can frequently be interpreted as nonspecific staining in non-epithelial malignancies. However, true strong epithelial differentiation can be observed in certain sarcomas [19]. In this study, keratin/ EMA expression was observed in SS and EWS/pPNETs but not in RMS. And as expected, SS showed the highest keratin/EMA expression rate (92.0%, 23/25), and was significantly different to that of EWS/pPNETs (7.1%, 1/14) (p < 0.0001). Although no epithelial differentiation was observed in RMS (0%, 0/17), dot expression beside the nucleus was observed in 6 RMS cases (3 for both ARMS and ERMS). The significance of dot expression in RMS is not clear and should be investigated in future studies.
SS (p < 0.025). By contrast, no significant difference in CD99 expression between RMS and SS was observed (p > 0.025, Fisher’s test). Myogenin expression As one of the well-known myogenic transcriptional regulatory proteins, myogenin is regarded as a most sensitive and specific marker of skeletal muscle differentiation [18], which makes it a useful marker to distinguish RMS from other SRBCTs. As expected, nuclear staining of myogenin differed among EWS/pPNETs [0% (0/14)], RMS [94.1% (16/17)] and SS [0% (0/25)], (p < 0.0001). Keratin/EMA expression Traditionally, epithelial differentiation is an indication of carcinoma or sarcomatoid carcinoma, and an aberrant cytokeratin staining pattern (including weak, focal, and
Clin. Lab. 8/2014
PAX5 expression PAX5 is a member of the PAX family of transcription factors, and has been considered as a possible target for
1387
QIAOXIN LI et al. Table 4. Reliability analysis between the target protein overexpression and small round blue-cell tumors in this study.
Tumor
n
EWS/PNET
14
RMS
SS
Antibody
Prob level (%)
Correct (%)
Sensitivity (%)
Specificity (%)
OR 95% CI
Pa
ROC
FLI1
0.3
67.2
63.2
69
3.82 (1.23 - 11.94)
0.021
0.66
CD99
0.3
91.1
92.9
90.5
123.50 (12.63 - ~)
< 0.001
0.92
keratin/EMA
0.3
64.3
92.9
54.8
0.06 (0.01 - 0.53)
0.011
0.74
FLI1
0.3
53.6
64.7
48.7
0.57 (0.18 - 1.86)
0.355
0.57
17 CD99
0.3
57.1
94.1
41
0.09 (0.01 - 0.75)
0.026
0.68
Myogenin
0.3
98.2
94.1
100
> 999.99
-
0.97
FLI1
0.3
64.3
72
58.1
0.28 (0.09 - 0.87)
0.027
0.65
CD99
0.3
64.3
88
45.2
0.17 (0.04 - 0.67)
0.012
0.67
keratin/EMA
0.3
94.6
92
96.8
345.00 (29.44 - ~)
0.0001
0.94
25
OR - odds ratio; 95% CI - 95% confident intervals; ROC - receiver operating characteristic. a : The results were in bold, if p < 0.05.
Figure 1. Myogenin, keratin/EMA, CD99 and FLI1 immunostaining in small round blue-cell tumors of soft tissue. RMS: A - HE staining; B - myogenin staining; SS: C - HE staining; D - cytokeratin (AE1/AE3) staining; E - EMA staining; EWS/pPNETs: F - HE staining; G - CD99 staining; H - FLI1 staining (A, C, F x 200; B, D, E, G, H x 400).
1388
Clin. Lab. 8/2014
IMMUNOHISTOCHEMISTRY AND SRBCTS
Supplementary Figure 1. Results of reverse transcriptase polymerase chain reaction (RT-PCR) and sequencing examination. A - Ewing’s sarcoma/peripheral primitive neuroectodermal tumors (EWS/pPNETs); B - rhabdomyosarcoma (ARMS subtype); C - synovial sarcoma (SS).
The expression of some other common markers, including actin, CD34, desmin, neuron-specific enolase (NSE), S100, HMB45, and bcl-2, were also utilized to support differential diagnosis. No statistically significant difference was found between the expression of these antibodies and any of the clinicopathological characteristics (data not shown).
cellular immunotherapy [20]. In this study, PAX5 expression was observed in EWS/pPNETs (13.3%, 2/15) and RMS (18.8%, 3/16), but not in any SS cases. Interestingly, PAX5 expression was significantly increased in the alveolar RMS subtype (three cases) compared with that in the embryonic RMS subtype (no cases) with p < 0.05. Finally, the sensitivity and specificity test of these markers was calculated in this study. As indicated, FLI1 and CD99 expression displayed strong association with EWS/pPNETs, with respective OR and p values of 3.82, p = 0.021 and 123.50, p < 0.001. The expression of keratin/EMA did not support the diagnosis of EWS/ pPNET, with OR and p values of 0.06, p = 0.011. As predicted, myogenin expression displayed strong association with RMS, with high sensitivity and specificity of 94.1% and 100%, respectively. ROC curve analysis indicated that keratin/EMA expression in SS might be a promising biomarker for SS with a ROC curve value of 0.94, but FLI1 and CD99 expression may not be suitable markers for SS (both with ROC values of 0.65). Similarly, myogenin expression might be a promising biomarker for RMS with a ROC curve value of 0.97. More details can be seen in Table 4. Clin. Lab. 8/2014
DISCUSSION Molecular genetic examination provides a more definitive assessment of certain tumors compared with immunohistochemical examination; however, immunohistochemistry is still the most prevalent method for routine investigation, especially in developing countries with limited health care systems [21]. SRBCTs immunophenotypically and morphologically overlap each other; therefore, in this study, we focused on commonly used but controversial markers, and we identified characteristics to enable differentiation among these malignancies.
1389
QIAOXIN LI et al.
and MyoD1 [18,30]. The diffused nuclear expression of myogenin can be considered a feature of RMS, which is distinguishable from the focal staining seen in a variety of sarcomas with limited areas of rhabdomyomatous differentiation. As predicted, in this study myogenin expression was observed only in RMS, and not in EWS/ pPNETs or SS cases. Interestingly, cytoplasmic staining of myogenin in some non-myogenous tumors has been reported and should be considered with caution [31]. PAX5 is a member of the paired box transcription factor family involved in development, and its expression has been well characterized among hematopoietic malignancies of B-cell lineage [32,33]. A significant finding, indicating that PAX5 expression can be used to distinguish ARMS from ERMS was found in this study, and this finding is consistent with a previous report [34]. However, PAX5 expression in other SRBCTs is not well established. In the current study, we found some EWS/pPNETs were immunoreactive for PAX5 (14.3%, 2/14), but this finding was not observed in a previous study by Sullivan et al. [34]. It was reported that CD99 and/or cytokeratin antibodies are rarely expressed in RMS [35,36], which supports our findings. Taken together, we speculated that the diagnosis of RMS should not be initially considered when SRBCTs are immunoreactive toward CD99 and/or cytokeratin antibodies.
Ewing Sarcoma/peripheral Primitive Neuroectodermal Tumor EWS/pPNETs belongs to a spectrum of round cell sarcoma, ranging from the more primitive Ewing’s sarcoma (ES) to examples with evidence of neural differentiation termed peripheral Primitive Neuroectodermal Tumor (pPNET) [22]. Over 85% of EWS/pPNETs are characterized by the translocation t (11; 22) (q24; q12), which results in fusion of the EWS gene with the FLI1 gene [16,23]. The chimeric fusion gene can trigger the expression of FLI1 and is associated with carcinogenesis. However, FLI1 immunopositivity can also be detected in certain other tumors, including lymphoblastic lymphomas and demoplastic round cell tumors [14,24]. The expression of FLI1 in SRBCTs is not well established. Folpe et al. [14] found strong FLI1 expression in EWS/pPNETs (29/41), but not in poorly differentiated SS (0/8) or RMS (0/32); however, weak FLI1 immunoreactivity in SS was observed (3/10) by Rossi et al. [25]. In this study, weak FLI1 immunoreactivity was found in SS (7/25) and in RMS (6/17). Therefore, we speculated that the reasons for the different results might be the genetic background of the population involved. However, the heterogeneity of tumors can also contribute to varying results. MIC2 antigen (CD99) membranous expression has been used for the diagnosis of EWS/pPNET [26]; however, it was reported that CD99 immunopositivity could be detected in RMS and SS, either expressed with membranous or cytoplasmic staining patterns [26]. Recently, the combination of CD99 and FLI1 was speculated to be the most sensitive and specific test panel for the diagnosis of EWS/ pPNETs [27]. Unfortunately, the pattern of staining is difficult to recognize, especially when the cytoplasm is minimal, and when staining conditions are not optimal. The majority of EWS/pPNETs do not stain for epithelial markers; however, rare cases may display epithelial differentiation and stain with antibodies of broad-spectrum cytokeratins [28,29]. In this study, one EWS/ pPNETs case (7.1%) showed epithelial differentiation with focal AE1/AE3 expression. The reason for the epithelial differentiation of soft tissue SRBCTs is not clear; we speculate that the tumor cells might derive from a totipotent stem cell which can display both epithelium and mesenchyme differentiation, or that a keratin-specific gene is triggered in the development of the tumor. In our opinion, diagnosis of EWS/pPNETs should not be the first consideration, especially when epithelial differentiation is present. A further comprehensive analysis is needed when the histopathological features disagree with the immunophenotype results.
Synovial sarcoma SS is a clinically and morphologically well-defined entity that has been described extensively in the literature; however, its origin is still not well established resulting in a complex and confusing immunophenotype profile. Histologically, synovial sarcoma is diagnostically obvious when morphologically or immunohistochemically biphasic. However, diagnostic difficulty increases with a lower epithelial pattern, especially for poorly differentiated synovial sarcomas (PDSSs) and for small samplings comprising only the spindle cell component. Several epithelium related antibodies react with SS, including AE1/AE3, EMA, ck7, ck18, and CEA [37,38].The combination of positive staining for both EMA and CK7 in SS is highly specific compared with other SRBCTs. In addition, some studies indicate that antibodies including bcl-2, CD56, calponin, and PGP9.5 showed rather high specificities toward SS and, therefore, appear to be well suited as adjuncts or second tier stains to EMA and cytokeratin [39,40]. Similar to previously reported studies, although strong CD99 membranous staining was observed in SS and not in EWS/ pPNETs, the combination of positive staining for CD99 and EMA (or other epithelial related antibodies) often indicated SS. Otherwise, EWS/pPNETs should be a prime candidate when only strong CD99 membranous staining is observed. Therefore, it is important to be aware of CD99 staining in SRBCTs especially when epithelial differentiation has occurred. In summary, the present study investigated the diagnostic significance of five antibodies in SRBCTs of soft tissue, and we present some useful observations for their
Rhabdomyosarcoma RMS is derived from myogenic precursor cells and exhibits almost exclusive skeletal muscle differentiation. Accumulated evidence indicates that myogenin is a more sensitive and specific marker for skeletal muscle differentiation compared with several other myogenic transcriptional regulatory proteins, including myoglobin
1390
Clin. Lab. 8/2014
IMMUNOHISTOCHEMISTRY AND SRBCTS
differential use. However, several methodological issues and limitations of the present study should be discussed. Firstly, we only analyzed the most common fusion gene for these SRBCTs, and the cases without any fusion genes might be mis-subtyped; in the current study, subtype was determined according to morphology and immunophenotype characteristics. Secondly, although we obtained some statistically significant findings, further large sample size studies are needed in case bias remains in this relatively small study. Thirdly, we investigated only five traditional antibodies in the present study, which did not include novel antibodies. Therefore, additional larger and well-designed studies are warranted to confirm our findings.
7.
Ronin G, Scamps C, Turc-Carel C, et al. Chimeric EWS-FLI1 transcript in a Ewing cell line with a complex t(11;22;14) translocation. Cancer Res 1993;53:3655-7.
8.
Heim-Hall J, Yohe SL. Application of immunohistochemistry to soft tissue neoplasms. Arch Pathol Lab Med 2008;132:476-89.
9.
Flecher C, Unni K, Mertens F. WHO classification of tumors: pathology ﹠ genetics of tumors of soft tissue and bone. Lyon: IARC Press 2002:1-224.
10. Adsay V, Cheng J, Athanasian E, et al. Primary desmoplastic small cell tumor of soft tissues and bone of the hand. Am J Surg Pathol 1999;23:1408-13. 11. Ben-David Y, Giddens EB, Bernstein A. Identification and mapping of a common proviral integration site Fli-1 in erythroleukemia cells induced by Friend murine leukemia virus. Proc Natl Acad Sci U S A 1990;87:1332-6.
CONCLUSION
12. Nowling TK, Gilkeson GS. Regulation of Fli1 gene expression and lupus. Autoimmun Rev 2006;5:377-82.
SRBCTs of soft tissue constitute a heterogeneous entity which share overlapping morphological features and immunophenotypical profiles but different prognoses and therapeutic strategies. Diagnosis of SRBCTs should be based on a comprehensive analysis involving morphology, immunoreactivity to a panel of markers, and even molecular genetic information. Also, diagnostic misinterpretation can be avoided by using a broad panel embracing both antibodies that are anticipated to be positive and those that are expected to be negative.
13. Nilsson G, Wang M, Wejde J, et al. Detection of EWS/FLI-1 by Immunostaining. An Adjunctive Tool in Diagnosis of Ewing's Sarcoma and Primitive Neuroectodermal Tumour on Cytological Samples and Paraffin-Embedded Archival Material. Sarcoma 1999;3:25-32. 14. Folpe AL, Hill CE, Parham DM, et al. Immunohistochemical detection of FLI-1 protein expression: a study of 132 round cell tumors with emphasis on CD99-positive mimics of Ewing's sarcoma/primitive neuroectodermal tumor. Am J Surg Pathol 2000;24: 1657-62. 15. Devoe K, Weidner N. Immunohistochemistry of small round-cell tumors. Semin Diagn Pathol 2000;17:216-24.
Declaration of Interest: The authors have declared that no competing interests exist.
16. Folpe AL, Goldblum JR, Rubin BP, et al. Morphologic and immunophenotypic diversity in Ewing family tumors: a study of 66 genetically confirmed cases. Am J Surg Pathol 2005;29:1025-33.
References:
17. Weidner N, Tjoe J. Immunohistochemical profile of monoclonal antibody O13: antibody that recognizes glycoprotein p30/ 32MIC2 and is useful in diagnosing Ewing's sarcoma and peripheral neuroepithelioma. Am J Surg Pathol 1994;18:486-94.
1.
Machado I, Traves V, Cruz J, et al. Superficial small round-cell tumors with special reference to the Ewing's sarcoma family of tumors and the spectrum of differential diagnosis. Semin Diagn Pathol 2013;30:85-94.
18. Kumar S, Perlman E, Harris CA, et al. Myogenin is a specific marker for rhabdomyosarcoma: an immunohistochemical study in paraffin-embedded tissues. Mod Pathol 2000;13:988-93.
2.
Potratz J, Jurgens H, Craft A, et al. Ewing sarcoma: biology-based therapeutic perspectives. Pediatr Hematol Oncol 2012;29:1227.
19. Kushitani K, Takeshima Y, Amatya VJ, et al. Differential diagnosis of sarcomatoid mesothelioma from true sarcoma and sarcomatoid carcinoma using immunohistochemistry. Pathol Int 2008; 58:75-83.
3.
Thompson PA, Chintagumpala M. Targeted therapy in bone and soft tissue sarcoma in children and adolescents. Curr Oncol Rep 2012;14:197-205.
4.
Sorensen PHB, Lynch JC, Qualman SJ, et al. PAX3-FKHR and PAX7-FKHR gene fusions are prognostic indicators in alveolar rhabdomyosarcoma: A report from the Children's Oncology Group. J Clin Oncol 2002;20:2672-9.
5.
Tsuji S, Hisaoka M, Morimitsu Y, et al. Detection of SYT-SSX fusion transcripts in synovial sarcoma by reverse transcriptionpolymerase chain reaction using archival paraffin-embedded tissues. Am J Pathol 1998;153:1807-12.
6.
Clark J, Rocques PJ, Crew AJ, et al. Identification of novel genes, SYT and SSX, involved in the t(X;18)(p11.2;q11.2) translocation found in human synovial sarcoma. Nat Genet 1994;7:502-8.
Clin. Lab. 8/2014
20. Stuart ET, Kioussi C, Aguzzi A, et al. PAX5 expression correlates with increasing malignancy in human astrocytomas. Clin Cancer Res 1995;1:207-14. 21. Davicioni E, Finckenstein FG, Shahbazian V, et al. Identification of a PAX-FKHR gene expression signature that defines molecular classes and determines the prognosis of alveolar rhabdomyosarcomas. Cancer Res 2006;66:6936-46. 22. Dehner LP. Peripheral and central primitive neuroectodermal tumors. A nosologic concept seeking a consensus. Arch Pathol Lab Med 1986;110:997-1005. 23. Khoury JD. Ewing sarcoma family of tumors. Adv Anat Pathol 2005;12:212-20.
1391
QIAOXIN LI et al. 24. Ozdemirli M, Fanburg-Smith JC, Hartmann DP, et al. Precursor B-Lymphoblastic lymphoma presenting as a solitary bone tumor and mimicking Ewing's sarcoma: a report of four cases and review of the literature. Am J Surg Pathol 1998;22:795-804.
34. Sullivan LM, Atkins KA, Legallo RD. PAX immunoreactivity identifies alveolar rhabdomyosarcoma. Am J Surg Pathol 2009; 33:775-80. 35. He LJ, Wang L, Sun N, et al. [Clinicopathological study of 145 childhood rhabdomyosarcoma cases]. Zhonghua Bing Li Xue Za Zhi 2004;33:225-8.
25. Rossi S, Orvieto E, Furlanetto A, et al. Utility of the immunohistochemical detection of FLI-1 expression in round cell and vascular neoplasm using a monoclonal antibody. Modern Pathol 2004;17:547-52.
36. Huang SH, Wu SY, Chang KC. Paranuclear dot-like immunostaining of CD99 in rhabdomyosarcoma. Histopathology 2013; 62:814-6.
26. Hasegawa SL, Davison JM, Rutten A, et al. Primary cutaneous Ewing's sarcoma: immunophenotypic and molecular cytogenetic evaluation of five cases. Am J Surg Pathol 1998;22:310-8.
37. Ouansafi I, Klein M, Sugrue C, et al. Monophasic parapharyngeal synovial sarcoma diagnosed by cytology, immunocytochemistry, and molecular pathology: case report and review of the literature. Diagn Cytopathol 2010;38:822-7.
27. Mhawech-Fauceglia P, Herrmann F, Penetrante R, et al. Diagnostic utility of FLI-1 monoclonal antibody and dual-colour, breakapart probe fluorescence in situ (FISH) analysis in Ewing's sarcoma/primitive neuroectodermal tumour (EWS/PNET). A comparative study with CD99 and FLI-1 polyclonal antibodies. Histopathology 2006;49:569-75.
38. Cheng Y, Sheng W, Zhou X, et al. Pericardial synovial sarcoma, a potential for misdiagnosis: clinicopathologic and molecular cytogenetic analysis of three cases with literature review. Am J Clin Pathol 2012;137:142-9.
28. Gu M, Antonescu CR, Guiter G, et al. Cytokeratin immunoreactivity in Ewing's sarcoma: prevalence in 50 cases confirmed by molecular diagnostic studies. Am J Surg Pathol 2000;24:410-6.
39. Folpe AL, Schmidt RA, Chapman D, et al. Poorly differentiated synovial sarcoma: immunohistochemical distinction from primitive neuroectodermal tumors and high-grade malignant peripheral nerve sheath tumors. Am J Surg Pathol 1998;22:673-82.
29. Machen SK, Fisher C, Gautam RS, et al. Utility of cytokeratin subsets for distinguishing poorly differentiated synovial sarcoma from peripheral primitive neuroectodermal tumour. Histopathology 1998;33:501-7.
40. Pelmus M, Guillou L, Hostein I, et al. Monophasic fibrous and poorly differentiated synovial sarcoma: immunohistochemical reassessment of 60 t(X;18)(SYT-SSX)-positive cases. Am J Surg Pathol 2002;26:1434-40.
30. Wang NP, Marx J, McNutt MA, et al. Expression of myogenic regulatory proteins (myogenin and MyoD1) in small blue round cell tumors of childhood. Am J Pathol 1995;147:1799-810.
Correspondence: Qiaoxin Li Department of Pathology The First Affiliated Hospital Xinjiang Medical University Urumqi 830054, China Email:
[email protected]
31. Gomez JA, Amin MB, Ro JY, et al. Immunohistochemical profile of myogenin and MyoD1 does not support skeletal muscle lineage in alveolar soft part sarcoma. Arch Pathol Lab Med 1999; 123:503-7. 32. Walther C, Guenet JL, Simon D, et al. Pax: a murine multigene family of paired box-containing genes. Genomics 1991;11:42434. 33. Nutt SL, Heavey B, Rolink AG, et al. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 1999;401:556-62.
Xinxia Li Department of Pathology The First Affiliated Hospital Xinjiang Medical University Urumqi 830054, China Email:
[email protected]
1392
Clin. Lab. 8/2014
