Aquaporin-4 Antibodies in Neuromyelitis Optica and ...

ORIGINAL CONTRIBUTION

Aquaporin-4 Antibodies in Neuromyelitis Optica and Longitudinally Extensive Transverse Myelitis Patrick Waters, PhD; Sven Jarius, MD; Edward Littleton, MBBS, DPhil; Maria Isabel Leite, MD; Saiju Jacob, MD; Bryony Gray, PhD; Ruth Geraldes, MD; Thomas Vale, BA; Anu Jacob, MD; Jacqueline Palace, DM; Susan Maxwell, MSc; David Beeson, PhD; Angela Vincent, MBBS, MSc, FRCPath

Background: There is increasing recognition of antibodymediated immunotherapy-responsive neurologic diseases and a need for appropriate immunoassays.

Main Outcome Measures: Comparison of different assays for AQP4 antibodies and characterization of antiAQP4 antibodies in patients with neuromyelitis optica.

Objectives: To develop a clinically applicable quantitative assay to detect the presence of aquaporin-4 (AQP4) antibodies in patients with neuromyelitis optica and to characterize the anti-AQP4 antibodies.

Results: We found antibodies to AQP4 in 19 of 25 pa-

Design: We compared a simple new quantitative fluo-

rescence immunoprecipitation assay (FIPA) with both indirect immunofluorescence and an AQP4-transfected cell-based assay, both previously described. We used the cell-based assay to characterize the antibodies for their immunoglobulin class, IgG subclass, and ability to induce complement C3b deposition in vitro. Setting: United Kingdom and Germany. Participants: Serum samples from patients with neu-

romyelitis optica (n=25) or longitudinally extensive transverse myelitis (n=11) and from relevant controls (n=78) were studied.

A

Author Affiliations: Neurosciences Group, Weatherall Institute of Molecular Medicine, and Department of Clinical Neurology, University of Oxford, Oxford, England (Drs Waters, Jarius, Littleton, Leite, S. Jacob, Gray, Palace, Beeson, and Vincent, Mr Vale, and Ms Maxwell); Department of Neurology, Hospital de Santa Maria, Lisbon, Portugal (Dr Geraldes); and The Walton Centre for Neurology and Neurosurgery, Liverpool, England (Dr A. Jacob).

tients with neuromyelitis optica (76%) using FIPA, in 20 of 25 patients with neuromyelitis optica (80%) using the cell-based assay, and in 6 of 11 patients with longitudinally extensive transverse myelitis (55%) with both assays; these assays were more sensitive than indirect immunofluorescence and 100% specific. The antibodies bound to extracellular epitope(s) of AQP4, were predominantly IgG1, and strongly induced C3b deposition. Conclusions: Aquaporin-4 is a major antigen in neuromyelitis optica, and antibodies can be detected in more than 75% of patients. Further studies on larger samples will show whether this novel FIPA is suitable for clinical use. The IgG1 antibodies bind to AQP4 on the cell surface and can initiate complement deposition. These approaches will be useful for investigation of other antibody-mediated diseases.

Arch Neurol. 2008;65(7):913-919

NTIBODIES TO DIFFERENT

ion channels have been found in several neurologic diseases, and their measurement is clinically important.1,2 A newly defined autoimmune channelopathy is neuromyelitis optica (NMO).1,3 Neuromyelitis optica is an inflammatory disease that involves the spinal cord and optic nerves4,5; it often follows a more aggressive clinical course than multiple sclerosis (MS) but responds better to immunosuppressive therapy.5-7 A need exists for a diagnostic test to distinguish reliably NMO from MS at onset, when the full clinical features may not be apparent but early intervention may prevent disability. In 2004, Lennon et al8 described an NMO IgG antibody using indirect immunofluorescence on adult mouse cerebellum sections, showing a characteristic pattern of binding around microvessels, pia, and Virchow-Robin spaces; it was 58% to 73% sensitive and

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 7), JULY 2008 913

91% to 100% specific for NMO.8 This report led to the adoption of NMO IgG positivity as 1 of 3 supportive criteria for the diagnosis of the disease.9 In 2005, the same group identified aquaporin-4 (AQP4) as a target antigen,3 showing binding of some NMO IgG–positive serum samples to the surface of human embryonic kidney (HEK) 293 cells transfected with human AQP4, subsequently confirmed in a study from Japan,10 and immunoprecipitation of solubilized enhanced green fluorescent protein (EGFP) AQP4 by Western blotting of the precipitates.3 In addition, 57% of NMO cases were positive by immunoprecipitation of in vitro–translated, sulfur 35– labeled methionine AQP4,11 but it is unlikely that the antigen adopts its full native conformation with this technique. We used EGFP tagging3 to demonstrate a novel, sensitive, quantitative, and highly specific fluorescence immunoprecipitation assay (FIPA) for AQP4 antibodies. In this article, we compare those re-

WWW.ARCHNEUROL.COM

Downloaded from www.archneurol.com at University of Washington, on September 11, 2009 ©2008 American Medical Association. All rights reserved.

Table 1. Summary of Clinical Features of Patients

Diagnosis Based on Medical Records Retrospectively NMO (n = 25) LETM (n = 11) MS (n = 38)

Male to Female Ratio

Age at Sampling, Median (Range), y

Disease Duration at Sampling, Median (Range), y

No. of Patients by Duration of Immunosuppressive Treatment, ⬎3 mo: ⱕ3 mo

Spinal Cord Lesion, No. of Segments (Range)

5:20 3:8 10:28

49.0 (13-75) 39.0 (23-55) 40.5 (21-74)

4.5 (0-18) ⬍1.0 (⬍1-8) Not recorded

11:10 (4 unknown) 4:7 Not recorded

6 (3-21) 6 (3-19) Not recorded

Abbreviations: LETM, longitudinally extensive transverse myelitis; MS, multiple sclerosis; NMO, neuromyelitis optica.

sults with the indirect immunofluorescence and cellbased methods and describe the characteristics of the antibodies and their pathogenic potential. Some of these data have been previously reported in abstract form.12 METHODS

PATIENTS We studied the earliest serum or plasma samples available from 25 unselected patients from the United Kingdom and Germany with an eventual diagnosis of NMO (defined according to the criteria of Wingerchuk et al9 but discounting the criterion of NMO IgG or AQP4 assay status), 11 patients with longitudinally extensive transverse myelitis (LETM) who did not fulfill the clinical criteria for NMO, 38 patients with MS (defined according to the criteria of McDonald et al13; 27 with relapsing-remitting MS, 6 with secondary progressive MS, and 5 with primary progressive MS), 26 controls with other autoimmune neurologic disease (AIND) derived from routine referrals, and 14 healthy controls (HCs). Many serum samples were included in our short report using indirect immunofluorescence.14 Table 1 summarizes the patients’ demographic and clinical characteristics.

INDIRECT IMMUNOFLUORESCENCE ASSAY The NMO IgG was detected by indirect immunofluorescence on 10-µm adult mouse cerebellum cryosections as previously described.14 Sections were classified as positive if they exhibited the typical NMO immunofluorescence pattern.8 For IgM and IgG subclass analysis, goat anti–human IgG was replaced with antibodies to IgG1, IgG2, IgG3, IgG4, or IgM (1:100; The Binding Site, Birmingham, England) and then Alexa Fluor 488– conjugated donkey anti–sheep IgG (1:750; Invitrogen Ltd, Paisley, England) was added as a secondary antibody. Slides were mounted with standard fluorescent mounting media (DakoCytomation, Cambridge, England) that contained diamidino2-phenylindole (DAPI) (1:1000).

SUBCLONING OF HUMAN AQP4 Human AQP4 complementary DNA was obtained (IMAGE clone 4717755; Geneservice Ltd, Cambridge, England). Both AQP4 isoforms were cloned into plasmid EGFP-C3 (Clontech, SaintGermain-en-Laye, France) using the reverse primer 5⬘GCATCCCGGGTCATACTGAAGACAATACCTCTCCAG and either 5⬘-GTCACTCGAGATGAGTGACAGACCCACAGCAAG to yield plasmid EGFP-AQP4-M1 or 5⬘GTCACTCGAGATGGTGGCTTTCAAAGG GGTCTG to yield plasmid EGFP-AQP4-M23.

CELL-BASED ASSAY AND CHARACTERIZATION OF ANTIBODIES The HEK cells were transfected with both EGFP-tagged AQP4 isoforms using standard polyethyleneimine transfection. Forty hours after transfection with EGFP-AQP4-M1, EGFP-AQP4M23, or EGFP alone (mock transfection), coverslips were rinsed gently with Dulbecco-modified Eagle medium with 20mM HEPES buffer (4-[2-hydroxyethyl]-1-piperazineethanesulfonic acid) and incubated with patient or control serum samples (1:20) in 250 µL of buffer with 1% bovine serum albumin for 1 hour at room temperature (RT), washed 3 times with buffer, and fixed immediately with 3% formaldehyde in phosphate-buffered saline for 15 minutes at RT. Cells were then rinsed twice and incubated: (1) for the detection of IgG or IgM antibodies, with goat anti–human IgG or goat anti–human IgM Alexa Fluor 568– conjugated secondary antibody (Invitrogen–Molecular Probes, Paisley) at 1:750 in buffer with 1% bovine serum albumin for 45 minutes at RT; and (2) for the identification of IgG subclasses, with mouse anti–human IgG1 or mouse anti–human IgG4 (The Binding Site) at 1:50 in buffer with 1% bovine serum albumin for 1 hour at RT, washed 3 times, and then labeled with goat anti– mouse isotype-specific IgG Alexa Fluor 568–conjugated antibody (Invitrogen–Molecular Probes). After antibody labeling, cells were then washed 4 times in phosphate-buffered saline, nuclei were counterstained with DAPI (1:1000), and coverslips were mounted as described herein.

DETECTION OF C3b DEPOSITION ON AQP4-EXPRESSING CELLS OR MOUSE BRAIN SECTIONS The HEK 293 cells transfected with AQP4 were incubated with heat-inactivated serum samples (30 minutes at 57°C) from AQP4 antibody–positive patients or controls at 1:20 dilution for 30 minutes at 37°C and then washed briefly. Fresh frozen serum from a healthy donor was used as a source of complement after incubation with HEK 293 cells on ice for 35 minutes to reduce nonspecific complement activation. The preabsorbed serum was applied to the AQP4 antibody–treated cells at 1:20 dilution for 30 minutes at 37°C. The coverslips were fixed in 3% formaldehyde, incubated with a polyclonal rabbit anti– human C3c antibody, which detects C3b (1:500, 30 minutes at 4°C; DakoCytomation, Glostrup, Denmark), or a rabbit isotype control (provided ready for use; Zymed Laboratories, South San Francisco, California); and then incubated with Alexa Fluor 568 goat anti–rabbit IgG antibody for 45 minutes (1:750; Invitrogen–Molecular Probes). All stages were performed with specimens on ice. Coverslips were mounted as described herein using standard fluorescence mounting media (Dako Cytomation) containing DAPI (1:1000). Mouse brain sections were immunostained for C3b in a similar fashion, except that the HEK


WWW.ARCHNEUROL.COM


A

IgG (Human)

IgG (Human)

B

293 cell preabsorption was not required, and the Alexa Fluor goat anti–rabbit IgG antibody was applied at 1:325. IgG1 (Human)

DETECTION OF IMMUNOFLUORESCENCE

IgG (Human)

C3b (Human)

Merge

Figure 1. Neuromyelitis optica (NMO) immunoglobulin-binding pattern and determination of IgG subclass and complement activation in NMO serum samples. A, Fluorescein isothiocyanate–labeled anti–human IgG antibody highlights the typical NMO staining pattern around brain microvessels and along the pial layer (original magnification ⫻ 200). B, The antibodies were predominantly IgG1. C, After exposure to serum and a fresh source of complement, complement deposition was detected by rabbit anti-C3c and anti–rabbit IgG (red), demonstrating colocalization of NMO immunoglobulin binding (green) and complement C3b deposition.

A

EGFP-AQP4

IgG (Human)

Merge

NMO Serum 1

FLUORESCENCE IMMUNOPRECIPITATION ASSAY Flasks of EGFP-AQP4–transfected HEK 293 cells were lysed by incubation for 1 hour at 4°C in 3 mL of extraction buffer (10mM TRIS, 100mM sodium chloride, 1mM EDTA, 1% Triton Cell-Based Assay Score

B 4

4

NMO Serum 2

3

Cell-Based Assay Score

C

Immunofluorescence slides or coverslips were stored, light protected, at 4°C and imaged on a Zeiss fluorescence microscope (Carl Zeiss Ltd, Welwyn Garden City, England) with a MacProbe v4.3 digital image system (Perceptive Scientific Instruments Inc, Chester, England). All photographs were taken under similar conditions. Slides were coded and scored for the intensity of surface immunofluorescence and colocalization with EGFPAQP4 by 3 of us (P.W., M.I.L., and R.G.). The binding was scored as follows: 0 to 0.5,none or slight labeling without colocalization; 1, weak labeling; 2,moderate labeling; 3,strong labeling; and 4,very strong labeling. The final score was the median of 3 independent readings (variance ⬍1). Sample scores of 1 or more were classified as positive on the basis of control results.

3

2

1

0 HC

NMO Serum 3

AIND

MS

LETM

NMO

1

C

HC Serum

0

EGFP

NMO Serum 1

IgG (Human)

Merge


4

3

2

1

0 0 IIF Positive

IIF Negative

Figure 2. Aquaporin-4 (AQP4) antibodies measured by the cell-based assay. A, Antibodies binding to AQP4-expressing cells were detected by anti–human immunoglobulin (red) and results scored (the “Cell-Based Assay and Characteristics of Antibodies” subsection in the “Methods” section provides details) (original magnification ⫻200). B, Scatterplot of scores of each serum sample; 1 or more was considered positive on the basis of the healthy control (HC) group. C, A total of 8 of 15 neuromyelitis optica (NMO) or longitudinally extensive transverse myelitis (LETM) serum samples that were negative by indirect immunofluorescence (IIF) were positive by the cellbinding assay, showing it to be more sensitive (P⬍.001). In B and C, the horizontal line represents the cutoff above which the results are considered positive. The median values are shown in each column. Only results from 10 LETM and 23 NMO serum samples are shown herein. AIND indicates autoimmune neurologic disease; EGFP, enhanced green fluorescent protein; and MS, multiple sclerosis.


WWW.ARCHNEUROL.COM


Table 2. Summary of Results of the Aquaporin-4 Antibody Assays No. (%) of Study Participants Diagnosis NMO (n = 25) LETM (n = 11) MS (n = 38) AIND (n = 26) HCs (n = 14)

In-house Indirect Immunofluorescence a

Cell-Based Assay

FIPA

14 (58) b 5 (50) b 0 1 (4) 0

20 (80) 6 (55) 0 0 0

19 (76) 6 (55) 0 0 0

Abbreviations: AIND, autoimmune neurologic disease; FIPA, fluorescence-based immunoprecipitation assay; HCs, healthy controls; LETM, longitudinally extensive transverse myelitis; MS, multiple sclerosis; NMO, neuromyelitis optica. a The indirect immunofluorescence assay was first established14 using 3 NMO serum samples (of 8) that were positive for NMO IgG testing by the Mayo Clinic, Rochester, Minnesota. b No serum was available for this assay in 1 patient in each of these groups (for NMO, the denominator was 24; and for LETM, the denominator was 10).

X-100, pH 7.5, with protease inhibitor cocktail [Sigma Aldrich Company Ltd, Dorset, England] added immediately before use) followed by centrifugation at 13 000 rpm in a microfuge for 6 minutes at 4°C. The EGFP-AQP4 extract was read on a fluorescence plate reader (SpectraMax GeminiXS; Molecular Devices, Sunnyvale, California). Individual serum samples (25 µL) were added to 250 µL of cell extract and incubated at 4°C overnight before precipitation of the IgG-AQP4 complexes using 100 µL of protein A beads (Sigma Aldrich Company Ltd), previously blocked for 1 hour at 4°C in ultralow immunoglobulin fetal calf serum (Invitrogen) and washed twice in extract buffer. The bead-IgG-AQP4 complexes were rotated for 2 hours at RT, washed 3 times for 5 minutes with 1 mL of extract buffer, resuspended in 120 µL of extract buffer, and transferred to a 96-well black polymerase chain reaction plate (Abgene, Epsom, England). The fluorescence at 512 nm (excitation, 472 nm; cutoff, 495 nm) was read on a fluorescence plate reader (Molecular Devices). We used computer software (GraphPad PRISM 4; GraphPad Software Inc, San Diego, California) to graph and analyze the data. The statistical tests used are indicated in the “Results” section. RESULTS

AQP4 ANTIBODIES MEASURED BY INDIRECT IMMUNOFLUORESCENCE AND CELL-BASED ASSAY Three serum samples previously found positive for NMO IgG at the Mayo Clinic, Rochester, Minnesota, were used to help establish our immunofluorescence assay.14 Testing all but 1 of our 36 patients with NMO or LETM by this method, we found positive results in 14 of 24 patients with NMO (58%) and in 5 of 10 patients with LETM (50%), with 1 positive serum sample from among 26 AIND controls (4%) but 0 in 38 patients with MS (Figure 1A) or 14 HCs. When tested for IgG subclass, only IgG1 was detected (Figure 1B), and in the presence of 3 NMO IgG–positive serum samples and fresh human serum as a source of complement, C3b deposition was clearly found (Figure 1C), with a distribution highly similar to that of the IgG or IgG1 antibodies.

To confirm that the antibodies bind to extracellular epitopes on AQP4, we expressed AQP4 in HEK 293 cells and used immunofluorescence to detect binding of serum antibodies. Because the EGFP-AQP4 was synthesized in the cytoplasm, green fluorescence was seen both within the cell and at the cell surface. By contrast, patients’ IgG, indicated by red fluorescence, was only detected on the cell surface (Figure 2A). The median scores for each serum sample are shown in Figure 2B. No binding was detectable in HC, AIND, or MS serum samples. The results were positive (ⱖ1.0) in 20 of 25 NMO serum samples (80%) and in 6 of 11 LETM serum samples (55%) (Table 2). More positive results were found with the cell-based assay than with immunofluorescence, and the scores were higher in the immunofluorescence-positive serum samples than in those that were negative (Figure 2C). CHARACTERIZATION OF THE AQP4 ANTIBODIES USING THE CELL-BASED ASSAY All positive serum samples tested, including those with both high and low AQP4 antibody reactivity, were strongly IgG1 subclass, as shown for 2 highly positive samples in Figure 3A, and weaker for IgG4 and IgM (Figure 3B). Moreover, 9 of 10 AQP4 antibody–positive serum samples showed strong complement C3b deposition on the cell membrane (Figure 4A and B), which correlated weakly (r2 =0.4, P=.05) with IgG1 AQP4 antibodies (Figure 4C). AQP4 ANTIBODIES MEASURED BY FIPA To establish a quantitative and objective assay, we used immunoprecipitation. The EGFP-AQP4, extracted in detergent from the cells, demonstrated a sedimentation coefficient of 7.4, corresponding to that predicted for an EGFPAQP4 tetramer (Figure 5A). Serum samples that were positive for AQP4 antibodies immunoprecipitated more EGFP-AQP4 with increasing concentrations of EGFPAQP4 (Figure 5B), suggesting relatively low overall affinity. Serum samples that immunoprecipitated EGFPAQP4 did not immunoprecipitate EGFP alone or other EGFP-tagged antigens (P.W., unpublished data, 2007). For testing all serum samples, we used 7500 to 9000 fluorescence units (FUs) in a volume of 250 µL, corresponding to 150nM tetrameric EGFP-AQP4 (based on the FUs detected per EGFP) (Figure 5A, insert). A total of 25 µL of the NMO and LETM serum sample immunoprecipitated between 10 and 1600 FUs, corresponding to 2.5 to 400nM of EGFP-AQP4 tetramers per liter of serum. We chose 25 FUs (equivalent to 6.25nM) as a conservative cutoff value, based on the HC results (mean⫹3 SDs, 21.23 FUs); the values for the patients with AIND (mean⫹3 SDs, 21.17 FUs) and the patients with MS (mean⫹3 SDs, 23.85 FUs) were not different from the HCs, and all were less than 25 FUs. Positive values were found in 19 of 25 patients with NMO (76%) and in 6 of 11 patients with LETM (55%) (Figure 5C and Table 2). The FIPA gave significantly higher results in serum samples that were positive for indirect immunofluorescence (P ⬍ .001, Mann-Whitney test) (Figure 5D) and was overall more sensitive and highly specific. Results of the quantitative cell-based assay and FIPA were strongly correlated (P⬍.001, data not shown).


WWW.ARCHNEUROL.COM


A

EGFP-AQP4

IgG1 (Human)

Merge

B

EGFP-AQP4

IgG (Human)

Merge

IgM and IgG Subclass Score

4

3

2

1

0 IgM

IgG1

IgG4

Figure 3. Neuromyelitis optica immunoglobulin serum samples bind to aquaporin-4 (AQP4) and are predominantly IgG1 subclass. A, AQP4-expressing cells were incubated with serum, followed by mouse antiserum specific for IgG1, IgG4, or IgM. The colocalization of the surface-expressed AQP4 (green) and the anti–IgG1 antibody (red) indicates that the antibodies are against AQP4 and are mainly IgG1 (original magnification ⫻ 200). B, Scores of the 11 AQP4 antibody–positive serum samples. The horizontal line represents the cutoff above which the results are considered positive. The median values are shown in each column. EGFP indicates enhanced green fluorescent protein.

EGFP-AQP4

C3b

Merge

Merge (⫻1000)

B C3b Deposition Score

A

NMO serum 1

NMO serum 2

4 3 2 1 0 HC

C3b Deposition Score

C NMO serum 3

HC serum

AQP4 Positive

4 3 2 1 0 0

1

2 IgG1-Binding Score

3

4

Figure 4. Complement deposition demonstrated by the cell-binding assay. A, Activation of complement by aquaporin-4 (AQP4) antibodies was demonstrated by use of a rabbit anti–human C3c antibody (red). The staining patterns of 3 neuromyelitis optica (NMO) serum samples and a healthy control (HC) serum sample are shown (original magnification ⫻ 200). The higher magnification (⫻ 1000) highlights the surface colocalization of the complement deposition and AQP4 antibody binding. B, A total of 9 of 10 AQP4 antibody–positive serum samples were positive (ⱖ1.0) for C3b deposition (the median value is shown in the column); HC serum samples showed no detectable complement activation. The horizontal line represents the cutoff above which the results are considered positive. C, There was a trend toward a positive correlation (r 2 =0.4, P=.05) between the scores for IgG1 binding and for C3b deposition. EGFP indicates enhanced green fluorescent protein.

TITER OF AQP4 ANTIBODIES AND CLINICAL FEATURES No correlation was found (P=.72) between the spinal cord magnetic resonance imaging lesion length and the AQP4 antibody values, but a trend was seen toward lower FIPA and cell-based assay values in patients immunosuppressed before serum analysis (P=.07; data not shown). However, antibody levels in patients during relapse were 100% positive, and were higher in patients during relapse than in those

sampled during remission (P=.02, cell-based assay; P=.006, FIPA; Mann-Whitney test) (Figure 6A and B). TheclinicalclassificationofthepatientsinTable1isbased on their eventual clinical diagnoses and did not incorporate knowledge of their NMO IgG (or AQP4 antibody) status. In 3 patients initially diagnosed as having MS, acute disseminatingencephalomyelitis,orinflammatoryencephalitis,NMO was diagnosed only several years later, in 2 at the postmortemexamination(M.Esiri,DPhil,I.Pomeroy,DPhil,S.Viegas, MD, unpublished data, 2007). All 3 patients were clearly


WWW.ARCHNEUROL.COM


A

B 7500

EGFP-AQP4 Precipitated by 25 uL, pmol

Fluorescence, FU

150

Fluorescence, FU

200

5000 2500

100

0

1

2

3

4

EGFP, µg 50

0 –20 –18 –16 –14 –12 –10

High positive Medium positive Low positive HC

5 4 3 2 1 0

–8

–6

–4

–2

0

0

50

100

Sedimentation Coefficient C

200

250

300

D

1600

1600

1350

1350

Fluorescence Precipitated, FU


150

EGFP-AQP4, nM

1100

1150 850 600 350 100 100

75 50

850 600 350 100 100

75 50 25

25 0

0 HC

AIND

MS

LETM

NMO

IIF Positive

IIF Negative

Figure 5. Fluorescence-based immunoprecipitation assay (FIPA). A, On sucrose density gradient centrifugation, the sedimentation coefficient of enhanced green fluorescent protein (EGFP) aquaporin-4 (AQP4) was 7.4, indicating predominantly a tetrameric form. Pure EGFP yielded 1900 fluorescence units (FUs) per 1 µg (inset). B, Immunoprecipitation by AQP4 antibody–positive serum increased with increasing concentrations of EGFP-AQP4. C, Individual values in FUs precipitated in the FIPA. The cutoff, 25 FUs, was calculated from the mean (⫹3 SDs) of the healthy control (HC) scores. D, All samples positive by indirect immunofluorescence (IIF) were also positive by FIPA, whereas 6 of 15 neuromyelitis optica (NMO) or longitudinally extensive transverse myelitis (LETM) serum samples that were negative by IIF were positive by FIPA, showing it to be a more sensitive assay (P ⬍ .001). In C and D, the horizontal line represents the cutoff above which the results are considered positive. In D, the median values are shown in each column. AIND indicates autoimmune neurologic disease; MS, multiple sclerosis.

A

B 1600



4

3

2

1

0 Relapse

1350 1100 850 600 350 100 100 75 50 25 0

Remission

Relapse

Remission

Figure 6. Correlation of aquaporin-4 antibody titers and disease activity. Cell-binding assay (A) and fluorescence-based immunoprecipitation assay (B) scores were significantly higher (P =.02 in A and P =.006 in B) when serum samples were obtained when the patient experienced disease relapse rather than remission. The median values are shown in each column. FU indicates fluorescence unit.

positive for AQP4 antibodies by cell-based assay (scores of 3) and FIPA (⬎70 FUs) early in their disease course. COMMENT

Neuromyelitis optica is an immune-mediated neurologic disease that can be severely disabling.4,5 Improve-

ment by immunosuppressive treatment and/or plasmapheresis4,6,7 indicates the need to distinguish it from MS and other diseases associated with inflammatory lesions as early as possible, often before a “full house” of clinical features is evident. Previous reports3,10,11 have shown that antibodies to the water channel AQP4 are specifically associated with this condition. We have established a new assay (FIPA) for potential clinical use and compared it with an AQP4-transfected cell-based assay10 and with detection of NMO IgG.8 Our results suggest that the antibodies detected by indirect immunofluorescence are directed principally against AQP4 and are best assayed by an antigen-specific test. In this relatively small cohort, the FIPA and cell-based assay showed superior sensitivity (76%-80%) and 100% specificity. We were not able to confirm the results of the study by Takahashi et al10 that the AQP4 antibody titer was related to spinal cord lesion length, but our samples were not all taken at the time of magnetic resonance imaging and some were obtained after immunosuppression, which was associated with reduced values. However, antibody levels were positive in all 10 patients sampled during relapse, and higher positivity overall might be expected if serum samples were obtained during a relapse and before commencement of immunosuppression. Nevertheless, it is not yet clear whether the antibodies are detectable in all patients at presenta-


WWW.ARCHNEUROL.COM


tion or how often high-risk antibody-negative patients should be retested. The cell-based assay, as previously reported,10 demonstrates that disease-associated antibodies bind to AQP4 in a naturally folded state when it is located on the cell surface and, thus, accessible to pathogenic antibodies. Indirect evidence for a humoral pathogenesis in NMO comes from histopathologic studies that demonstrate immunoglobulin deposits and complement activation in acute NMO lesions,15 as well as a pattern-specific intralesional loss of AQP4.16-18 Our finding that AQP4 antibody and NMO IgG belong principally to the IgG1 subclass and can activate complement in vitro provides evidence of the potential pathogenicity of this antibody, confirming a recent report19 that also demonstrated reduction of surface AQP4 expression by endocytosis or degradation and complement activation. Our detection of IgG1 and complement-activating antibodies on brain tissue by immunofluorescence supports the idea that these mechanisms could operate in vivo. Overall, these results strongly support the use of therapies that target humoral immune mechanisms6,7,20,21 and also the possibility of anti-complement therapy. Neuromyelitis optica is the first MS-like disease in which a major antigen has been identified, but it is one of a growing number of central nervous system diseases associated with antibodies to cell membrane proteins, particularly ion channels.1-3 The approaches described are already being used to establish assays for antibodies to a range of different ion channels and receptors (P.W., D.B., and A.V., unpublished data, 2005-2008) to diagnose and study the widening spectrum of antibody-mediated neurologic diseases. Accepted for Publication: February 19, 2008. Correspondence: Angela Vincent, MBBS, MSc, FRCPath, Neurosciences Group, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DS, England ([email protected] .uk). Author Contributions: Study concept and design: Waters, Jarius, Leite, S. Jacob, Beeson, and Vincent. Acquisition of data: Waters, Jarius, Littleton, Leite, S. Jacob, Gray, Geraldes, Vale, A. Jacob, Palace, Maxwell, and Vincent. Analysis and interpretation of data: Waters, Jarius, Littleton, Leite, and Vincent. Drafting of the manuscript: Jarius, Littleton, Leite, and Vincent. Critical revision of the manuscript for important intellectual content: Waters, Jarius, Littleton, Leite, S. Jacob, A. Jacob, Palace, and Vincent. Statistical analysis: Jarius, Littleton, and Vincent. Obtained funding: Vincent. Administrative, technical, and material support: Waters, Jarius, Littleton, and A. Jacob. Study supervision: Palace and Vincent. Financial Disclosure: Dr Beeson has filed a patent (PCT/ GB2006/050455) for the use of EGFP-tagged acetylcholine receptor, muscle-specific kinase, and AQP4 for autoantibody detection; and Dr Vincent and her department receive royalties and revenue for performing antibody assays for neurologic diseases. Funding/Support: This study was partly supported by the National Institute of Health Research Oxford Biomedi-

cal Research Centre Programme. Dr Jarius was supported by a fellowship from the European Neurological Society. Dr Leite was supported by a fellowship from the Fundac¸a˜o para a Cieˆncia e a Tecnologia in Portugal. Additional Contributions: The Medical Research Council (Drs Waters and Beeson and Ms Maxwell), R. Voltz, MD (Dr Jarius), the Muscular Dystrophy Campaign (Drs Jarius, Beeson, and Vincent), and B. P. Morgan, PhD, provided monoclonal antibodies and advice; and M. Esiri, DPhil, and R. Hohlfeld, MD, provided comments.

REFERENCES 1. Vincent A, Lang B, Kleopa KA. Autoimmune channelopathies and related neurological disorders. Neuron. 2006;52(1):123-138. 2. Buckley C, Vincent A. Autoimmune channelopathies. Nat Clin Pract Neurol. 2005; 1(1):22-33. 3. Lennon VA, Kryzer TJ, Pittock SJ, Verkman AS, Hinson SR. IgG marker of opticspinal multiple sclerosis binds to the aquaporin-4 water channel. J Exp Med. 2005; 202(4):473-477. 4. Wingerchuk DM, Lennon VA, Lucchinetti CF, Pittock SJ, Weinshenker BG. The spectrum of neuromyelitis optica. Lancet Neurol. 2007;6(9):805-815. 5. Wingerchuk DM, Hogancamp WF, O’Brien PC, Weinshenker BG. The clinical course of neuromyelitis optica (Devic’s syndrome). Neurology. 1999;53(5):1107-1114. 6. Papeix C, Vidal JS, de Seze J, et al. Immunosuppressive therapy is more effective than interferon in neuromyelitis optica. Mult Scler. 2007;13(2):256-259. 7. Mandler RN, Ahmed W, Dencoff JE. Devic’s neuromyelitis optica: a prospective study of seven patients treated with prednisone and azathioprine. Neurology. 1998;51(4):1219-1220. 8. Lennon VA, Wingerchuk DM, Kryzer TJ, et al. A serum autoantibody marker of neuromyelitis optica: distinction from multiple sclerosis. Lancet. 2004;364 (9451):2106-2112. 9. Wingerchuk DM, Lennon VA, Pittock SJ, Lucchinetti CF, Weinshenker BG. Revised diagnostic criteria for neuromyelitis optica. Neurology. 2006;66(10): 1485-1489. 10. Takahashi T, Fujihara K, Nakashima I, et al. Anti-aquaporin-4 antibody is involved in the pathogenesis of NMO: a study on antibody titre. Brain. 2007; 130(pt 5):1235-1243. 11. Paul F, Jarius S, Aktas O, et al. Antibody to aquaporin 4 in the diagnosis of neuromyelitis optica. PLoS Med. 2007;4(4):e133. doi:10.1371/journal.pmed.0040133. 12. Waters P, Jarius S, Littleton E, et al. A novel sensitive assay for aquaporin-4 antibodies (NMO-IgG) [abstract]. J Neurol Neurosurg Psychiatry. 2007;78(10): 1030. 13. McDonald WI, Compston A, Edan G, et al. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann Neurol. 2001;50(1):121-127. 14. Jarius S, Franciotta D, Bergamaschi R, et al. NMO-IgG in the diagnosis of neuromyelitis optica. Neurology. 2007;68(13):1076-1077. 15. Lucchinetti CF, Mandler RN, McGavern D, et al. A role for humoral mechanisms in the pathogenesis of Devic’s neuromyelitis optica. Brain. 2002;125(pt 7): 1450-1461. 16. Roemer SF, Parisi JE, Lennon VA, et al. Pattern-specific loss of aquaporin-4 immunoreactivity distinguishes neuromyelitis optica from multiple sclerosis. Brain. 2007;130(pt 5):1194-1205. 17. Misu T, Fujihara K, Kakita A, et al. Loss of aquaporin 4 in lesions of neuromyelitis optica: distinction from multiple sclerosis. Brain. 2007;130(pt 5):12241234. 18. Jarius S, Paul F, Franciotta D, et al. Mechanisms of disease: aquaporin-4 antibodies in neuromyelitis optica (published online ahead of print March 11, 2008). Nat Clin Pract Neurol. 2008;4(4):202-214. 19. Hinson SR, Pittock SJ, Lucchinetti CF, et al. Pathogenic potential of IgG binding to water channel extracellular domain in neuromyelitis optica. Neurology. 2007; 69(24):2221-2231. 20. Cree BA, Lamb S, Morgan K, Chen A, Waubant E, Genain C. An open label study of the effects of rituximab in neuromyelitis optica. Neurology. 2005;64(7):12701272. 21. Keegan M, Pineda AA, McClelland RL, Darby CH, Rodriguez M, Weinshenker BG. Plasma exchange for severe attacks of CNS demyelination: predictors of response. Neurology. 2002;58(1):143-146.


WWW.ARCHNEUROL.COM


ORIGINAL CONTRIBUTION

Association Between Clinical Conversion to Multiple Sclerosis in Radiologically Isolated Syndrome and Magnetic Resonance Imaging, Cerebrospinal Fluid, and Visual Evoked Potential Follow-up of 70 Patients Christine Lebrun, MD; Caroline Bensa, MD; Marc Debouverie, MD; Sandrine Wiertlevski, MD; David Brassat, MD; Jerome de Seze, MD; Lucien Rumbach, MD; Jean Pelletier, MD; Pierre Labauge, MD; Bruno Brochet, MD; Ayman Tourbah, MD; Pierre Clavelou, MD; for the Club Francophone de la Scle´rose en Plaques Background: Subclinical demyelinating lesions may occur in the brains of asymptomatic individuals. Objective: To describe the clinical and magnetic reso-

nance imaging (MRI) follow-up of patients with subclinical demyelinating lesions that fulfill the Barkhof/ Tintore´ criteria. Design: Prospective study. Setting: University-affiliated teaching hospitals. Patients: Fifty-three women and 17 men with subclinical demyelinating lesions (mean age, 35.63 years). Main Outcome Measures: Cerebrospinal fluid, MRI,

and visual evoked potential measurements. Methods: All patients underwent their first brain MRI

for various medical problems that were not suggestive of multiple sclerosis (MS). The patients’ physicians proposed that they undergo paraclinical studies (blood, cerebrospinal fluid, and visual evoked potential analysis) and follow-up with MRI.

F

Author Affiliations are listed at the end of this article. Group Information: Members of the Club Francophone de la Scle´rose en Plaques are listed at the end of this article.

Results: Twenty-three patients (33%) had clinical conversion: 6 to optic neuritis, 6 to myelitis, 5 to brainstem symptoms, 4 to sensitive symptoms, 1 to cerebellar symptoms, and 1 to cognitive deterioration. The mean time between the first brain MRI and the first clinically isolated syndrome was 2.3 years (range, 0.8-5.0 years). Twelve patients had been treated with immunomodulators after a clinically isolated syndrome. Examination of pejorative markers for clinical conversion showed that sex, number of T2 lesions, presence of oligoclonal bands, and IgG index were not statistically different in patients with MS determined by MRI compared with clinically definite MS. Visual evoked potential abnormalities, young age, and gadolinium enhancement on follow-up MRI were more frequent in clinically definite MS than in MS determined by MRI. Conclusions: In this cohort, we determined the rate of clinical conversion (33%) during a mean follow-up of 5.2 years. To our knowledge, this is the first clinically isolated syndrome cohort with preclinical follow-up. Early treatment of these patients with MS determined by MRI should be discussed.

Arch Neurol. 2009;66(7):841-846

EW CASE REPORTS HAVE BEEN

published on patients with asymptomatic demyelinating lesions with suspicion and final diagnosis of relapsing-remitting or primary progressive multiple sclerosis (MS).1-6 We recently reported on a descriptive retrospective study of the clinical characteristics and 5-year magnetic resonance imaging (MRI) follow-up of patients with subclinical demyelinating lesions that fulfill the criteria of Barkhof et al7 and Tintore´ et al.8 The patients’ neurological examination results were normal, which shows the impor-


tance of the demonstration of dissemination of the disease in time and space during the preclinical phase.9 We report herein on a new prospective descriptive study concerning 70 patients with subclinical MS (radiologically isolated syndrome [RIS]) and describe the predictive clinical, imaging, and electrophysiological factors in diagnosing a clinically isolated syndrome (CIS). METHODS From 2000 to 2008, a total of 70 patients who presented with brain asymptomatic T2-

WWW.ARCHNEUROL.COM


Table 1. Patient Characteristics After Paraclinical Examination Patients, No (%) Characteristic ⱖ9 T2-hyperintense lesions Gadolinium enhancement First MRI Second MRI Both MRIs Infratentorial lesions Abnormal VEP Oligoclonal bands Increased IgG index Oligoclonal bands and increased IgG index ⱖ9 T2-hyperintense lesions and gadolinium enhancement ⱖ9 T2-hyperintense lesions, gadolinium enhancement, and abnormal VEP ⱖ9 T2-hyperintense lesions, gadolinium enhancement, oligoclonal bands, and increased IgG index Met all criteria a

CIS (n = 23)

MS on MRI (n = 47)

P Value

22 (95.6)

41 (87.2)

.27

15 11 9 (39) 8 (34.8) 20 (87) 12 (52.1) 12 (52.1) 11 (47.8) 11 (47.8) 10 (43.5) 7 (30.4) 7 (30.4)

2 8 3 (6.3) 37 (78.7) 25 (53) 18 (38.2) 16 (34) 12 (25.5) 9 (19.2) 2 (4.2) 2 (4.2) 1 (2.1)

.05 .02 .03 .048 .02 .27 .14 .06 .02 .04 .04 .02

Abbreviations: CIS, clinically isolated syndrome; MRI, magnetic resonance imaging; MS, multiple sclerosis; VEP, visual evoked potential. a Only 1 patient who met all criteria had not yet presented with neurological symptoms.

hyperintense signals fulfilling Barkhof/Tintore´ criteria were included in the study. General practitioners asked for medical advice from neurologists from the MS centers in their respective regions concerning asymptomatic patients with possible MS, suspected from brain MRI. None of the patients had a neurological history that was suggestive of a CIS. All patients initially underwent brain MRI (1.5-T, axial fluid-attenuated inversion recovery, and fast spin-echo T2- and T1-weighted sequences with and without gadolinium) for various medical problems not suggestive of MS. As recommended, the neurologist at the MS center applied the Barkhof/Tintore´ criteria only to T2-hyperintense signals greater than 3 mm on the T2weighted fast spin-echo sequence. Patients who did not fulfill the MRI criteria were not enrolled. When demyelinating lesions fulfilled three-fourths of Barkhof/Tintore´ MRI criteria, it was proposed that patients undergo extensive neurological examinations, including paraclinical studies (blood samples, spinal fluid analysis, and evoked potentials) and clinical and MRI follow-up. Case reports were prospectively gathered and a neurologist (blinded to clinical diagnosis) reviewed MRI scans and classified them according to Barkhof/Tintore´ criteria: number and location of fast spin-echo T2-weighted lesions and number of gadolinium-enhanced lesions. When biological screening and cerebrospinal fluid (CSF) and visual evoked potential (VEP) examinations were performed, MRI follow-up was proposed with another brain MRI after 3 to 6 months, including T2-weighted fast spin-echo/proton density–weighted sequences and T1 with and without gadolinium. After each MRI, the patients underwent neurological examinations.

BIOLOGICAL SCREENING All patients initially had normal neurological and biological analysis results. All patients underwent biological and immunological tests, including a complete blood cell count and measurements of erythrocyte sedimentation rate, serum cryoglobulins, total serum gamma globulins, serum protein immunoelectrophoresis, C-reactive protein, complement factors, antinuclear antibodies, antinative DNA, antiphospholipid/ anticardiolipin antibodies, rheumatoid factor, antiprothrombinase, human immunodeficiency virus, herpes simplex virus, varicella-zoster virus, hepatitis C and B, cytomegalovirus, and Epstein-Barr virus serology.

All patients underwent CSF analysis with cell count and a protein level and oligoclonal band evaluation by isoelectrofocusing methods. Detection of oligoclonal bands was considered positive if more than 1 band that was not detected in the serum was present in CSF.

STATISTICAL ANALYSIS Intergroup comparison was performed with the Fisher exact test for categorical variables and with the Wilcoxon test for quantitative variables. All tests were 2-tailed and P ⬍.05 was considered statistically significant. Comparison between relative frequencies was done using the ␹2 distribution. Survival analysis was used to assess time-dependent variables. The end point was the time from the first MRI to the CIS and was analyzed using Kaplan-Meier estimates. Survival curves were compared using the log-rank test. RESULTS

Seventy patients were identified: 53 women and 17 men with a mean age of 35.63 years (range, 16-48 years; mean age: men, 35.3 years; women, 35.7 years) (Table 1). Nine patients had a relevant family history (5 with MS and 4 with migraine). Twenty-five patients had a medical background: migraine (n = 12), depression (n = 7), endocrinologic disorders (n=4), atopic eczema (n=2), and breast cancer (n=1). The first brain MRI was usually ordered by the general practitioner for various medical events, including headache (n=24), migraine with (n=4) or without (n=10) aura, craniocerebral trauma (n=2), depression (n=7), tinnitus (n=7), radiculalgia (n=5), endocrinopathies (n = 3), childhood epilepsy (n = 2), cognitive complaint (n=1), anosmia (n=1), and dystonia (n=1); 3 patients had volunteered to undergo MRI. None of these complaints were related to suspicion of a demyelinating event. Even if depression and radiculalgia rarely precede MS, it cannot be definitively disregarded as a CIS. The mean follow-up time for the whole cohort was 5.2 years (range, 3-6.4 years). The mean time between the


WWW.ARCHNEUROL.COM


1.00

Survival Distribution Function

first consultation and the first brain MRI was 5 months (range, 1-48 months). Seventeen patients had initial gadolinium enhancement, 58 had at least 9 T2-hyperintense lesions, and 45 had infratentorial lesions (Table 1). Cerebrospinal fluid analysis revealed a mean cell count of 3 cells/mm3 (range, 0-16 cells/mm3; with 28 patients having ⬎4 cells/mm3). Thirty patients had oligoclonal bands and 28 had an increased IgG index. Forty-five patients had an abnormal asymptomatic VEP. For the 12 patients with fewer than 9 T2-hyperintense signals on brain MRI, CSF abnormalities were seen in 2 cases associated with an abnormal VEP. Among the 58 patients with at least 9 T2-hyperintense signals, 38 of 58 (65.5%) had an abnormal VEP and 48 of 58 (82.7%) had a positive CSF result. The mean time until the second brain MRI was 6 months (range, 3-30 months) (3-6 months in 34 patients, 6-12 months in 14 patients, 12-24 months in 21 patients, and 30 months in 1 patient). Sixty-four patients (91%) had dissemination in time, including 20 of 64 patients (37%) with new gadolinium enhancement and 47 with at least a new T2 lesion. Patients with dissemination in time were considered to have MS on MRI. During follow-up, 23 of 70 patients were found to have clinical conversion to the following conditions: optic neuritis (n = 6), myelitis (n = 6), brainstem (diplopia or internuclear ophthalmoplegia) symptoms (n = 5), sensitive symptoms (paresthesias in lower or upper limbs) (n=4), cerebellar symptoms (n = 1), and cognitive deterioration (n=1). No progressive form of MS was detected. No particular event (infection or vaccination) was found in the 3 months before the CIS. The mean time between the first brain MRI and CIS was 2.3 years (range, 0.8-5.0 years). Twelve patients had been treated with immunomodulators after the CIS: 8 with interferon and 4 with glatiramer acetate (4 patients after the second relapse). Of patients who had MS diagnosed according to McDonald criteria,10,11 4 had their first clinical event during the first year after the initial MRI, 6 patients had it during the second year, 11 had it during the third and fourth years, and 2 had it at 5 years (Figure 1). The mean age at development of a CIS was 34.2 years. Eight of 23 patients had 2 relapses, with a mean delay of 9 months. To date, the mean Expanded Disability Status Scale (EDSS) score for the 23 patients who had a CIS is 1.5 (range, 0-4), with a mean follow-up after the CIS of 2.1 years. Considering MRI criteria, we found that only gadolinium enhancement on MRI and infratentorial lesions were statistically significant for clinical conversion in a univariate analysis (P=.01) (Table 1). Associated MRI criteria (ⱖ9 T2-hyperintense lesions and gadolinium enhancement) predicted CIS (P⬍.05). When comparing patients with initial symptoms that are unlikely to represent demyelinating events with those who had symptoms that possibly represented a CIS, only gadolinium enhancement was statistically significant (P=.005) (Table 2). The CSF criteria were only statistically significant when associated with 9 or more T2-hyperintense lesions on the first MRI on multivariate analysis (P=.02) (Figure 2). An abnormal VEP at presentation was a significant pejorative marker for developing CIS in a univariate analysis (P⬍.05) (Table 3). Meeting MRI criteria for MS, added to CSF abnormalities alone or to a VEP abnormality, was associated

0.75

0.50

0.25

0.00 0.0

2.5

5.0

7.5

10.0

12.5

15.0

17.5

20.0

Follow-up, y

Figure 1. Kaplan-Meier survival curve showing the risk of developing a clinically isolated syndrome (CIS). At 1 year, 92% of patients have not had a CIS. At 2 years, 82% of patients have not had a CIS. At 3 years, 59% of patients have not had a CIS.

Table 2. Initial Symptoms Leading to Brain Magnetic Resonance Imaging No. of Patients by Likelihood of Symptom Representing a Demyelinating Event Characteristic ⱖ9 T2-hyperintense signals Gadolinium enhancement Infratentorial lesions Oligoclonal band Visual evoked potential Clinically isolated syndrome

Unlikely a (n=46)

Possible b (n=24)

P Value

37 16 31 21 31 15

21 1 14 9 14 8

.10 .005 .45 .5 .45 .95

a Cranial trauma, research scan, headaches, and endocrinology. b Depression, dystonia, anosmia, auditive disorders, radiculalgia, cognitive

complain, and seizures.

with an increased risk of a CIS. Among the patients with CIS, 7 (30.4%) met all of the studied criteria before clinical conversion (Table 1) and only 1 (2.1%) patient in the nonconversion group met all of the criteria. The mean residual EDSS score of these patients with CIS was 2.8 (range, 1-6), which is worse than the whole CIS but not statistically significant. COMMENT

The concept of preclinical MS is now recognized and is an exciting concept for neurologists. Case reports have already been published for first-degree relatives of patients with MS who are at particular risk, demonstrating 10% of subclinical demyelination in asymptomatic siblings in a particular population in Sardinia.12,13 We have already described a cohort of 30 pre-MS patients who presented with subclinical MS and had MS dissemination criteria in space on MRI.9 Twenty-six of the 70 patients (37%) of this new cohort had developed a CIS with a clinical expression corresponding to that reported in a review of a large database of patients with CIS, which found that 21% presented with optic neuritis, 46% presented


WWW.ARCHNEUROL.COM


A 1.00

Survival Distribution Function

Table 3. Prognostic Factors for Developing a Clinically Isolated Syndrome

Negative CSF result and 0