J Plant Growth Regul (2016) 35:109–120 DOI 10.1007/s00344-015-9511-z
Arbuscular Mycorrhizal Fungus Alleviates Chilling Stress by Boosting Redox Poise and Antioxidant Potential of Tomato Seedlings Airong Liu1 • Shuangchen Chen1,2 • Mengmeng Wang1 • Dilin Liu3 • Rui Chang1 • Zhonghong Wang2 • Xiaomin Lin1 • Bing Bai4 • Golam Jalal Ahammed1
Received: 20 November 2014 / Accepted: 11 March 2015 / Published online: 3 June 2015 Ó Springer Science+Business Media New York 2015
Abstract The universal symbiotic associations between arbuscular mycorrhizal fungi (AMF) and plant roots remarkably stimulate plant growth, nutrient uptake, and stress responses. The present study investigated the stress ameliorative potential of the AM fungus Funneliformis mosseae against chilling in tomato seedlings. AMF-inoculated tomato seedlings exhibited significantly higher fresh weight and dry weight than non-AMF control plants under both control (25/15 °C) and low temperature (8 °C/4 °C) treatments. Under chilling stress, AMF inoculation significantly reduced the level of MDA, H2O2, and O2 along with increased calcium precipitates in the apoplast and vacuole of root cells compared with the non-AMF control. Furthermore, AMF inoculation induced activities of antioxidant enzymes and transcripts of related genes under chilling stress. Notably, AMF inoculation resulted in reduced redox state in root cells as evident by significantly increased content of reduced ascorbate, reduced glutathione, redox ratio, and the activity of L-galactono-1,4lactone dehydrogenase in the tomato roots both under & Shuangchen Chen
[email protected];
[email protected] 1
College of Forestry, Henan University of Science and Technology, No.70, Tianjin Road, Luoyang 471003, Henan, People’s Republic of China
2
Department of Plant Science, Agricultural and Animal Husbandry College of Tibet University, Xueyuan Road, Linzhi 860000, People’s Republic of China
3
Rice Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, Guangdong, People’s Republic of China
4
Laboratory of Plant Physiology, Wageningen University, Wageningen 6700 AR, The Netherlands
control and low temperature. Taken together, these results indicate that AMF could play an important role in optimizing chilling resistance by maintaining redox poise and calcium balance in tomato seedlings. Keywords Arbuscular mycorrhizal fungus Low temperature stress Redox poise Tomato (Solanum lycopersicum L.)
Introduction Chilling stress adversely affects plant growth and productivity by altering a series of morphological, physiological, biochemical, and molecular processes (Sanghera and others 2011). Various phenotypic symptoms in response to chilling stress include reduced leaf expansion, wilting, chlorosis, and necrosis. Low temperature induces a number of alterations in cellular components, including the content and composition of lipids, hormone levels, proteins, and carbohydrates and the activation of ion channels (Popov and others 2012; Chen and others 2014). Tomato is highly sensitive to chilling stress, which inhibits seed germination and photosynthesis during the early stages of plant growth and development (Zhang and others 2014). A temperature below 8 °C causes significant growth retardation of tomato seedlings (Atherton and Rudich 1986). However, at the later stages, it affects reproductive development causing homeotic floral transformations. Fruit setting is also hampered due to poor pollen germination as a result of low temperature and it causes chilling injury of fruit at the ripening stage (Pandey and others 2011). Thus, the chilling sensitivity of tomato is a major constraint for sustainable vegetable production in many regions. Notably, few studies
123
110
have been conducted using physiological strategies to improve chilling tolerance in the roots of tomato (Iseri and others 2013; Ntatsi and others 2014). Roots of the vast majority of plant species develop symbiotic associations with arbuscular mycorrhizal fungi (AMF). The symbiotic association between plant roots and AMF improves plant performance under normal and stressful conditions (Bunn and others 2009, Fusconi and Berta 2012). Previous studies have reported the relief of chilling stress through the use of AMF (Zhu and others 2010; Abdel Latef and He 2011; Chen and others 2013). Such studies were predominantly focused on primary metabolism such as plant growth, nutrient uptake, chlorophyll parameters, photosynthesis, and antioxidant enzymes. Especially, the use of AMF for manipulation of chilling stress responses in plants has gained extensive attention in recent years (Grover and others 2011; Zhou and others 2012a). In response to mycorrhizal inoculation, chilling-stressed plants showed higher leaf water potential (El-Tohamy and others 1999). AMF-induced enhanced chilling tolerance of plants may be not only attributed to reduced lipid peroxidation and permeability in the plasma membrane, but also to increased osmolyte accumulation, enhanced antioxidant enzyme activity, photosynthesis, and secondary metabolism (Bunn and others 2009; Zhu and others 2010; Abdel Latef and He 2011; Chen and others 2013). The cellular and organellar redox states play signaling roles in the regulation of gene and protein expression in a wide variety of plant physiological processes including stress acclimation (Shigeoka and Maruta 2014). Zhou and others (2012b) reported that hydrogen peroxide (H2O2) generated by triphosphopyridine nucleotide NADPH oxidase in the apoplast of plant cells plays a crucial role in cold acclimation-induced tolerance. Notably, ascorbate, glutathione, and the NADPH-generating dehydrogenases had a role in the process of chilling acclimation because of their effect on the redox state of the cell (Airaki and others 2012). Protection against chilling stress is also associated with activity of L-galactono-1,4-lactone dehydrogenase (GaILDH) that plays an imperative role in maintaining ascorbate pool and ascorbate redox state (Wang and others 2013). These studies indicate that cellular redox poise is one of the key factors that modulate chilling stress tolerance (Suzuki and others 2012). However, few studies have attempted to elucidate the relative quantitative and qualitative contributions of AMF in maintaining the redox state of plants particularly under chilling stress. Recently, we demonstrated that enhanced secondary metabolism and integrated transcriptional regulation by AMF inoculation might play a crucial role in AMF-mediated alleviation of chilling stress (Chen and others 2013). This AMF-induced low-temperature tolerance is also associated with efficient neutralization of H2O2 and increased ATPase activity in
123
J Plant Growth Regul (2016) 35:109–120
cucumber. Ca2? acts as a downstream component in the H2O2 signaling pathway (Li and Xue 2010). For example, treatment with H2O2 can induce an increase in cytosolic Ca2? concentration (Rentel and Knight 2004). Therefore, understanding the changes in the content of H2O2 and Ca2? may provide insights into mechanisms involved in the tolerance of mycorrhizal plants to abiotic stress. However, only limited information is available on the effect of AMF inoculation on net fluxes of H2O2 and Ca2? in roots under abiotic stress (Zou and others 2015). Here, we hypothesized that the AMF-mediated alterations in H2O2 would possibly stimulate the cellular redox state through regulating the ascorbate–glutathione cycle. In this study, we used tomato as it is a model plant and could be easily infected by AM fungi for symbiotic association. To test this hypothesis, we systematically investigated the effect of AMF inoculation on the physiological features of tomato seedlings exposed to sub-optimal temperature with a focus on localization of calcium, antioxidant enzyme activity, and cellular redox status in roots. This study unveil the critical role of AMF inoculation in regulating calcium accumulation and redox poise toward enhanced tolerance to chilling stress in tomato seedlings.
Materials and Methods Plant Culture, Mycorrhizal Inoculation, and Treatments Seeds of tomato (Solanum lycopersicum L. cv. Zongza 9) were obtained from the Institute of Vegetables and Flowers, CAAS, P.R. China. AMF inocula [Funneliformis mosseae (T.H. Nicolson & Gerd.) C. Walker & A. Schu¨ßler] consisting of spores, soil, hyphae, and infected clove (Trifolium repens L.) root fragment were taken from a stock culture of F. mosseae, which was propagated by AMF inocula donated by Dr. Tunde Tackas, Hungarian Academy of Sciences. The inoculated dosage was 10 g of inocula per pot containing approximately 720 spores per gram calculated by microscopy before the experiment. There were 2100 infective propagules/g in the inoculum as determined by MPN assay (Porter 1979). Seeds were surface sterilized by immersion in 70 % ethanol for 5 min, rinsed four times with distilled water, and placed on wet filter paper in Petri dishes at 28 °C for germination. After 3 days, the germinated seeds were transplanted into 13 cm 9 13 cm plastic pots containing 0.88 kg organized soil substrate (organic manure, soil and decomposed straw = 1:2:1). Half of the pots (AM plants) were inoculated with 10 g of F. mosseae per pot. Non-AM plants received the same weight of autoclaved inocula. The inocula were placed adjacent to
J Plant Growth Regul (2016) 35:109–120
each seedling root. The organic substrate was collected from the greenhouse of Institute of Vegetables and Flowers, CAAS and sterilized for 4 h at 160 °C, with the chemical properties as follows: pH 7.15, 10.8 % organic matter, 144 mg kg-1 available phosphorus, 520 mg kg-1 available nitrogen, and 546 mg kg-1 available potassium. The experimental pots were placed in a solar greenhouse at an average temperature of 28 °C/20 °C (day/night) with photon flux density of 600 lmol m-2 s-1 and 85 % relative humidity to obtain uniform and normal seedlings which are suitable for stress treatment. Uniformly sized seedlings were transferred to a growth chamber subjected to different temperature conditions at 20 days after inoculation. The experimental design consisted of four treatments crossing two mycorrhizal inoculations levels (non-AMF and F. mosseae) with two temperature levels (25 °C/15 °C, 8 °C/4 °C, day/night). Control temperature (CT): 10 g of sterilized inocula, 25 °C/15 °C (day/night); `AMF inoculation (AMF): 10 g of inocula, 25 °C/15 °C (day/night); ´ low temperature (LT): 10 g of sterilized inocula, 8 °C/4 °C (day/night); and ˆAMF inoculation under low temperature(AMF ? LT): 10 g of inocula, 8 °C/4 °C (day/night). During the chilling stress treatment, the photon flux density was reduced to 100 lmol m-2 s-1 to minimize the well-known effects of photoinhibition. The experimental design was a completely randomized block design, four replications were designed for each treatment, and thirty plants were arranged in each replication. The mycorrhizal colonization rate was measured using the gridline intercept method described by Giovannetti and Mosse (1980) on days 45, 60, and 75 after inoculation. At 60 days after inoculation, reactive oxygen species (ROS) contents, calcium localization, enzymes, and gene transcription were determined. Biomass Determination Six plants per treatment were randomly harvested and divided into roots and shoots. After measuring fresh weight of roots and shoots by a digital measuring device, samples were kept in an oven run at 80 °C for 48 h. These dried samples were weighed to record their dry weights. Quantitative Assay of H2O2, Superoxide Anion (O– 2 ), and Lipid Peroxidation H2O2 was extracted from root tissue according to Doulis and others (1997). Root material (0.5 g) was ground in liquid nitrogen and 2 mL of 0.2 M HClO4. After thawing, the mixture was transferred to a 10-mL plastic tube and another 2 mL of 0.2 M HClO4 was added. The homogenate was centrifuged at 27009g for 30 min at 4 °C, and the supernatant was collected, adjusted to pH 6.0 with
111
4 M KOH, and centrifuged at 1109g for 1 min at 4 °C. The supernatant was placed onto a AG1x8 prepacked column (Bio-Rad, Hercules, CA), and H2O2 was eluted with 4 mL double-distilled H2O. Recovery efficiencies of H2O2 from different samples were determined by analyzing duplicate samples to which H2O2 was added during grinding at a final concentration of 50 lM. H2O2 was determined by a spectrophotometric assay (Willekens and others 1997). The sample (800 lL) was mixed with 400 lL reaction buffer containing 4 mM 2,20 -azino-di(3ethylbenzthiazoline-6-sulfonic acid) and 100 mM potassium acetate at pH 4.4, 400 lL deionized water, and 0.25 U of horseradish peroxidase. H2O2 concentration was quantified by measuring optical density of the reaction mixture at 412 nm (OD412) with a spectrophotometer (Willekens and others 1997). O2 was measured as described by Elstner and Heupel (1976) by monitoring the nitrite formation from hydroxylamine in the presence of O2 . The absorbance in the aqueous solution was recorded at 530 nm. A standard curve with NO2- was used to calculate the production rate of O2 from the chemical reaction of O2 and hydroxylamine. Lipid peroxidation was estimated by measuring the content of MDA in roots using the method of Hodges and others (1999). Root samples (0.5 g) were homogenized in 5 mL of 10 % (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 30009g for 10 min, and 4 ml of 20 % TCA containing 0.65 % (w/v) TBA was added to 1 ml of supernatant. The mixture was heated in a hot water bath at 95° C for 25 min and immediately placed in an ice-bath to stop the reaction. Then, those samples were centrifuged at 30009g for 10 min, and the absorbance of the supernatant was recorded at 532 nm. Correction of non-specific turbidity was made by subtracting the absorbance value read at 600 nm. The level of lipid peroxidation, that is, MDA, was expressed as nmol g-1 fresh weight (FW), with a molar extinction coefficient of 0.155 mM cm-1. Fixation and Transmission Electron Microscopy of Roots Sixty days after inoculation, the roots of the seedling were fixed in 3 % glutaraldehyde, 2 % potassium pyroantimonate, and 75 mM potassium phosphate (pH 7.8) at 4 °C for 4 h, and washed four to five times in 75 mM potassium phosphate and 2 % potassium pyroantimonate (pH 7.8) every 30 min. Samples subsequently were fixed in 1 % OsO4 containing 2 % potassium pyroantimonate and 75 mM potassium phosphate (pH 7.8) for 12–16 h at 4 °C, rinsed in 60 mM potassium phosphate buffer four to five times (30 min each time), dehydrated in a graded EtOH series, and embedded in Epon 812 resin (Yu and others 2009). Ultrathin sections were obtained using a Sorvall
123
112
MT-6000 ultramicrotome (Wilmington, Germany), stained with 2 % uranyl acetate for 15 min, and observed under a JEM-1200 EX transmission electron microscope (TEM Hitachi, Japan). Enzyme Extraction and Activity Assay For the enzyme assays, 0.3 g of roots was ground with 3 ml ice-cold 25 mM HEPES buffer (pH 7.8) containing 0.2 mM EDTA, 2 mM AsA, and 2 % PVP. The homogenates were centrifuged at 4 °C for 20 min at 12,0009g and the resulting supernatants were used for the determination of enzymatic activity. Ascorbate peroxidase (APX) and dehydroascorbate reductase (DHAR) activities were measured by a decrease in absorbance at 290 nm and an increase in absorbance at 265 nm, respectively (Nakano and Asada 1981). Glutathione reductase (GR) activity was measured according to Foyer and Halliwell (1976), which depends on the rate of decrease in the absorbance of NADPH at 340 nm. MDHAR activity was measured by using 1 U ascorbate oxidase, and the oxidation rate of NADH was followed at 340 nm (Adriano and others 2005). All spectrophotometric analyses were conducted on a SHIMADZU UV-2410PC spectrophotometer. The chemicals used in the experiment came from the Sigma Company of America. Determination of Glutathione and Ascorbate in Roots Ascorbic acid content was assayed according to Law and others (1983). The samples were homogenized in cold 6 % (w/v) trichloroacetic acid. The homogenate was centrifuged at 12,0009g for 20 min, and the supernatant was used for measurement. The assay was based on the reduction of Fe3? to Fe2? by ascorbate (AsA) in acidic solution. Fe2? forms complexes with bipirydyl, giving a pink color with the maximum absorbance at 525 nm. For the measurement of reduced glutathione (GSH) and oxidized glutathione (GSSG), plant root tissue (0.2 g) was homogenized in 2 ml of 2 % metaphosphoric acid containing 2 mM EDTA and centrifuged at 4 °C for 10 min at 14,0009g. GSSG and total glutathione contents were determined in the supernatants by the 5, 500 dithio-bis (2nitrobenzoic acid)-GSSG reductase recycling method. GSH content was then estimated from the difference between total glutathione and GSSG (Rao and Ormrod 1995). RNA Extraction and qRT-PCR for Gene Expression Analysis Total RNA was isolated from tomato roots in different treatments using Trizol reagent (Sangon, China) according to the manufacturer’s instruction. Genomic DNA was
123
J Plant Growth Regul (2016) 35:109–120
removed with RNeasy Mini Kit (Qiagen, Germany). Total RNA (1 lg) was reverse-transcribed using ReverTra Ace qPCR RT Kit (Toyobo, Japan) following the manufacturer’s instruction. Quantitative real-time PCR was performed using the iCycler iQTM real-time PCR detection system (Bio-Rad, Hercules, CA, USA). Each reaction (25 lL) consisted of 12.5 lL SYBR Green PCR Master Mix (Takara, Japan), 1 lL of diluted cDNA, and 0.1 lmol of forward and reverse primers. PCR cycling conditions were as follows: 95 °C for 3 min and 40 cycles of 95 °C for 10 s, 58 °C for 45 s. On the basis of EST sequences, the gene-specific primers were designed and used for amplification (Table 1). The quantification of mRNA levels is based on the method of Livak and Schmittgen (2001). The threshold cycle (Ct) value of actin was subtracted from that of the gene of interest to obtain a DCt value. The Ct value of the untreated control sample was subtracted from the DCt value to obtain a DDCt value. The fold changes in expression levels relative to the control were expressed as 2-DDCt. Statistical Analysis All data presented were averages of four repetitions of each treatment. Data were statistically analyzed using two-way analysis of variance (AVONA), and tested for significant (P B 0.05) treatment differences using Tukey’s test. Origin pro 7.5 version was used to prepare graphs.
Results AM Root Colonization in Tomato Seedling Under Low Temperature The roots of tomato seedlings from both AMF-inoculated and non-AMF treatment were microscopically examined for the colonization ratio. No AMF colonization was observed in the non-AMF control treatment. For AMFinoculated seedlings, the colonization ratio increased over time from 45 to 75 days (Fig. 1). There was a rapid increase in colonization from 45 to 60 days followed by a slow increase from 60 to 75 days. Notably, the AMF colonization in chilling-stressed seedlings was consistently lower than the control treatment during the three timepoints assayed. For instance, the colonization ratio was 79.29 and 58.85 %, respectively, for the AMF treatment and AMF ? LT treatment at day 60. Effects of AM Fungus on Seedling Growth Under Low Temperature The fresh mass and dry mass of shoots and roots from the four treatments were measured. As shown in Table 2, the
J Plant Growth Regul (2016) 35:109–120 Table 1 Primers used for realtime RT-PCR assays
113
Gene
Encoding protein
Accession no.
APX
ascorbate peroxidase
AF413573.1
Primer pairs F: GAGGTGGAGCTAATGGAAGC R: ACATCCATCCTCCCATGTTT
MDHAR
monodehydroascorbate reductase
DQ665255.1
F: TCCGAACAAACATACCTGGA R: GTGTGCGTGTGTGCAGTTAG
DHAR1
dehydroascorbate reductase
NM_001247893.1
F: CATTTCCGAAGAGCAAGGAT
GR
glutathione reductase
EU285581.2
F: GCCACTCTTTCTGGTCTTCC
AB199316.1
F: TGGTCGGAATGGGACAGAAG
R: TTTCAGGCACACTCCACTTC R: TGCTGTAGGGTGAATACCCA actin
R: CTCAGTCAGGAGAACAGGGT F forward primer, R reverse primer
Effects of AM Fungus on the Changes in Reactive Oxygen Species (ROS) and MDA Content Under Low Temperature
Fig. 1 Arbuscular mycorrhizal colonization ratio in roots of tomato plants under different treatments. CT control temperature ? nonAMF, AMF control temperature ? AMF, LT low temperature ? nonAMF and AMF ? LT- low temperature ? AMF inoculation. Means denoted by the same letter did not significantly differ at P B 0.05, according to Tukey’s test
total fresh mass and total dry mass of the AMF-inoculated seedlings were significantly increased by 43.48 and 32.05 % compared with the control under normal temperature. Such an increase was more attributed to the root mass increase rather than the shoot. For instance, AMF increased the fresh root mass by 86.13 % but only by 40.00 % for fresh shoot mass. The seedling fresh mass and dry mass under low temperature were significantly lower as compared to the control at normal temperature regardless of AMF inoculation. However, the mass increase by AMF inoculation was still observed under low temperature. In comparison with the non-AMF low temperature control, AMF increased the fresh mass, dry mass of root, root–shoot ratio of fresh mass by 53.28, 43.87, and 40.66 %, respectively. These data demonstrated the efficacy of AMF in promoting the growth of tomato seedlings under sub-optimal low temperature.
ROS are well-described second messengers in a variety of cellular processes including tolerance to environmental stresses (Huang and others 2014). To verify the effect of AM fungus on the accumulation of ROS under chilling stress, we examined the changes in H2O2 and O2 content under different treatments. In the present study, H2O2 content was increased by 28.21 % in tomato roots of AMFinoculated seedlings compared with non-AMF control under control temperature (Fig. 2a). The H2O2 levels in roots under LT were significantly increased by 3.06 times over the CT. Importantly, inoculation of AMF significantly reduced the H2O2 under low temperature, which was 51.83 % below LT treatment alone. Likewise, a reduction of O2 and MDA accumulation in the roots of AMFinoculated seedlings was also observed under chilling stress, while no distinct change between CT and AMF treatment was noted (Fig. 2b, c). Effects of AM Fungus on Localization of Calcium in Root Cells Transmission electron microscopy showed a remarkable accumulation of calcium precipitates predominantly in the apoplast and vacuole of root cells in AMF-inoculated tomato plants (Fig. 3). Intriguingly, under chilling stress, calcium precipitates in apoplasts were noticeably less in root cells, and the calcium precipitates were mostly accumulated together in the vacuole. However, inoculation of AMF with LT treatment increased calcium precipitates in root cells under chilling stress (Fig. 3). These results indicated that AMF inoculation played an important role in regulating calcium poise in roots under lower temperature.
123
114
J Plant Growth Regul (2016) 35:109–120
Table 2 Effect of AMF on biomass production of tomato under low temperature Treatment
Shoot/(gplant-1) Fresh weight
Root/(gplant-1) Dry weight
Fresh weight
Root–shoot ratio Dry weight
Fresh weight
Dry weight
Total fresh weight/g
Total dry weight/g 1.875b
CT
14.542b
1.681b
1.529c
0.194b
0.105c
0.115c
16.071b
AMF
20.213a
2.125a
2.846a
0.351a
0.141a
0.165a
23.059a
2.476a
LT
11.052c
1.073c
1.175d
0.155c
0.106c
0.144b
12.227c
1.228c
AMF ? LT
13.342b
1.481b
1.801b
0.223b
0.135b
0.151b
15.143b
1.704b
Data are means of four biological replicates (±SD) Significant differences (P \ 0.05) between treatments are indicated by different letters according to Tukey’s test
Effect of AM Fungus on Antioxidant Enzyme Activities and Gene Expression Influences of AM fungus on the activity of antioxidant enzymes that scavenge H2O2, particularly in the ascorbate– glutathione cycle, are shown in Fig. 4. APX and MDHAR activities were significantly increased in the plants under chilling stress. The activities of APX, MDHAR, GR, and DHAR of AMF-inoculated seedlings were significantly higher than those of the non-AMF control under control temperature (increased by 78.57, 63.41, 41.03, and 285.30 %, respectively). Importantly, inoculation with AMF combined with LT treatment significantly induced APX, GR, MDHAR, and DHAR activities (2.25-, 2.02-, 1.91-, and 2.28-fold, respectively) compared with LT treatment alone. Although there were minor changes between AMF and LT in the activity of MDHAR, the change was distinct between LT and AMF ? LT. Consistent with the changes of enzyme activity, AMF inoculation significantly induced the transcript level of antioxidant genes in tomato roots (Fig. 5). Notably, the remarkable expression of related genes was observed following AMF ? LT treatment compared with LT treatment alone. The expression levels of APX, MDHAR, GR, and DHAR genes in the AMF ? LT treatment were 2.364-, 1.919-, 1.713-, and 1.735-fold higher, respectively, compared with LT treatment alone. These results strongly suggest that AMF inoculation plays an important role in strengthening enzymatic antioxidant capacity.
Fig. 2 Effects of AM fungus on hydrogen peroxide (H2O2), superoxide anion (O-) 2 , and malondialdehyde (MDA) content in roots of tomato plants under chilling stress. Results are from four independent replicates. Means followed by different letters are significantly different at P B 0.05 as determined by Tukey’s test. CT control temperature, AMF AMF inoculation, LT low temperature, AMF ? LT AMF inoculation under low temperature
123
Effects of AM Fungus on Changes of Cellular Redox Status Under Chilling Stress To determine the involvement of altered cellular redox status in response to AMF inoculation, we examined the redox state of the AsA and GSH pool under chilling stress (Fig. 6). The contents of AsA and GSH, and the redox ratio
J Plant Growth Regul (2016) 35:109–120
115
Fig. 3 Effects of AM fungus on localization of calcium in root cells of tomato with CeCl3 staining and transmission electron microscopy. CT control temperature, AMF AMF inoculation, LT low temperature, AMF ? LT AMF inoculation under low temperature. V vacuole, C cytoplasm, CW cell wall, M mitochondria, P plastid, PM plasmalemma, S starch grain. Root samples were obtained on 60 days after inoculation. Arrows show calcium precipitates visualized by using dye. Scale bar 2 lm
Fig. 4 Effect of AMF inoculation on ascorbate peroxidase (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), and glutathione reductase (GR) activities in roots of tomato plants under chilling stress. CT control temperature, AMF AMF inoculation, LT low temperature, AMF ? LT AMF inoculation under low temperature. Results are from four independent replicates. Means followed by different letters are significantly different at P B 0.05 as determined by Tukey’s test
of ascorbate and glutathione were all increased (by 69.13, 49.43, 94.02, and 52.40 %, respectively) in the roots of AMF-inoculated tomato plants compared with non-
inoculated control. However, chilling stress resulted in greater decreases in the levels of AsA and GSH, and the redox ratio of ascorbate and glutathione, but led to
123
116
J Plant Growth Regul (2016) 35:109–120
Fig. 5 Effect of AMF inoculation on expression of APX, GR, MDHAR, and DHAR genes in roots of tomato plants under chilling stress. CT control temperature, AMF AMF inoculation, LT low temperature, AMF ? LT AMF inoculation under low temperature. Results are from four independent replicates. Means followed by different letters are significantly different at P B 0.05 as determined by Tukey’s test. Roots were selected randomly for collecting root tissues as samples
Fig. 6 Effects of AM fungus on the ascorbate–glutathione pool in the roots of tomato plants under chilling stress. CT control temperature, AMF AMF inoculation, LT low temperature, AMF ? LT AMF inoculation under low temperature. Results are from four independent replicates. Means followed by different letters are significantly different at P B 0.05 as determined by Tukey’s test
significant increases of DHA in the roots of tomato plants. AMF inoculation under chilling stress almost maintained the content of AsA and GSH to a level near to the CT. Intriguingly, chilling stress also resulted in the reduction of GaILDH activity, and inoculation with AMF greatly increased the level of GaILDH activity compared with LT treatment alone (Fig. 7). All these observations indicated that AMF inoculation was associated with the cellular redox homeostasis under chilling stress.
123
Discussion AMF are probably the most ancient type of symbioses between plants and microorganisms. It is proposed that AM symbiosis can improve antioxidative defense systems of plants through higher SOD activity in AMF-inoculated plants, facilitating rapid dismutation of O2- to H2O2, and subsequent prevention of H2O2 build-up by higher activities of CAT, APX, and APX (Abdel Latef and He 2011;
J Plant Growth Regul (2016) 35:109–120
Evelin and Kapoor 2014). In a previous study, higher activities of ROS-scavenging enzymes were concomitant with lowering of H2O2, less lipid peroxidation, and higher proline in AMF-inoculated plants subjected to salinity stress (Hajiboland and others 2010). AM symbiosis could increase SOD and CAT activity but decreased H2O2 and O– 2 concentrations in leaves and roots under well-watered and drought stress (Zou and others 2015). Our study showed a significant reduction of H2O2 and O– 2 accumulation in tomato roots when colonized with F. mosseae. This was in agreement with the previous reports in which AMF colonization ameliorated the low temperature- and heavy metal-induced deleterious effect on plant growth and health (Birhane and others 2012; Chen and others 2013). Thus, the accumulation of ROS in the cytoplasm of arbuscule-containing cells might ultimately lead to arbuscular degradation (Fester and Hause 2005; Talaat and Shawky 2014). Calcium plays a fundamental role in plant growth and development by acting as a second messenger in signal transduction that regulates cell cycle progression (Tuteja and Mahajan 2007; Yu and others 2009). Many of the calmodulin-binding proteins include transcription factors, ion channels, and metabolic enzymes that assist plant to effectively cope with environmental stress and pathogens (Das and Pandey 2014). Transient spatial and temporal changes in calcium pools and cytoplasmic Ca2? concentration ([Ca2?]cyt) are initial responses to external stimulation, which may trigger a physiological and developmental cascade (Lecourieux and others 2006; Batisticˇ and Kudla 2012). In the present study, transmission electron microscopic analysis demonstrated that calcium precipitates were distributed primarily in apoplast and
Fig. 7 Effects of AM fungus on GaILDH activity in the roots of tomato plants under chilling stress. CT control temperature, AMF AMF inoculation, LT low temperature, AMF ? LT AMF inoculation under low temperature. Results are from four independent replicates. Means followed by different letters are significantly different at P B 0.05 as determined by Tukey’s test
117
vacuoles of tomato root cells (Fig. 3). This was in agreement with the previous reports that a mycorrhiza-induced lower oxidative burst was found to relate to higher antioxidant enzyme activities and Ca2? influxes in trifoliate orange roots under drought stress (Zou and others 2015). Furthermore, cytosolic Ca2? was required for adventitious rooting, and Ca2? as a downstream component of H2O2 signaling pathway (Li and Xue 2010). Consistently, [Ca2?]cyt increase was reported to be involved in ROSmediated cell death (Lecourieux and others 2006). In the present study, vacuole calcium precipitates were decreased greatly in root cells after chilling treatment, whereas an increment of calcium precipitates in root cells inoculated with AMF was observed under chilling stress. Recent studies indicate that the increased cytosolic Ca2? can reduce H2O2 levels by stimulating activities of antioxidant enzymes (Yang and Poovaiah 2002). This indicated that AMF inoculation plays an important role in regulating calcium homeostasis in the roots and promoting the growth of tomato under low temperature. Intracellular thiol redox status is a critical parameter in determining plant growth and development in response to continuous production of ROS (Kopriva and others 2012). Under high light or drought and salt stress, changes in the redox state of the plastoquinone pool are known to be correlated with expression of antioxidant and defense genes, including pathogen defense genes, and phosphorylation of thylakoid proteins (Begcy and others 2011). Furthermore, maintaining higher concentrations of nonenzymatic antioxidants due to mycorrhiza would help the plant to eliminate ROS production. However, an excess ROS formation shifts the redox balance in favor of the oxidative state which leads to cell damage and death. The increase of ROS can induce an adaptive response, consisting of a compensatory upregulation of antioxidant systems, aimed to restore the redox homeostasis (La´zaro and others 2013; Garcia-Sanchez and others 2014). In the present study, we observed that the AsA content, glutathione content, and redox ratio of ascorbate were all significantly reduced accompanied by increased H2O2 and O2 content under chilling stress. On the contrary, AMF inoculation remarkably increased the AsA content, GSH content, and redox ratio of ascorbate, but decreased the H2O2 and O2 content under AMF ? LT treatment compared with LT alone. Thus, chilling-stressed mycorrhizal plants were able to cope with oxidative damage by inducing antioxidant enzyme activities and by avoiding significant chilling-induced oxidation of their ascorbate and glutathione pool. The improvement of stress tolerance often results from the enhancement of activities of antioxidant enzymes in plants. An increased level of ROS triggers the upregulation of the activity of ascorbate–glutathione cycle enzymes,
123
118
which in turn protects plants from oxidative stress (Ma and others 2008, Faltin and others 2010). However, there was an opposite conclusion reported that no significant correlation was found between activities of SOD, CAT, and H2O2 and O2 concentration in the roots (Porcel and RuizLozano 2004, Azco´n and others 2009), suggesting that low oxidative levels in AM seedlings were not mainly due to the enhanced SOD and CAT activity by mycorrhization. It is known that detoxification of ROS also involves nonenzymatic (for example, APX, GR, and guaiacol peroxidase) as well as nonenzymatic antioxidants (e.g., ascorbate, glutathione, and tocopherols). In the ascorbate–glutathione cycle, APX utilizes AsA as an electron donor for reduction of H2O2, monodehydroascorbate is reduced to AsA by MDHAR, and dehydroascorbate is reduced to AsA by DHAR (Ordon˜ez and others 2014). In the present study, AMF inoculation significantly promoted APX, GR, MDHAR, and GaILDH activity as compared to control during chilling stress, which are well in line with the previous findings (Alqarawi and others 2014; Kumar and others 2014). Moreover, we found that AMF inoculation could enhance chilling tolerance by induction of gene expression involved in oxidative stress defense mechanisms. Interestingly, the expression trend of the GR and DHAR genes was slightly different from the activities of the GR and DHAR enzymes. In reality, there are many post-transcriptional as well as post-translational events that are involved in the processing of mRNA to protein such as microRNA regulation, protein phosphorylation, protein ubiquitination, and so on, which may explain the discrepancy of results between enzymes and transcripts. Similar results were seen in previous studies (Bian and Jiang 2009). In summary, F. mosseae-colonized tomato seedlings had lower H2O2 and O2 accumulation in roots under chilling, suggesting a lower oxidative burst in AM seedlings. The lower oxidative burst in AM seedlings might be attributed to optimized resistance by maintaining the redox poise and calcium balance in tomato seedlings. Our data highlight an integrative understanding of the role of AM fungi and provide a new approach for manipulating plant tolerance for sustainable crop production under low temperature. Acknowledgments This work was supported by National Natural Science Foundation of China (31471867, 31101536), Science Development Plan Project of Shandong Province (2012GNC011111), and Outstanding Young Teacher Project in Henan Province (2011GGJS-075, 2012GGJS-078).
References Abdel Latef AAH, He CX (2011) Arbuscular mycorrhizal influence on growth, photosynthetic pigments, osmotic adjustment and oxidative stress in tomato plants subjected to low temperature stress. Acta Physiol Plant 33:1217–1225
123
J Plant Growth Regul (2016) 35:109–120 Adriano S, Angelo CT, Bartolomeo D, Cristos X (2005) Influence of water deficit and rewatering on the components of the ascorbate– glutathione cycle in four interspecific Prunus hybrids. Plant Sci 169:403–412 Airaki M, Leterrier M, Mateos RM, Valderrama R, Chaki M, Barroso JB, Del Rio LA, Palma JM, Corpas FJ (2012) Metabolism of reactive oxygen species and reactive nitrogen species in pepper (Capsicum annuum L.) plants under low temperature stress. Plant Cell Environ 35:281–295 Alqarawi AA, Abd Allah EF, Hashem A (2014) Alleviation of saltinduced adverse impact via mycorrhizal fungi in Ephedra aphylla Forssk. J Plant Interact 9:802–810 Atherton JG, Rudich J (1986) The Tomato Crop. Chapman and Hall Ltd, New York Azco´n R, Pera´lvarez MC, Biro´ B, Rolda´n A, Ruı´z-Lozano JM (2009) Antioxidant activities and metal acquisition in mycorrhizal plants growing in a heavy-metal multicontaminated soil amended with treated lignocellulosic agrowaste. Appl Soil Ecol 41:168–177 Batisticˇ O, Kudla J (2012) Analysis of calcium signaling pathways in plants. BBA Gen Subj 1820:1283–1293 Begcy K, Mariano E, Mattiello L, Nunes AV, Mazzafera P, Maia IG, Menossi M (2011) An Arabidopsis mitochondrial uncoupling protein confers tolerance to drought and salt stress in transgenic tobacco plants. PLoS ONE 6:e23776 Bian SM, Jiang YW (2009) Reactive oxygen species, antioxidant enzyme activities and gene expression patterns in leaves and roots of Kentucky bluegrass in response to drought stress and recovery. Sci Hortic 120:264–270 Birhane E, Sterck FJ, Fetene M, Bongers F, Kuyper TW (2012) Arbuscular mycorrhizal fungi enhance photosynthesis, water use efficiency, and growth of frankincense seedlings under pulsed water availability conditions. Oecologia 169:895–904 Bunn R, Lekberg Y, Zabinski C (2009) Arbuscular mycorrhizal fungi ameliorate temperature stress in thermophilic plants. Ecology 90:1378–1388 Chen SC, Jin WJ, Liu AR, Zhang SJ, Liu DL, Wang FH, Lin XM, He CX (2013) Arbuscular mycorrhizal fungi (AMF) increase growth and secondary metabolism in cucumber subjected to low temperature stress. Sci Hortic 160:222–229 Chen LJ, Xiang HZ, Miao Y, Zhang L, Guo ZF, Zhao XH, Lin JW, Li TL (2014) An overview of cold resistance in plants. J Agron Crop Sci 200:237–245 Das R, Pandey A (2014) Role of calcium/calmodulin in plant stress response and signaling. In: Das R, Pandey A, Pandey GK (eds) Approaches to plant stress and their management. Springer, New Delhi, pp 53–84 Doulis AG, Debian N, Kingston-Smith AH, Foyer CH (1997) Differential localization of antioxidants in maize leaves. Plant Physiol 114:1031–1037 El-Tohamy W, Schnitzler WH, El-Behairy U, El-Beltagy MS (1999) Effect of VA mycorrhiza on improving drought and chilling tolerance of bean plants (Phaseolus vulgaris L). J Appl Bot 73(5–6):178–183 Elstner EF, Heupel A (1976) Inhibition of nitrite formation from hydroxylammonium-chloride-simple assay for superoxide dismutase. Anal Biochem 70:616–620 Evelin H, Kapoor R (2014) Arbuscular mycorrhizal symbiosis modulates antioxidant response in salt-stressed Trigonella foenum-graecum plants. Mycorrhiza 24:197–208 Faltin Z, Holland D, Velcheva M, Tsapovetsky M, Roeckel-Drevet P, Handa AK, Abu-Abied M, Friedman-Einat M, Eshdat Y, Perl A (2010) Glutathione peroxidase regulation of reactive oxygen species level is crucial for in vitro plant differentiation. Plant Cell Physiol 51:1151–1162 Fester T, Hause G (2005) Accumulation of reactive oxygen species in arbuscular mycorrhizal roots. Mycorrhiza 15:373–379
J Plant Growth Regul (2016) 35:109–120 Foyer CH, Halliwell B (1976) The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta 133:21–25 Fusconi A, Berta G (2012) Environmental stress and role of arbuscular mycorrhizal symbiosis. In: Ahmad P, Prasad MNV (eds) Abiotic stress responses in plants. Springer, New York, pp 197–214 Garcia-Sanchez M, Palma JM, Ocampo JA, Garcia-Romera I, Aranda E (2014) Arbuscular mycorrhizal fungi alleviate oxidative stress induced by ADOR and enhance antioxidant responses of tomato plants. J Plant Physiol 171:421–428 Giovannetti M, Mosse B (1980) An evaluation of techniques for measuring vesicular–arbuscular infection in roots. New Phytol 84:489–500 Grover M, Ali SZ, Sandhya V, Rasul A, Venkateswarlu B (2011) Role of microorganisms in adaptation of agriculture crops to abiotic stresses. World J Microb Biot 27:1231–1240 Hajiboland R, Aliasgharzadeh N, Laiegh SF, Poschenrieder C (2010) Colonization with arbuscular mycorrhizal fungi improves salinity tolerance of tomato (Solanum lycopersicum L.) plants. Plant Soil 331:313–327 Hodges DM, Delong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207:604–611 Huang YM, Srivastava AK, Zou YN, Ni QD, Han Y, Wu QS (2014) Mycorrhizal-induced calmodulin mediated changes in antioxidant enzymes and growth response of drought-stressed trifoliate orange. Front Microbiol 5:682. doi:10.3389/fmicb.2014.00682 Iseri OD, Korpe DA, Sahin FI, Haberal M (2013) Hydrogen peroxide pretreatment of roots enhanced oxidative stress response of tomato under cold stress. Acta Physiol Plant 35:1905–1913 Kopriva S, Mugford SG, Baraniecka P, Lee BR, Matthewman CA, Koprivova A (2012) Control of sulfur partitioning between primary and secondary metabolism in Arabidopsis. Front Plant Sci 3:1–9 Kumar A, Dames JF, Gupta A, Sharma S, Gilbert JA, Ahmad P (2014) Current developments in arbuscular mycorrhizal fungi research and its role in salinity stress alleviation: a biotechnological perspective. Crit Rev Biotechnol. doi:10.3109/07388551. 2014.899964 Law MY, Charles SA, Halliwell B (1983) Glutathione and ascorbicacid in spinach (Spinacia oleracea) chloroplasts—the effect of hydrogen-peroxide and of Paraquat. Biochem J 210:899–903 La´zaro JJ, Jime´nez A, Camejo D, Iglesias-Baena I, Martı´ Mdel C, La´zaro-Payo A, Barranco-Medina S, Sevilla F (2013) Dissecting the integrative antioxidant and redox systems in plant mitochondria. Effect of stress and S-nitrosylation. Front Plant Sci 4:460 Lecourieux D, Ranjeva R, Pugin Alain (2006) Calcium in plant defence-signalling pathways. New Phytol 171:249–269 Li SW, Xue LG (2010) The interaction between H2O2 and NO, Ca2?, cGMP, and MAPKs during adventitious rooting in mung bean seedlings. In Vitro Cell Dev Biol Plant 46:142–148 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408 Ma YH, Ma FW, Zhang JK, Li MJ, Wang YH, Liang D (2008) Effects of high temperature on activities and gene expression of enzymes involved in ascorbate-glutathione cycle in apple leaves. Plant Sci 175:761–766 Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol 22:867–880
119 Ntatsi G, Savvas D, Ntatsi G, Klaring HP, Schwarz D (2014) Growth, yield, and metabolic responses of temperature-stressed tomato to grafting onto rootstocks differing in cold tolerance. J Am Soc Hortic Sci 139:230–243 Ordon˜ez NM, Marondedze C, Thomas L, Pasqualini S, Shabala L, Shabala S, Gehring C (2014) Cyclic mononucleotides modulate potassium and calcium flux responses to H2O2 in Arabidopsis roots. FEBS Lett 588:1008–1015 Pandey SK, Nookaraju A, Upadhyaya CP, Gururani MA, Venkatesh J, Kim DH, Park SW (2011) An update on biotechnological approaches for improving abiotic stress tolerance in tomato. Crop Sci 51:2303–2324 Popov VN, Antipina OV, Pchelkin VP, Tsydendambaev VD (2012) Changes in the content and composition of lipid fatty acids in tobacco leaves and roots at low-temperature hardening. Russ J Plant Physiol 59:177–1782 Porcel R, Ruiz-Lozano JM (2004) Arbuscular mycorrhizal influence on leaf water potential, solute accumulation, and oxidative stress in soybean plants subjected to drought stress. J Exp Bot 55:1743–1750 Porter WM (1979) The ‘‘Most Probable Number’’ method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil. Aust J Soil Res 17:515–519 Rao MV, Ormrod DP (1995) Impact of UVB and O3 on the oxygenfree radical scavenging system in Arabidopsis thaliana genotypes differing in flavonoid biosynthesis. Photochem Photobiol 62:719–726 Rentel MC, Knight MR (2004) Oxidative stress-induced calcium signaling in Arabidopsis. Plant Physiol 135:1471–1479 Sanghera GS, Wani SH, Hussain W, Singh NB (2011) Engineering cold stress tolerance in crop plants. Curr Genomics 12:30–43 Shigeoka S, Maruta T (2014) Cellular redox regulation, signaling, and stress response in plants. Biosci Biotechnol Biochem 78:1457–1470 Suzuki N, Koussevitzky S, Mittler R, Miller G (2012) ROS and redox signalling in the response of plants to abiotic stress. Plant Cell Environ 35:259–270 Talaat NB, Shawky BT (2014) Modulation of the ROS-scavenging system in salt-stressed wheat plants inoculated with arbuscular mycorrhizal fungi. J Plant Nutr Soil Sci 177:199–207 Tuteja N, Mahajan S (2007) Calcium signaling network in plants. Plant Signal Behav 2:79–85 Wang LY, Li D, Deng YS, Lv W, Meng QW (2013) Antisense-mediated depletion of tomato GDP-L-galactose phosphorylase increases susceptibility to chilling stress. J Plant Physiol 170:303–314 Willekens H, Chamnongpol S, Davey M, Schraudner M, Langebartels C, VanMontagu M, Inze D, VanCamp W (1997) Catalase is a sink for H2O2 and is indispensable for stress defence in C3 plants. EMBO J 16:4806–4816 Yang T, Poovaiah BW (2002) Hydrogen peroxide homeostasis: activation of plant catalase by calcium/calmodulin. Proc Natl Acad Sci USA 99:4097–4102 Yu JQ, Sun Y, Zhang Y, Ding J, Xia XJ, Xiao CL, Shi K, Zhou YH (2009) Selective trans-cinnamic acid uptake impairs [Ca2?]cyt homeostasis and growth in Cucumis sativus L. J Chem Ecol 35:1471–1477 Zhang GX, Liu YF, Ni Y, Meng ZJ, Lu T, Li TL (2014) Exogenous calcium alleviates low night temperature stress on the photosynthetic apparatus of tomato leaves. PLoS One 9:e97322 Zhou J, Wang J, Shi K, Xia XJ, Zhou YH, Yu JQ (2012a) Hydrogen peroxide is involved in the cold acclimation-induced chilling tolerance of tomato plants. Plant Physiol Biochem 60:141–149 Zhou ZZ, Ma HM, Liang KN, Huang GH, Pinyopusarerk K (2012b) Improved tolerance of teak (Tectona grandis L.f.) seedlings to
123
120 low-temperature stress by the combined effect of arbuscular mycorrhiza and paclobutrazol. J Plant Growth Regul 31:427–435 Zhu XC, Song FB, Xu HW (2010) Influence of arbuscular mycorrhiza on lipid peroxidation and antioxidant enzyme activity of maize plants under temperature stress. Mycorrhiza 20:325–332
123
J Plant Growth Regul (2016) 35:109–120 Zou YN, Huang YM, Wu QS, He XH (2015) Mycorrhiza-induced lower oxidative burst is related with higher antioxidant enzyme activities, net H2O2 effluxes, and Ca2? influxes in trifoliate orange roots under drought stress. Mycorrhiza 25:143–152
