Arp4 JCS 2012 ver3 - Journal of Cell Science - The Company of ...

2 downloads 0 Views 6MB Size Report
May 8, 2012 - eluate was further incubated with Nickel affinity gel and then eluted with imidazole. We ..... the mixture was spotted onto a PEI cellulose plate (Merck), and chromatography was carried out in 0.5M ..... Science 258, 759-760.
© 2012. Published by The Company of Biologists Ltd.

Heterocomplex Formation by Arp4 and β-Actin Involved in Integrity of the Brg1 Chromatin Remodeling Complex

Naoki Nishimoto1 , †, Masanori Watanabe1 , †, Shinya Watanabe2, Nozomi Sugimoto2, Takashi Yugawa1, Tsuyoshi Ikura3, Osamu Koiwai4, Tohru Kiyono1 and Masatoshi Fujita1, 2, *

Accepted manuscript

Virology Division, National Cancer Center Research Institute,

5-1-1 Tsukiji, Chuohku, Tokyo 104-0045, Japan

Journal of Cell Science

1

University of Science, Noda, Chiba 278-8510, Japan

2

Department of Cellular Biochemistry, Graduate School of Pharmaceutical Sciences, Kyushu

University, 3-1-1 Maidashi, Higashiku, Fukuoka 812-8582, Japan 3

Laboratory of Chromatin Regulatory Network, Department of Mutagenesis, Radiation

Biology Center, Kyoto University, Yoshida Konoe-cho, Sakyo-ku, Kyoto, 606-8501, Japan 4

Department of Applied Biological Science, Faculty of Science and Technology, Tokyo



These authors equally contributed to this work.

*

Author for correspondence (E-mail: [email protected])

Short title: Complex formation by Arp4 and β-Actin

Key words: Arp4, β-actin, Arp4-β-actin heterocomplex, Brg1 chromatin remodeling complex

The total words except for the References: 8392

1 JCS online publication date 8 May 2012

Summary Although nuclear actin and Arps (actin-related proteins) are often identified as components of multi-protein, chromatin-modifying enzyme complexes such as chromatin remodeling and histone acetyltransferase (HAT) complexes, their molecular functions still remain largely elusive.

We have investigated the role of BAF53/human Arp4 in Brg1 chromatin

remodeling complexes. Depletion of Arp4 by RNA interference impaired their integrity and accelerated degradation of Brg1, indicating a crucial role in maintenance, at least in certain

Accepted manuscript

on structural similarities between conventional actin and Arp4 and the assumption that actin-

Journal of Cell Science

human cell lines. We further found that Arp4 can form a heterocomplex with β-actin. Based

β-actin-Arp4 complex formation may be a crucial feature in some chromatin-modifying

Arp4 binding might mimic actin-actin binding, we introduced a series of mutations in Arp4 by which interactions with β-actin might be impaired. Some of them indeed caused reduced binding to β-actin.

Interestingly, such mutant Arp4 proteins also showed reduced

incorporation into Brg1 complexes and interactions with c-myc-associated complexes as well as Tip60 HAT complexes were also impaired. Based on these findings, we propose that

enzyme complexes like the Brg1 complex.

2

Introduction Actin–related proteins (Arps) are conserved throughout eukaryotes (Poch and Winsor, 1997; Muller et al., 2005). Among the documented examples, Arp 4 to 9 are mainly detected in the cell nucleus and often function as components of multi-subunit, chromatin-modifying enzyme complexes such as chromatin remodeling and histone acetyltransferase (HAT) complexes that play crucial roles in controlling gene expression, DNA replication and other chromatin transactions (Boyer and Peterson, 2000; Olave et al., 2002a; Blessing et al.,

Accepted manuscript

Arp8, and actin, among which Arp4 and actin are essential (Shen et al., 2000). Arp4 and

Journal of Cell Science

2004). For instance, the yeast INO80 chromatin remodeling complex contains Arp4, Arp5,

dispensable for INO80 complex assembly. The yeast SWI/SNF chromatin remodeling

Arp8 can bind to core histones, suggesting that they could facilitate interaction of the complexes with nucleosomes (Harata et al., 1999; Shen et al., 2003). Consistent with this idea, mutant INO80 complexes lacking Arp5 or Arp8 show a reduction in ATPase and chromatin remodeling activities in vitro (Shen et al., 2003). In the case of Arp8 deficiency, Arp4 and actin also disappear from the complexes, indicating that Arp4 and actin are

complex, and the highly related RSC (remodels the structure of chromatin) complex contain Arp7 and Arp9, two essential Arps (Cairns et al., 1998; Peterson et al., 1998). In contrast to the Arps in INO80, Arp7 and Arp9 show no affinity for nucleosomes (Szerlong et al., 2003). In vitro ATPase activity of mutant RSC complexes lacking them is partially impaired compared with the wild type (Szerlong et al., 2003; Szerlong et al., 2008). Actin itself is a slow ATPase and the central actin fold is important for ATP binding and hydrolysis (Wertman and Drubin, 1992; Kabsch and Holmes, 1995). Although Arps are very similar to actin in the central actin fold, it has been suggested that Arp7 and Arp9 lack ATP binding and hydrolysis (Cairns et al., 1998). Arp4 is also a component of the NuA4 HAT complex in budding yeast and, in this case, is required for integrity of the complex (Galarneau et al., 2000). Overall, molecular functions of nuclear Arps remain largely elusive. Actin itself has also been recently implicated in important processes of nuclear metabolism (Bettinger et al., 2004). Actin has been characterized as a component of several

3

chromatin-modifying enzyme complexes (Boyer and Peterson, 2000; Olave et al., 2002a; Blessing et al., 2004), almost all of which simultaneously contain nuclear Arps, implying a close relationship. One study addressed the functional role of actin in chromatin remodeling complexes using human SWI/SNF family BAF (Brg or Brm associated factor) complexes. The BAF complex is based on hBrm or Brg1, close relatives to yeast SWI2, and contains one Arp, human Arp4/BAF53, and β-actin (Zhao et al., 1998; Kuroda et al., 2002; Olave et al., 2002b). Zhao et al. have shown that BAF complex DNA-dependent ATPase activity is

Accepted manuscript

plays a crucial role in the chromatin remodeling process (Zhao et al., 1998). It has been also

Journal of Cell Science

inhibited by the actin inhibitor latrunculin-B and, based on this finding, suggested that actin

In this study, we found that depletion of Arp4 by RNA interference destabilized Brg1

proposed that the BAF complex binds to actin filaments for localization to the nuclear matrix (Rando et al., 2001). More recently, several studies have shown that actin is also involved in transcription by RNA polymerase I (Fomproix and Percipalle, 2004; Philimonenko et al., 2004), II (Hofmann et al., 2004; Kukalev et al., 2005), and III (Hu et al., 2004). However, molecular functions of nuclear actin also remain largely elusive.

chromatin remodeling complexes, accelerating the degradation of Brg1 and BAF170, the two core subunits, in several human cell lines. Interestingly, we also found that β-actin and human Arp4/BAF53 can form a heterocomplex, probably a heterodimer. Therefore, we prepared a series of Arp4 mutants based on the structural relationships between actin and Arp4 and examined their ability to bind to actin and be incorporated into Brg1 complexes. Taken together, our data suggest that interactions between β-actin and Arp4 may be required for integrity of Brg1 complexes. During the preparation of the manuscript, Fenn et al. (2011) reported structure of yeast Arp4 and interaction between the Arp4 and actin. Discussion on our and their results is also described.

4

Results Depletion of Human Arp4/BAF53 Impairs the Integrity of Brg1 Complexes and Accelerates Degradation of Brg1 and BAF170 in Several Human Cell Lines In human cells, several chromatin-modifying complexes containing β-actin and Arp4 have been identified, including BAF chromatin remodeling complexes (Zhao et al., 1998), Tip60 HAT complexes (Cai et al., 2003), and c-myc-associated transcriptional activator complexes (Park et al., 2001). In this study, we first attempted to clarify the effects of Arp4 depletion

Journal of Cell Science

Accepted manuscript

on Brg1 chromatin remodeling complexes. HeLa cells were infected with recombinant retrovirus carrying an shRNA expression vector toward Arp4 or a control vector, selected with puromycin, and examined at 5 days after infection. Whole cell lysates were prepared and subjected to immunoblotting. As shown in Fig. 1, A and B, levels of Arp4 protein were reduced to ~20% by the shRNA expression. Cell growth was significantly inhibited by Arp4 depletion (Fig. 1D), suggesting that Arp4 is essential for cell growth. Arp4 has been implicated in many transcription processes. Therefore, we performed DNA microarray analyses. The microarray used contained ~17,800 cDNAs, and only genes induced or repressed more than 2.5-fold were counted. Arp4 depletion in HeLa cells resulted in the induction of 87 genes and repression of 35 genes (Supplementary Table 1). Among them, a remarkable decrease in expression of CRYAB (alpha B-crystallin) was noted, since it has been identified as a gene that is activated by Brg1 (Liu et al., 2001). This can be taken to support the accuracy of the analysis. Thus far it is unclear how Arp4 depletion leads to growth suppression in HeLa cells. We examined protein levels of Brg1, BAF170, and BAF47/Ini1/hSNF5 (Fig. 1, A and B), which are thought to be core subunits of the Brg1 complex (Phelan et al., 1999). Interestingly, Brg1 and BAF170 protein levels were reduced to ~40% in Arp4-depleted HeLa cells. BAF47 protein levels were also reduced, but to a lesser extent. Actin protein levels were not affected. Similar results were obtained with other shRNA expression vectors targeting Arp4 (Figure 1C). One possible reason for the significant reduction in Brg1 and

5

BAF170 protein levels might be that their transcriptions were down-regulated by Arp4 depletion. However, the microarray analysis revealed that their transcription levels were virtually unchanged (Fig. 1E). On the other hand, levels of BAF47 transcripts appeared to be somewhat down-regulated (Fig. 1E), which might explain the slight decrease in BAF47 protein in Arp4-depleted cells. As expected, the microarray analysis detected the decrease in Arp4 transcript levels by the shRNA expression (Fig. 1E). Taken together, these data indicate that Brg1 and BAF170 proteins are deregulated at the post-transcription level by

Accepted manuscript

cells, the half-lives of Brg1 and BAF170 were significantly decreased (Fig. 1, F and G). In

Journal of Cell Science

Arp4 depletion. We investigated the half-lives of these proteins. In Arp4-depleted HeLa

Arp4 and analyzed at 48 hr post-transfection. As shown in Fig. 1H, the levels of Arp4

contrast, the half-lives of actin and Arp4 were not significantly changed by Arp4 depletion. These data suggest that degradation of Brg1 and BAF170 may be promoted in Arp4-depleted cells. Using a different experimental system, we further assessed whether Arp4 depletion affects the stability of Brg1. HeLa cells were transfected with two different siRNAs toward

protein were reduced to ~15% by both siRNAs and Brg1 protein levels were concomitantly decreased. The levels of SNF2H, another chromatin remodeler not associated Arp4, were unaffected. When the experiments were repeated with normal human cervical keratinocytes immortalized with telomerase (Tatsumi et al., 2006), the steady-state levels of Brg1 were again reduced with Arp4 depletion (Fig. 1I). Similar results were obtained with normal human fibroblasts immortalized with telomerase (data not shown). We also investigated whether Arp4 depletion induces apoptosis by detecting PARP1 cleavage by caspases (i.e. appearance of the 89kDa cleaved PARP1) as a readout of apoptosis (Oliver et al., 1998). Bleomycin-treated HeLa cells were used as a positive control. The data indicate that Arp4 depletion does not induce apoptosis in HeLa cells (Fig. 1J). We then characterized the Brg1 complex in Arp4-depleted HeLa cells. Nuclear extracts were prepared from Arp4-depleted and control HeLa cells, and subjected to immunoblotting. As expected, the levels of Brg1 and BAF170 proteins in nuclear extracts

6

from the Arp4-depleted cells were significantly decreased (Fig. 2, A and B). The nuclear extracts were then subjected to immunopurification with anti-Brg1 antibody beads. In these experiments, the amounts of the nuclear extracts subjected to the immunopurification were adjusted to recover the Brg1 complex at the same levels both from control and Arp4depleted cells. Namely, 4 times more nuclear extracts from Arp4-depleted cells than those from control cells were subjected to immunoprecipitation.

The precipitates were

immunoblotted with antibodies against Brg1, BAF170, Arp4, BAF47, and actin, and the

Accepted manuscript

Arp4 plus some other subunit(s) exist in Arp4-depleted HeLa cells, then their relative levels

Journal of Cell Science

signal intensities of the bands were quantified. If defective Brg1 complexes lacking Arp4 or

from nuclear extracts of Arp4-depleted cells, relatively high nonspecific ATP hydrolyzing

to Brg1 protein in the immunoprecipitates would be reduced. However, no significant difference was found in the levels of the subunits examined between the immunoprecipitates from control and Arp4-depleted cells (Fig. 2C). The data suggest that, if any, there is limited defective Brg1 complex in Arp4-depleted cells. We also examined the DNA-dependent ATPase activity of the purified Brg1 complexes (Fig. 2D). In control immunoprecipitates

activity was observed. This may be due to more nuclear extract being subjected to immunoprecipitation in the case of Arp4-depleted cells. However, the levels of specific DNA-dependent ATPase activity for Brg1 complexes prepared from Arp4-depleted cells were essentially the same as those from control cells (Fig. 2D).

Arp4 Can Form a Heterodimer with β-Actin in Bacterial Expression System As a way to address the molecular functions of Arp4, we focused on its relationship with βactin. The Arp2-3 complex regulates the formation of branched actin filaments, whereby it has been suggested that the minus end (pointed end) of actin monomers binds to the faces of the Arp2 or Arp3 equivalent to the plus end (barbed end) of actin and then actin filaments are elongated (Welch et al., 1997; Mullins et al., 1998; De La Cruz and Pollard, 2001; Robinson et al., 2001; Nolen et al., 2004). Nuclear Arp7 and Arp9 may also form a heterodimer in yeast RSC chromatin remodeling complexes (Szerlong et al., 2003).

7

Recently, it was shown that nuclear Arps and actin interact with chromatin remodelers and modifiers through conserved helicase-SANT-associated (HSA) domains and yeast Eaf1 HSA-Arp4-actin and Swr1 HSA-Arp4-actin ternary complexes were isolated (Szerlong et al., 2008).

However, whether conventional actin and nuclear Arp form dimers (or

heterocomplexes) without help of the HSA domain has not been clarified, especially in mammalian cell system. To address this issue, purified monomeric actin and bovine serum albumin, as a negative control, were immobilized on Sepharose beads and binding of in vitro

Accepted manuscript

monomers but no binding to control BSA (Fig. 3A).

Journal of Cell Science

translated human Arp4 was examined. There was significant Arp4 binding to actin

was tagged with the hemagglutinin (HA) epitope at its N-terminus. His-β-actin and HA-

To gain further insight into potential heterodimer formation by β-actin and Arp4, we sought to isolate the recombinant heterocomplex produced by an in vitro transcriptiontranslation system with bacterial extracts. We used the bacterial system to exclude the possibility that observed β-actin-Arp4 binding is mediated by other eukaryotic proteins. For these experiments, β-actin was tagged with six histidines (His) at its N-terminus and Arp4

Arp4 were co-synthesized and subjected to immunopurification with anti-HA antibody. As shown in Fig. 3B, His-β-actin was co-eluted with HA-Arp4 by excess HA peptides. The eluate was further incubated with Nickel affinity gel and then eluted with imidazole. We finally obtained purified His-β-actin-HA-Arp4 heterocomplexes (Fig. 3B). His-β-actin and HA-Arp4 appeared stoichiometric in the purified complexes, as estimated from the silver staining intensity. We then tried to determine the molecular mass of reconstituted β-actin-Arp4 heterocomplexes. In these studies, Arp4 was tagged with the tandem HA at its C-terminus and, together with His-β-actin, was bacterially expressed and purified. Then, the complexes were subjected to sucrose gradient centrifugation. They appeared to fractionate somewhat widely, from an apparent molecular mass of ~100kDa (Fig. 3C; fraction 6) to ~400kDa (Fraction 10). In the higher molecular mass fractions, a ~75kDa protein was also co-eluted (Fractions 8-10), which turned out to be a bacterial chaperon, DnaK, on immunoblot analysis

8

(data not shown). One possible interpretation for the result is while β-actin and Arp4 can form heterodimers, they readily bind to Dnak, leading to increase in the molecular mass. In this context, it is notable that actin has structural similarity to Hsp70 (Kabsch and Holmes, 1995). It also remains possible that β-actin and Arp4 can form heteropolymers. To further clarify whether β-actin and Arp4 can form heterodimers in this experimental setting, we collected fractions 6 and 7 containing the putative dimers (Fig. 3C) and re-subjected them to sucrose gradient centrifugation. They re-fractionated from fraction 5 (~80kDa) to fraction 9

Accepted manuscript

notion that β-actin and Arp4 can form heterodimers. When human cells were transfected

Journal of Cell Science

(~200kDa), with a peak in fraction 7 (Fig. 3D). The data provide further support for the

Creation of a Series of Arp4 Mutants Based on Structural Similarities with β-Actin

with HA-Arp4 and then subjected to immunoprecipitation with anti-HA antibodies, endogenous Arp4 was not co-precipitated (data not shown). Therefore, in human cells, there may be no complex that contains multiple Arp4 molecules. Taken together, the data suggest that Arp4 may form heterocomplexes, possibly heterodimers, with β-actin.

To address biological significance of Arp4-β-actin complex formation for the integrity of Brg1 complexes, we examined the influence of Arp4 mutations. For this, we utilized structural similarities between conventional actin and Arp4.

When aligned using

CLUSTALW program (http://align.genome.jp/clustalw/), Arp4 has overall ~30.1% homology and ~55.3% similarity with β-actin in the amino acid sequences (Fig. 4C). At least three relatively long insertion sequences could be identified in Arp4; amino acids K62T72, E231-R248, and V278-H286 (Fig. 4C). High-resolution structures of actin have been clarified using crystals of actin monomers bound to other proteins or small molecules that prevent polymerization (Kabsch et al., 1990; Kabsch and Holmes, 1995; Hertzog et al., 2004; Nolen et al., 2004). Fig. 4A shows a ribbon diagram of human β-actin monomer drawn by the SWISS model ver.36.0003 (http://swissmodel.expasy.org//SWISSMODEL.html) based on the above structures. Extensive mutational analyses featuring replacement of charged residues with alanine have been performed with yeast actin,

9

identifying crucial residues located on the surface of the monomer and whose mutations lead to lethality (Wertman and Drubin, 1992; Wertman et al., 1992). In principle, strong contacts are made between the minus and plus ends of the monomers during actin polymerization (Wertman and Drubin, 1992; De La Cruz and Pollard, 2001). Thus, it has been suggested that some of the identified residues may be directly involved in actin-actin binding. We reasoned that β-actin-Arp4 interactions might mimic this process. If so, it is conceivable that some critical residue in actin may be conserved in Arp4.

Accepted manuscript

Drubin, 1992; Wertman et al., 1992) and a similar amino acid stretch (224ASKEAVR230)

Journal of Cell Science

E205A/R206A/E207A are dominant lethal mutations in yeast actin (Wertman and

mutations (Fig. 4, C and D). Similarly, we constructed Arp4 M3 with E388A/R389A/R390A

to the surrounding amino acids (204AEREIVR210) was found in human Arp4 (Fig. 4, C and D). Thus, we created Arp4 M1 with K226A/E227A mutations (Fig. 4, C and D). K326A/K328A are also dominant lethal mutations in yeast actin and a similar amino acid stretch (376MRLKLIA382) to the surrounding amino acids (325MKIKIIA331) was found in human Arp4 (Fig. 4, C and D). Thus, we created Arp4 M2 with R377A/L378A/K379A

and Arp4 M4 with I340A/R341A mutations (Fig. 4, C and D). Using the Robetta server (http://robetta.bakerlab.org/), we obtained the predicted tertiary structure of human Arp4 (Fig. 4B). In this model, while the structures of subdomains 1 and 3 (equivalent to the actin plus end) appear very similar to actin, subdomains 2and 4 (equivalent to the minus end) appear different, probably due to specific insertion sequences. The amino acid residues we mutated are all positioned in similar domains to those containing the corresponding amino acids of actin (Fig. 4, A and B). In addition, we also introduced other mutations in Arp4 by which interactions with βactin might not be affected. Arp4 has a unique N-terminal 6 amino acid stretch lacking in βactin (Fig. 4C). Arp4 M7 has an Y6A mutation (Fig. 4, C and D), which might be associated with some transcriptional function of Arp4 (Lee et al., 2005). S14 in actin is an important residue for constitution of the ATP-binding pocket and the S14A mutation in yeast actin results in 40- to 60-fold reduction of ATP affinity (Chen et al., 1995). Although the

10

mutation in the corresponding serine residue, S23A, in yeast Arp4 does not leads to any detectable phenotypic change (Görzer et al., 2003), we also prepared Arp4 M8 having a S20A mutation.

Arp4 Mutants with Reduced Binding to β-Actin Show Reduced Incorporation into Brg1 Complexes To characterize properties of the prepared mutant Arp4 proteins, they were transiently

Accepted manuscript

antibodies against HA tagged to the C-terminus of Arp4. As shown in Fig. 5A, β-actin co-

Journal of Cell Science

overexpressed in 293T cells, and immunoprecipitated from prepared nuclear extracts with

shown).

precipitated with wild type Arp4-2HA. Under the experimental conditions, efficiency of enrichment of Brg1 with anti-Brg1 antibodies appeared similar to that of Arp4 (Figs. 2C and 5C), suggesting a large proportion of endogenous Arp4 proteins to be in association with Brg1 in the nucleus, with the rest being in complex with other chromatin modifying proteins such as Tip60. In addition, only a little Brg1 co-precipitated with Arp4-2HA (data not Furthermore, while Arp4-2HA was detectable in Flag-Brg1 HSA

immunoprecipitates prepared from cells co-transfected with Arp4-2HA and Flag-Brg1 HSA (Fig. 5B), the Flag-Brg1 HSA was undetectable in Arp4-2HA immunoprecipitates (Fig. 5D). Therefore, the observed β-actin co-precipitation with overexpressed Arp4-2HA in Fig. 5A may mainly represent direct binding in the cells. Interestingly, co-precipitation of β-actin with Arp4 M1 to M4 mutants was significantly decreased while that with Arp4 M7 and M8 was not (Fig. 5A), suggesting that the conserved residues may also be involved in the actinArp4 interaction. Recently, it was shown that when Flag-Brg1 HSA and HA-Arp4 are co-transfected and immunoprecipitated with anti-Flag antibodies, Flag-Brg1 HSA-HA-Arp4-β-actin ternary complexes can be detected (Szerlong et al., 2008). Here, we investigated the effects of the Arp4 mutations on this ternary complex formation. 293T cells were co-transfected with Flag-Brg1 HSA and Arp4-2HA and subjected to immunoprecipitation with anti-Flag antibodies. Wild type Arp4-2HA and endogenous β-actin specifically co-precipitated with

11

Flag-Brg1 HSA (Fig. 5, B and D). We found that co-precipitation of Arp4-2HA was impaired by mutations M1 to M4, while mutations M7 and M8 were without influence (Fig. 5B). Previous extensive mutagenic analyses of yeast Sth1 HSA-Arp7-Arp9 complexes suggested that Arp7 and Arp9 may interact with the HSA as a dimer and that their binding might be mediated by many contact sites locating along the HSA (Szerlong et al., 2008). Thus, our data could be interpreted as Arp4-β-actin complex formation being prerequisite for association with Brg1 HSA. This appears consistent with the fact that incorporation of yeast

Accepted manuscript

Fig. 5D, in Flag-Brg1 HSA- and Arp4-2HA-overexpressed 293T cells, relative amount of

Journal of Cell Science

Arp7 and Arp9 into the RSC complex is interdependent (Szerlong et al., 2003). As shown in

incorporation into genuine Brg1 complexes. We therefore precipitated Brg1 complexes with

Flag-Brg1 HSA-endogenous Arp4-β-actin complexes appeared higher than that of Flag-Brg1 HSA-exogenous Arp4-2HA-β-actin complexes. Therefore, effects of the Arp4 mutations on β-actin co-precipitation were not observed in Flag-Brg1 HSA immunoprecipitates from Flag-Brg1 HSA- and Arp4-2HA-overexpressed 293T cells. (data not shown). The above data suggest that the mutations M1 to M4 may compromise Arp4

anti-Brg1 antibodies from nuclear extracts of Arp4-2HA-overexpressed 293T cells. Exogenous wild type Arp4-2HA was incorporated into Brg1 complexes although inefficiently compared with the endogenous Arp4 (Fig. 5, C and E). Interestingly, Arp4 M1 to M4 mutants with reduced affinity for β-actin also showed reduced incorporation into Brg1 complexes (Fig. 5C). In these experiments, efficiencies of co-precipitation of endogenous Arp4 were all equal. In addition, the Arp4 M7 mutant showed only partial reduction in incorporation into the complexes and M8 mutants were incorporated with comparable efficacy to the wild type. Similar effects of the Arp4 mutations on the Arp4-β-actin interaction and incorporation into Brg1 complexes were also observed with HeLa cells (data not shown).

Effects of the Arp4 Mutations on Interactions with Other Chromatin-Modifying Enzyme Complexes

12

We further examined the effects of the Arp4 mutations on interactions with other chromatinmodifying enzyme complexes. We first transiently overexpressed the Arp4-2HA mutants in HeLa cells stably expressing Flag-Tip60 at near-endogenous levels and carried out immunoprecipitation with anti-Flag antibodies. As expected form previous report (Cai et al., 2003), wild type Arp4-2HA specifically co-precipitated with Flag-Tip60 (Fig. 6A). Whereas neither the mutation M7 nor M8 affected incorporation of Arp4-2HA into Tip60 HAT complexes, it was partially impaired by the mutations M1 to M4, with ~50% inhibition by

Journal of Cell Science

Accepted manuscript

the M3 mutation (Fig. 6A). We also investigated effects of the mutations on the Arp4-c-myc interaction. 293T cells were co-transfected with Flag-c-myc and Arp4-2HA and subjected to immunoprecipitation with anti-Flag antibodies. As reported (Park et al., 2001), wild type Arp4-2HA specifically co-precipitated with Flag-c-myc (Fig. 6B).

Whereas neither

mutation M7 nor M8 affected interaction of Arp4-2HA with c-myc, it was impaired by the mutations M1 to M4, with ~60% inhibition by the M3 mutation (Fig. 6B). Overall, these data appear consistent with the notion that the Arp4 mutants with reduced affinity for β-actin also exhibit impaired incorporation into Tip60 HAT and c-mycassociated transcription complexes although the extent may differ with the target.

Human Arp4 Possesses Core Histone Binding Activity It is known that budding yeast Arp4 and Arp8 have histone binding properties (Harata et al., 1999; Shen et al., 2003). To investigate whether human Arp4 also possesses similar activity, we purified GST-Arp4 and examined binding to core histones by pull-down assay. Core histones strongly bound to GST-Arp4 but not to control GST (Fig. 7A) and some binding remained even after washing with buffer containing 1M NaCl. We then compared the histone binding capability of each mutant Arp4 protein. The mutations we introduced had only a little effect on histone binding, with ~25% inhibition by M3 (Fig. 7B). It will be intriguing to identify Arp4 mutants which severely lose the histone binding activity. Critical residues might be positioned in the Arp4 specific insertion sequences.

13

Discussion Our analyses indicated that Arp4 forms heterocomplexes with β-actin (Figs. 3 and 5A).

At least in bacterial expression system, they can form heterodimers (Fig. 3),

reminiscent of the Arp7-Arp9 heterodimer (Szerlong et al., 2003). However, the Arp4-βactin heterodimers may be unstable under physiological condition as follows. When Arp4Flag-β-actin complexes immunopurified from Arp4-Flag-transfected 293T cells were analyzed on sucrose gradient centrifugation, many of them fractionated around the

Accepted manuscript

were mixed with recombinant Arp4 proteins and then the mixtures were subjected to gel

Journal of Cell Science

monomeric mass (data not shown). In addition, when purified monomeric G-actin proteins

chromatin-modifying complexes. Indeed, it is suggested that the HSA domains can form

filtration chromatography, again the dimeric complexes were hardly detectable (data not shown). The instability of Arp4-β-actin complex appears consistent with the reported finding that yeast Arp4 may interact with monomeric G-actins but cannot efficiently sequester them during the actin polymerization (Fenn et al., 2011). Under physiological condition, Arp4-β-actin dimers may be formed only transiently as intermediates for complete

stable complexes with actin and Arp4 (Szerlong et al., 2008). It is possible that the relatively stable Arp4-HA-His-β-actin dimers produced in bacteria (Fig. 3) may have some biases in the structure compared with native ones. Further studies on this point would be required for in depth understanding. To investigate the biological significance of Arp4-β-actin complex formation for the integrity of Brg1 complexes, we searched for Arp4 mutations by which interactions with βactin are impaired. The findings obtained with Arp4 M2 (R377A/L378A/K379A) and M4 (I340A/R341A) mutants appear especially intriguing. Both the mutations change residues that may lie on the surface of the Arp4 subdomain 3 (Fig. 4), which significantly reduced Arp4-β-actin interaction in human cells (Fig. 5A). Thus, these amino acids may be critical for Arp4-β-actin interactions. Incorporation of these Arp4 mutants into the Brg1 complexes was remarkably reduced (Fig. 5C) and interaction with Brg1 HSA domain was also impaired (Fig. 5B). To a certain extent, this was also the case for Tip60 HAT and c-myc-associated

14

complexes (Fig. 6), suggesting that Arp4-β-actin interactions may also be involved in efficient formation of these complexes. Binding of Arp4 to core histones was unchanged by these mutations (Fig. 7), suggesting that effects are not nonspecific. Arp4 M3 mutations (E388A/R389A/R390A) change residues that may lie also on the surface of Arp4 subdomain 3 but are somewhat distant from those changed by M2 and M4 mutations (Fig. 4). They significantly reduced Arp4-β-actin interaction in human cells (Fig. 5A). Interaction of the Arp4 M3 mutant with Brg1 HSA domain was inhibited (Fig. 5B) and, in line with this, its

Accepted manuscript

Arp4 M3 mutant with Tip60 HAT complex and c-myc-associated complex was also partially

Journal of Cell Science

incorporation into Brg1 complexes was significantly reduced (Fig. 5C). Interaction of the

the Arp4 M1 mutants into the Brg1 complexes was remarkably reduced (Fig. 5, B and C)

impaired (Fig. 6). These results indicated a role for the residues in Arp4-β-actin interactions and formation of chromatin-modifying enzyme complexes. Binding of Arp4 to core histones was reduced only by ~25% with the M3 mutations (Fig. 7). Arp4 M1 (K226A/E227A) mutations introduced into residues likely to lie on the surface of subdomain 4 (Fig. 4) significantly reduced the Arp4-β-actin interaction in human cells (Fig. 5A). Incorporation of

and that into Tip60 HAT complex and c-myc-associated complex was also partially impaired (Fig. 6). Binding of Arp4 to core histones was reduced only by ~20% with the M1 mutations (Fig. 7). For the Arp4 M7 mutation (Y6A), which alters a N-terminal residue (Fig. 4), associations with β-actin and Brg1 complex in human cells were only partially impaired (Fig. 5), while those with Tip60 c-myc were not affected at all (Fig. 6). It also did not affect Arp4 histone binding (Fig. 7). For Arp4 M8 mutation (S20A), which alters a residue that may be associated with potential ATP binding pocket (Fig. 4), no change was observed in the phenotypes we tested (Figs. 5, 6, and 7). In aggregate, our mutational analyses suggest that Arp4-β-actin heterocomplex formation may be a crucial feature for incorporation of Arp4 into large chromatin-modifying enzyme complexes, although some allele-specific and target-specific phenotypes were also observed. This appears consistent with the fact that yeast Arp7 and Arp9 can form heterodimers and that their incorporation into the RSC complex is interdependent (Szerlong et al., 2003). Although our mutational

15

analyses indicate the importance of Arp4-β-actin heterocomplex formation, it remains unclear how they interact. In this regard, the data obtained by Fenn et al. (2011) suggest that yeast Arp4 may bind to the plus end of monomeric actin. It will be interesting to clarify the structure of Arp4-actin or HSA-Arp4-actin complex. Nuclear actin and Arps play multiple roles in a context-dependent manner; e.g. yeast and human Arp4 can bind to histones (Harata et al., 1999; Shen et al., 2003; and Fig. 7) and murine neuron-specific Arp4/BAF53b is required for recruitment of BAF complex to

Accepted manuscript

Arp4 functions; silencing of Arp4 by RNAi impairs the integrity of Brg1 chromatin

Journal of Cell Science

specific promoters (Wu et al., 2007). In the present study, we found a new aspect of human

budding yeast (Galarneau et al., 2000). On the other hand, Arp4 and actin appear to be

remodeling complexes and accelerates the degradation of Brg1 and BAF170 in several human cell lines, including normal cells (Fig. 1). In this regard, the previous demonstration that Brg1 stability is affected by BAF47 and BAF155 subunits is of interest (Cui et al., 2004; Sohn et al., 2007). The requirement of human Arp4 for Brg1 complex integrity is reminiscent of the previous finding that mutations in Arp4 disrupt NuA4 HAT complex in

dispensable for the INO80 complex assembly (Shen et al., 2003). In this regard, it is also notable that Brg1, BAF170, BAF155, and BAF47 can form stable complexes without the help of actin and Arp4 when overexpressed in insect cells (Phelan et al., 1999). Lee et al. (2007) reported that silencing of Arp4 by siRNA did not decrease the steady-state levels of Brg1 proteins in NIH3T3 cells and it was also reported that neural BAF complexes can be assembled in the absence of the neuron-specific Arp4/BAF53b in murine neural tissues (Wu et al., 2007). Thus, it is possible that the Arp4 impact on Brg1 complex integrity is dependent on cell type and/or cellular condition. There are several possibilities to explain why Arp4 depletion influences the integrity of Brg1 complexes in certain human cells. One is that Arp4 depletion might reduce the expression of some gene(s) that is required for the complex integrity. For example, transcription of some other subunit(s) than Arp4 might be reduced. However, this was ruled out by our microarray analysis (Fig. 1E). It is also possible that canonical chaperon proteins

16

like Hsp70 and Hsp40 are involved in the folding of certain subunit(s) and/or in the complex assembly and their expression is repressed. However, no significant change was found in transcription levels of canonical chaperon genes in the microarray analysis (data not shown). We also must consider another interpretation that Arp4 depletion primarily induces degradation of Brg1 and BAF170. Since degradation of actin and Arp4 was unchanged, it seems unlikely that protein degradation is nonspecifically accelerated in Arp4-silenced HeLa cells. Brg1 and BAF170 proteins are structurally unrelated although incorporated into the

Accepted manuscript

must be activated by Arp4 depletion, which seems very unlikely. At least in our microarray

Journal of Cell Science

same complex. Therefore, if this scenario were the case, two specific degradation pathways

may be more easily brought to degradation.

analysis, no significant increase was found in the expression of genes that are known to be associated with specific protein degradation pathways such as ubiquitination-associated E1, E2, and E3 components (data not shown). Therefore, at this time, our preference lies with the possibility that Arp4 proteins itself may play a crucial role in the Brg1 complex assembly and/or maintenance of the complex stability. The unincorporated Brg1 and BAF170 proteins

17

Materials and Methods Production of Retrovirus Vector Expressing Arp4 shRNA For silencing Arp4, the 19-nucleotide sequence corresponding to Arp4 cDNA nucleotides 194-212 (underlined) was expressed as an shRNA as follows. Two oligonucleotides (Arp4S1, 5’-GAT CCC CGA GAT GAC GGA AGC ACA TTT TCA AGA GAA ATG TGC TTC CGT CAT CTC TTT TTG GAA A-3’; and Arp4-AS1, 5’-AGC TTT TCC AAA AAG AGA TGA CGG AAG CAC ATT TCT CTT GAA AAT GTG CTT CCG TCA TCT CGG G-3’)

Accepted manuscript

(Tatsumi et al., 2006). The sequences of other shRNAs for Arp4 (Arp4 shRNA-3 and -4)

Journal of Cell Science

were annealed and introduced into the pSI-MSCVPuro-H1R retroviral expression vector

labeled with Cy3 or Cy5 CTP and hybridization to DNA microarrays were performed

will be presented upon request. HeLa cells were infected with the retroviruses and selected with 0.5 µg/ml puromycin for 2 days.

DNA Microarray Analysis Total RNA was isolated as described previously (Fujita et al., 2003). Preparation of cRNAs

according to Agilent protocol. The microarray contains ~17,800 cDNAs (Human1A Ver.2 Oligo Microarray, Agilent Technologies).

siRNA Experiments HeLa cells were transfected with siRNAs using HiPerFect (Qiagen) and HCK1/T cells (human cervical keratinocytes immortalized with telomerase) (Tatsumi et al., 2006) using Lipofectamine RNAiMAX (Invitrogen). siRNA were synthesized (IDT) with the following sequences (sense strands): Brg1-1 (5'-GGAAGAUUACUUUGCGUAUCGCGdGdC-3'), Brg1-2

(5'-CCAGAGCUGAGAUGGCAUAGGCCdTdT-3') ,

GGCAGUGUAAUAGUGGCAGGAGGdAdA-3’),

Arp4-2

Ar p 4 - 3

(5’(5’-

GGUAGAAAGAGAUGACGGAAGCAdCdA-3’), and control scrambled (5’CUUCCUCUCUUUCUCUCCCUUGUdGdA-3’).

18

Purification and ATPase Assay of the Brg1 Complexes The Brg1 complexes were immunoprecipitated directly from soluble nuclear extracts (125µl for control HeLa cells and 500µl for Arp4 depleted HeLa cells) with Brg1 antibody beads (15µl). The beads were washed twice with ATPase buffer (20mM Tris-HCl, pH 7.4, 10mM MgCl2, 2mM DTT, 1mM ATP) and resuspended in 30µl of the same buffer containing 10µCi [γ-33P]ATP. When indicated, 3µg of activated calf thymus DNA (Amersham) was

Accepted manuscript

The mixtures were incubated at 37oC for 90 min. After the reaction, an aliquot of

the mixture was spotted onto a PEI cellulose plate (Merck), and chromatography was carried

Journal of Cell Science

included.

al., 1997). Purified G-actin (0.5mg) was coupled to 0.3ml CNBr-activated Sepharose 4 Fast

out in 0.5M formic acid and 1M LiCl. The plates were analyzed on a Bio-Imaging analyzer BAS-2500 (Fuji Film).

In Vitro Binding Assay for actin and Arp4 HeLa cell cytoplasmic G-actin was purified essentially as described previously (Ayscough et

Flow in actin coupling buffer (0.1M NaHCO3 pH8.3, 0.5mM CaCl2, 0.5mM phenylmethylsulfonyl fluoride). Plasmid pcDNA3-HA-Arp4/BAF53 (kindly provided by Dr. Harata, Tohoku University), with which HA-tagged human Arp4/BAF53 cDNA is transcribed from the T7 promoter, was previously described (Kuroda et al., 2002). HAtagged Arp4 proteins were synthesized by in vitro transcription-translation with a rabbit reticulocyte lysate (TNT T7 quick coupled transcription/translation system, Promega). HAArp4 produced by in vitro translation in 20µl of reaction mixture was diluted with 280µl binding buffer (20mM Tris-HCl, pH7.4, 150mM NaCl, 0.1% Triton X-100, 0.5mM MgCl2, 0.1mM DTT, 0.1mM ATP), mixed with 20µl actin-beads or control BSA-beads, and incubated at 4oC for 60 min. The beads then were washed with binding buffer. Bound proteins were eluted with 30µl SDS sample buffer (62.5mM Tris-HCl pH6.8, 2% SDS, 5% β-mercaptoethanol, 10% glycerol, 0.01% bromophenol blue).

19

Isolation of β-Actin-Arp4 Heterocomplexes For Fig. 3B, human Arp4 cDNA was inserted into pIVEX2.6d (Roche) and β-actin cDNA (Fujita et al., 2003) was inserted into pIVEX2.4a (Roche). HA-tagged Arp4 and His-tagged β-actin were co-synthesized from pIVEX2.6d-Arp4 and pIVEX2.4a- β-actin using an in vitro transcription-translation system with bacterial extracts (RTS 500, Roche), and bound to 0.3ml Anti-HA Affinity Matrix (Roche). After washing with NET gel buffer (50mM TrisHCl pH7.4, 150mM NaCl, 0.1% Triton X-100, 1mM EDTA), the bound proteins were eluted

Accepted manuscript

loaded onto 1ml Nickel affinity gel (HIS-Select, Sigma). The beads were washed with 15ml

Journal of Cell Science

with 2ml NET gel buffer containing HA peptide (Roche) at 1mg/ml. The eluate was then

tag. Finally, β-actin cDNA was inserted into pETDuet-1-Arp4. HA-Arp4 and His-β-actin

buffer H (50mM sodium phosphate pH 8.0, 250mM NaCl) containing 10mM imidazole and eluted with 3ml buffer H containing 250mM imidazole. For Fig. 3, C and D, Arp4-2HA and His- β-actin were simultaneously expressed in Escherichia coli strain BL-21 Lys S using pERDuet-1 vector (Novagen). First, Arp4 cDNA was inserted into pERDuet-1 and then the C-terminal S-tag was replaced with tandem HA-

were co-produced from pETDuet-1-β-actin-Arp4, purified on Nickel affinity gel and then immunoprecipitated with Anti-HA Affinity Matrix. One milliliter of the eluate was layered over 5-20% linear sucrose gradients (9ml) containing 0.05% Triton X-100 and centrifuged at 28,000rpm for 20 h at 4°C in a P40ST swing rotor (Hitachi Koki Co., Ltd.). Twenty-eight fractions (0.4ml each) were collected and analyzed.

Modeling of Tertiary Structures of β-Actin and Arp4 The predicted tertiary structure of human Arp4 was deduced using a Rovetta server (http://robetta.bakerlab.org/).

Construction of Mammalian Expression Vectors For mammalian expression of Arp4-2HA, the Arp4 cDNA was excised from pETDuet-1Arp4 and inserted into pCMV/myc/nuc (Invitrogen).

20

To generate Arp4 mutants,

oligonucleotide-directed mutagenesis (QuickChange Site-directed Mutagenesis Kit; Stratagene) was performed with each oligonucleotide and a complementary oligonucleotide as

follows;

Y6A,

5’-gagttatgagcggcggcgtggccggcggagatgaagttg-3’;

S20A,

5’-

ggagcccttgtttttgacattggagcctatactgtgagagctggttatg-3’; K226A/ E 2 2 7 A ,

5’-

ccatatatgattgcatcagctgcagctgttcgtgaaggatctcc-3’ ;

5’-

R 3 7 7 A/L378A/K 3 7 9 A ,

cagaaaactcctccaagtatggctgcagcattgattgcaaataatacaac-3’ ; gcaaataatacaacagtggctgcagcttttagctcatggattggcggc-3’;

E 3 8 8 A /R389A/R390A, and

I340A/R341A,

5’5 ’-

Journal of Cell Science

Accepted manuscript

gggatgtgtgatattgatgctgctccaggtctctatggcagtg-3’. For expression of Flag-c-myc, the c-myc cDNA was inserted into p3xFLAG-CMV10 (Sigma). The expression vector for Flag-tagged Brg1 HSA domain (pcDNA3-Flga-Brg1 HSA) was described previously (Szerlong et al., 2008) and kindly provide by Dr. Bradley R Cairns (University of Utah).

Immunoprecipitation The indicated plasmids (total 6µg) were transiently transfected into 3_106 293T cells in 100mm culture dishes with TransIT-293 reagent (Mirus, Madison, WI). HeLa cells were transfected with HilyMax Transfection reagent (Dojin Chemicals, Kumamoto, Japan). Forty-eight hours after transfection, cells were lysed on 1ml mCSK buffer containing 0.1% Triton X-100, 1mM DTT, and multiple protease inhibitors. After centrifugation, the remnant unclear pellet was resuspended in 1ml mCSK buffer containing 500mM NaCl, 0.1% Triton X-100, 1mM DTT, and multiple protease inhibitors to obtain nuclear extract. For Fig. 5B, transfected cells were directly lysed in mCSK buffer containing 500mM NaCl, 0.1% Triton X-100 and 1mM DTT.

After centrifugation, aliquots of the extracts were

immunoprecipitated with anti-HA (3F10, roche), anti-Flag (M2, Sigma), anti-Brg1 or control IgG (Dako) antibodies and protein G-Sepharose beads (Amersham Bioscience). The beads were washed with the buffer and immunoprecipitates were eluted with SDS sample buffer.

GST-Arp4 Pull-Down Assay for Histone Binding

21

Core hisotnes were purified from HeLa cells essentially as described previously (Kundu et al., 1999). For bacterial expression of glutathione S-transferase (GST)-Arp4, Arp4 cDNA was introduced into pGEX6P-2 (Amersham Biosciences). Wild type GST-Arp4 and GSTArp4 mutants were produced in Escherichia coli strain BL-21 Lys S and purified as described previously (Sugimoto et al., 2008). GST-Arp4 (7µg) was incubated with 5µg of purified core histone in binding buffer (200 mM NaCl, 20 mM Tris-HCl, pH7.4, 1 mM DTT, 0.05% Triton X-100, 5% glycerol) at 4oC for 180 min and then collected on glutathione

Accepted manuscript

were eluted with buffer containing 1M NaCl, followed by complete elution with SDS sample

Journal of Cell Science

beads. The beads were washed three times with 1 ml binding buffer and bound proteins

(Sugimoto et al., 2008).

buffer. The samples were finally analyzed by SDS-PAGE with Coomassie brilliant blue (CBB) staining.

Immunoblotting and Antibodies Immunoblotting and quantification of band signals were performed as described previously

For production of anti-Brg1 antibodies, a peptide corresponding to the 50 amino acid C-terminal region of Brg1 was synthesized and used for immunizing rabbits. The antibodies were affinity-purified. For immunopurification of Brg1 complexes, the anti-Brg1 antibodies were cross-linked to protein G-Sepharose beads (Amersham) at 1mg/ml with dimethylpimelimidate. Anti-DnaK antibodies were provided by Dr.Kanemori (Kanazawa University). Other antibodies were purchased as follows: Flag-tag (M2, Sigma), HA-tag (HA.11, BAbCO and 3F10, Roche), His-tag (70796-3, Novagen), actin (MAB1501, Chemicon), human BAF53 (ab3882, abcam), BAF170 (E-6, Santa Cruz), BAF47/hSNF5/Ini1 (H-300, Santa Cruz), and PARP1 (#9542, Cell Signaling).

22

Acknowledgments We thank Drs. M. Harata (Tohoku University) and B. R. Cairns (University of Utah) for plasmids, T. Tsuji and S. Yoshida for technical assistance, and A. Noguchi for secretarial work. We also thank Dr. Kanemori for providing antibodies. This work was supported in part by a Grant to M.F. from the Ministry of Education, Culture, Sports, Science and

Journal of Cell Science

Accepted manuscript

Technology of Japan.

23

References Ayscough, K. R., Stryker, J., Pokala, N., Sanders, M., Crews, P. and Drubin, D. G. (1997). High rates of actin filament turnover in budding yeast and roles for actin in establishment and maintenance of cell polarity revealed using the actin inhibitor latrunculinA. J. Cell Biol. 137, 399-416.

Bettinger, B. T., Gilbert, D. M. and Amberg, D. C. (2004). Actin up in the nucleus. Nat.

Journal of Cell Science

Accepted manuscript

Rev. Mol. Cell. Biol. 5, 410-415.

Blessing, C. A., Ugrinova, G. T. and Goodson, H. V. (2004). Actin and ARPs: actin in the nucleus. Trends Cell Biol. 14, 435-442.

Boyer, L. A. and Peterson, C. L. (2000). Actin-related proteins (Arps): conformational switches for chromatin-remodeling machines? Bioessays 22, 666-672.

Cai, Y., Jin, J., Tomomori-Sato, C., Sato, S., Sorokina, I., Parmely, T. J., Conaway, R. C. and Conaway, J. W. (2003). Identification of new subunits of the multiprotein mammalian TRRAP/TIP60-containing histone acetyltransferase complex. J. Biol. Chem. 278, 42733-42736.

Cairns, B. R., Erdjument-Bromage, H., Tempst, P., Winston, F. and Kornberg, R. D. (1998). Two actin-related proteins are shared functional components of the chromatinremodeling complexes RSC and SWI/SNF. Mol. Cell 2, 639-651.

Chen, X., Peng, J., Pedram, M., Swenson, C. A. and Rubenstein, P. A. (1995). The effect of the S14A Mutation on the conformation and thermostability of Saccharomyces cerevisiae G-actin and its interaction with adenine nucleotides. J. Biol. Chem. 270, 11415-11423.

24

Cui, K., Taylor, P., Liu, H., Chen, X., Ozato, K. and Zhao, K. (2004). The chromatinremodeling BAF complex mediates cellular antiviral activities by promoter priming. Mol. Cell. Biol. 24, 4476-4486.

De La Cruz, E. M. and Pollard, T. D. (2001). Structural biology: Actin' up. Science 293, 616-618.

Accepted manuscript

(2011). Structural biochemistry of nuclear actin-related proteins 4 and 8 reveals their

Journal of Cell Science

Fenn, S., Breitsprecher, D., Gerhold, C. B., Witte, G., Faix, J. and Hopfner, K.-P.

Fujita, M., Ichinose, S., Kiyono, T., Tsurumi, T. and Omori, A. (2003). Establishment of

interaction with actin. EMBO J. 30, 2153-2166.

Fomproix, N. and Percipalle, P. (2004). An actin-myosin complex on actively transcribing genes. Exp. Cell Res. 294, 140-148.

latrunculin-A resistance in HeLa cells by expression of R183A D184A mutant β-actin. Oncogene 22, 627-631.

Galarneau, L., Nourani, A., Boudreault, A. A., Zhang, Y., Héliot, L., Allard, S., Savard, J., Lane, W. S., Stillman, D. J. and Côté, J. (2000). Multiple links between the NuA4 histone acetyltransferase complex and epigenetic control of transcription. Mol. Cell 5, 927937.

Görzer, I, Schüller, C., Heidenreich, E., Krupanska, L., Kuchler, K. and Wintersberger, U. (2003). The nuclear actin-related protein Act3p/Arp4p of Saccharomyces cerevisiae is involved in transcription regulation of stress genes. Mol. Microbiol. 50, 1155-1171.

25

Harata, M., Oma, Y., Mizuno, S., Jiang, Y. W., Stillman, D. J. and Wintersberger, U. (1999). The nuclear actin-related protein of Saccharomyces cerevisiae, Act3p/Act4p, interacts with core histones. Mol. Biol. Cell 10, 2595-2605.

Hertzog, M., Heijenoort, C. V., Didry, D., Gaudier, M., Coutant, J., Gigant, B., Didelot, G., Preat, T., Knossow, M., Guittet, E. and Carlier, M. F. (2004). The β-Thymosin/WH2 domain: structural basis for the switch from inhibition to promotion of actin assembly. Cell

Journal of Cell Science

Accepted manuscript

117, 611-623.

Hofmann, W. A., Stojiljkovic, L., Fuchsova, B., Vargas, G. M., Mavrommatis, E., Philimonenko, V., Kysela, K., Goodrich, J. A., Lessard, J. L., Hope, T. J., Hozak, P. and Lanerolle, P. D. (2004). Actin is part of pre-initiation complexes and is necessary for transcription by RNA polymerase II. Nat. Cell Biol. 6, 1094-1101.

Hu, P., Wu, S. and Hernandez, N. (2004). A role for beta-actin in RNA polymerase III transcription. Genes Dev. 18, 3010-3015.

Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F. and Holmes, K. C. (1990). Atomic structure of the actin: DNase I complex. Nature 347, 37-44.

Kabsch, W. and Holmes, K. C. (1995). The actin fold. FASEB J. 9, 167-174.

Kukalev, A., Nord, Y., Palmberg, C., Bergman, T. and Percipalle, P. (2005). Actin and hnRNP U cooperate for productive transcription by RNA polymerase II. Nat. Struct. Mol. Biol. 12, 238-244.

Kundu, T. K., Wang, Z. and Roeder, R. G. (1999). Human TFIIIC relieves chromatinmediated repression of RNA polymerase III transcription and contains an intrinsic histone

26

acetyltransferase activity. Mol. Cell. Biol. 19, 1605-1615.

Kuroda, Y., Oma, Y., Nishimori, K., Ohta, T. and Harata, M. (2002). Brain-specific expression of the nuclear actin-related protein ArpNα and its involvement in mammalian SWI/SNF chromatin remodeling complex. Biochem. Biophys. Res. Commun. 229, 328-334.

Lee, J. H., Lee, J. Y., Chang, S. H., Kanf, M. J. and Kwon, H. (2005). Effects of ser2 and

Accepted manuscript

293.

Journal of Cell Science

tyr6 mutants of BAF53 on cell growth and p53-dependent transcription. Mol. Cells 19, 289-

Liu, R., Liu, H., Chen, X., Kirby, M., Brown, P. O. and Zhao, K. (2001). Regulation of

Lee, K., Kang, M. J., Kwon, S. J., Kwon, Y. K., Kim, K. W., Lim, J.-H. and Kwon, H. (2007). Expansion of chromosome territories with chromatin decompaction in BAF53depleted interphase cells. Mol. Biol. Cell 18, 4013-4023.

CSF1 promoter by the SWI/SNF-like BAF complex. Cell 106, 309-318.

Muller, J., Oma, Y., Vallar, L., Friederich, E., Poch, O. and Winsor, B. (2005). Sequence and comparative genomic analysis of actin-related proteins. Mol. Biol. Cell 16, 5736-5748.

Mullins, R. D., Heuser, J. A. and Pollard, T. D. (1998). The interaction of Arp2/3 complex with actin: nucleation, high affinity pointed end capping, and formation of branching networks of filaments. Proc. Natl. Acad. Sci. USA 95, 6181-6186.

Nolen, B.J., Littlefiled, R. S. and Pollard, T.D. (2004). Crystal structures of actin-related protein 2/3 complex with bound ATP or ADP. Proc. Natl. Acad. Sci. USA 101, 1562715632.

27

Olave, I. A., Reck-Peterson, S. L. and Crabtree, G. R. (2002a). Nuclear actin and actinrelated proteins in chromatin remodeling. Annu. Rev. Biochem. 71, 755-781.

Olave, I., Wang, W., Xue, Y., Kou, A. and Crabtree, G. R. (2002b). Identification of a polymorphic, neuron-specific chromatin remodeling complex. Genes Dev. 16, 2509-2517.

Journal of Cell Science

Accepted manuscript

Oliver, F. J., de la Rubia, G., Rolli, V., Ruiz-Ruiz, M. C., de Murcia, G. and Murcia, J. M. (1998). Importance of poly(ADP-ribose) polymerase and its cleavage in apoptosis. Lesson from an uncleavable mutant. J. Biol. Chem. 273, 33533-33539.

Park, J., Wood, M. A. and Cole, M. D. (2001). BAF53 forms distinct nuclear complexes and functions as a critical c-Myc-interacting nuclear cofactor for oncogenic transformation. Mol. Cell. Biol. 22, 1307-1316.

Peterson, C. L., Zhao, Y. and Chait, B. T. (1998). Subunits of the yeast SWI/SNF complex are members of the actin-related protein (ARP) family. J. Biol. Chem. 273, 23631-23644.

Phelan, M. L., Sif, S., Narlikar, G. J. and Kingston, R. E. (1999). Reconstitution of a core chromatin remodeling complex from SWI/SNF subunits. Mol. Cell 3, 247-253.

Philimonenko, V. V., Zhao, J., Iben, S., Dingova, H., Kysela, K., kahle, M., Zentgraf, H., Hormann, W. A., Lanerolle, P. D., Hozak, P. and Grummt, I. (2004). Nuclear actin and myosin I are required for RNA polymerase I transcription. Nat. Cell. Biol. 6, 1165-1172.

Poch, O. and Winsor, B. (1997). Who's who among the Saccharomyces cerevisiae actinrelated proteins? A classification and nomenclature proposal for a large family. Yeast 13, 1053-1058.

28

Rando, O. J., Zhao, K., Janmey, P. and Crabtree, G. R. (2001). Phosphatidylinositoldependent actin filament binding by the SWI/SNF-like BAF chromatin remodeling complex. Proc. Natl. Acad. Sci. USA 99, 2824-2829.

Robinson, R. C., Turbedsky, K., Kaiser, D. A., Marchand, J. B., Higgs, H. N., Choe, S.

Accepted manuscript

Shen, X., Mizuguchi, G., Hamiche, A. and Wu, C. (2000). A chromatin remodeling

Journal of Cell Science

and Pollard, T. D. (2001). Crystal structure of Arp2/3 complex. Science 294, 1679-1684.

Sohn, D. H., Lee, K. Y., Oh, J., Chung, H., Jeon, S. H. and Seong, R. H. (2007). SRG3

complex involved in transcription and DNA processing. Nature 406, 541-544.

Shen, X., Ranallo, R., Choi, E. and Wu, C. (2003). Involvement of actin-related-proteins in ATP-dependent chromatin remodeling. Mol. Cell 12, 147-155.

interacts directly with the major components of the SWI/SNF chromatin remodeling complex and protects them from proteasomal degradation. J. Biol. Chem. 282, 10614-10624.

Sugimoto, N., Kitabayashi, I., Osano, S., Tatsumi, Y., Yugawa, T., Narisawa-Saito, M., Matsukage, A., Kiyono, T. and Fujita, M. (2008). Identification of novel human Cdt1binding proteins by a proteomics approach: Proteolytic regulation by APC/CCdh1. Mol. Biol. Cell 19, 1007-1021.

Szerlong, H., Saha, A. and Cairns, B. R. (2003). The nuclear actin-related proteins Arp7 and Arp9: a dimeric module that cooperates with architectural proteins for chromatin remodeling. EMBO J. 22, 3175-3187.

Szerlong, H., Hinata, K., Viswanathan, R., Erdjument-Bromage, H., Tempst, P. and

29

Cairns, B. R. (2008). The HSA domain binds nuclear actin-related proteins to regulate chromatin-remodeling ATPases. Nat. Struct. Mol. Biol. 15, 469-476.

Tatsumi, Y., Sugimoto, N., Yugawa, T., Narisawa-Saito, M., Kiyono, T. and Fujita, M. (2006). Deregulation of Cdt1 induces chromosomal damage without rereplication and leads to chromosomal instability. J. Cell Sci. 119, 3128-3140.

Accepted manuscript

human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to

Journal of Cell Science

Welch, M. D., DePace, A. H., Verma, S., Iwamatsu, A. and Mitchison, T. J. (1997). The

Wertman, K. F., Drubin, D. G. and Botstein, D. (1992). Systematic mutational analysis of

cellular regions of dynamic actin filament assembly. J. Cell. Biol. 138, 375-84.

Wertman, K. F. and Drubin, D. G. (1992). Actin constitution: Guaranteeing the right to assemble. Science 258, 759-760.

the yeast ACT1 gene. Genetics 132, 337-350.

Wu, J. I., Lessard, J., Olave, I. A., Qiu, Z., Ghosh, A., Graef, I. A. and Crabtree, G. R. (2007). Regulation of dendritic development by neuron-specific chromatin remodeling complexes. Neuron 56, 94-108.

Zhao, K., Wang, W., Rando, O. J., Xue, Y., Swiderek, K., Kuo, A. and Crabtree, G. R. (1998). Rapid and phosphoinositol-dependent binding of the SWI/SNF-like BAF complex to chromatin after T lymphocyte receptor signaling. Cell 95, 625-636.

30

Figure Legends Fig. 1. Silencing of BAF53/human Arp4 leads to acceleration of degradation of Brg1 in HeLa and HCK1/T cells. (A-G) HeLa cells were infected with retroviruses expressing Arp4 shRNAs, drug selected, and examined at 5 days after infection. (A and B) Whole cell lysates were immunoblotted with the indicated antibodies. The membranes were also stained with CBB to confirm equal loading. Representative data are shown in (A). The signal intensities of the bands were quantified and the mean and standard deviation of three independent

Accepted manuscript

with retroviruses expressing other shRNAs targeting Arp4 (Arp4 shRNA-3 and -4) and then

Journal of Cell Science

experiments are shown with control cells set at 100 in (B). (C) HeLa cells were infected

lives of Brg1, BAF170, Arp4, and actin proteins were investigated. Cycloheximide

analyzed as in (A). (D) Growth rates of parental, control virus-infected, and Arp4-depleted HeLa cells (2000/well in 96-well plates) were estimated by MTS assay. (E) Changes in expression of Brg1 complex-related genes in Arp4-depleted cells. Expression of the indicated genes was investigated with DNA microarray analysis. Fold change of expression in Arp4-depleted cells compared with the control cells was calculated. (F and G) The half-

(50µg/ml) was added to the medium, and cells were sequentially harvested at the indicated time points for immunoblot analysis. Representative data are shown in (F). The results of quantification are shown in (G). The means and standard deviations for data from two independent experiments are shown. (H) HeLa cells were transfected with the indicated siRNAs. Forty-eight hours after the transfection, whole cell lysates were subjected to immunoblotting. The signal intensities of the bands were quantified and are shown below with control siRNA-treated cells set at 100. (I) HCK1/T cells (normal human cervical keratinocytes immortalized with telomerase) were transfected and analyzed as in (H). (J) HeLa cells treated as in (H) were immunoblotted with anti-PARP1 antibody. Bleomycintreated HeLa cells (16µM, 48hr) were also analyzed.

Fig. 2. Arp4 silencing reduces amounts of Brg1 complexes in HeLa cells. Arp4-silenced cells were prepared with Arp4 shRNA retroviruses as in Fig.1. (A and B) Nuclear extracts

31

were prepared and immunblotted with the indicated antibodies. Representative data are shown in (A). The signal intensities of the bands were quantified and the mean and standard deviation of three independent experiments are shown with control cells set at 100 in (B). (C) Brg1 complexes were immunopurified from the nuclear extracts and immunoblotted with the indicated antibody. For Arp4-depleted cells, 4 times more nuclear extracts than those from control cells were subjected to immunoprecipitation. The signal intensities of the bands were quantified, and shown with those of control cells set at 100. (D) DNA-

Accepted manuscript

immunopurified Brg1 complexes were subjected to ATPase assay. Activated calf thymus

Journal of Cell Science

dependent ATPase activities of the immunopurified Brg1 complexes. Antibody beads with

reticulocyte lysate, mixed with G-actin-beads or control BSA-beads, and incubated in the

DNA was included as indicated. ATPase activities are shown as % ATP hydrolysis in each reaction.

Fig. 3. β-actin and Arp4 form heterocomplexes. (A) Binding of Arp4 to monomeric actin in vitro.

HA-Arp4 was synthesized by in vitro transcription-translation with a rabbit

presence or absence of 100µM ATP. After washing the beads, bound proteins were immuneblotted with anti-HA antibody. (B) Isolation of β-actin/Arp4 heterocomplexes produced by an in vitro transcription-translation system with bacterial extracts. His-β-actin and HA-Arp4 co-synthesized were first subjected to immunopurification with anti-HA antibody and eluted with HA peptides (HA eluate). The eluate was further incubated with Nickel affinity column. After washing, His-β-actin was eluted with buffer containing 250mM imidazole (1ml x 3 times). Each fraction was analyzed by silver staining and by immunoblotting with anti-HA and anti-His antibodies. Flow through: flow through fraction of the Nickel affinity column. (C) Fractionation of β-actin/Arp4 heterocomplexes on sucrose gradient centrifugation. Arp4-2HA and His-β-actin were co-produced in bacteria, purified on Nickel affinity gel, and then immunoprecipitated with Anti-HA Affinity Matrix. The eluate was layered over 5-20% linear sucrose gradients and fractionated. Twenty-eight fractions were collected and analyzed by SDS-PAGE followed by silver staining. The signal

32

intensities of the bands were quantified and shown with the maximum values for each set at 100 (lower panel). (D) Re-fractionation of β-actin/Arp4 heterocomplexes. Fractions 6 and 7 in (C) were collected and re-subjected to 5-20% linear sucrose gradient centrifugation as above. Only the data for fractions 1-14 are presented. Non-specific bands apparent at 50, 60, and 70kDa are due to contamination with marker proteins used for SDS-PAGE.

Fig. 4. Creation of a series of Arp4 mutants based on structural similarities with β-actin. (A)

Accepted manuscript

deduced with the SWISS-Model program and visualized with the ViewerLite 5.0 program.

Journal of Cell Science

The deduced tertiary structure of the human β-actin monomer drawn by ribbon diagram, as

the amino acid residues we mutated in this study are indicated in green. Predicted regions of

The positions of amino acids whose mutations cause recessive lethality (D286A/D288A, E334A/R335A/K336A) and dominant lethality (E205A/R206A/E207A, K326A/K328A) in budding yeast are indicated in red and blue, respectively. Note that these do not represent all mutations that lead to lethality. (B) The predicted tertiary structure of human Arp4, deduced by Rovetta server and visualized with the ViewerLite 5.0 program. Predicted positions of

the three human Arp4 specific insertion sequences are indicated in orange. (C) Alignment of amino acid sequences of human β-actin and human Arp4 using the CLUSTALW program. The colored sequences correspond to those in (A) and (B). (D) Amino acid stretches conserved between Arp4 and β-actin. The colored sequences correspond to those in (A) and (B).

Fig. 5. Arp4 mutants with reduced binding to β-actin show reduced incorporation into the Brg1 complex. (A) Arp4 M1-M4 mutants show reduced binding to β-actin. 293T cells were transfected with the indicated Arp4-2HA expression vectors and nuclear extracts were prepared. After immunoprecipitation with anti-HA antibodies, the precipitates were blotted with the indicated antibodies (upper panels). Four percent of the input for HA-Arp4 and 0.07% of the input for β-actin were loaded. To estimate the co-precipitation efficiency of βactin with Arp4-2HA, the signal intensities of the bands of co-precipitated β-actin were

33

normalized to those of the precipitated Arp4-2HA. The means and standard deviations of data from two independent experiments are shown with β-actin co-precipitation with the wild type Arp4-2HA set at 100 (lower panel). (B) Mutations M1-M4 in Arp4 compromise interactions of Arp4-2HA with Flag-Brg1 HSA. 293T cells were co-transfected with the indicated Arp4-2HA expression vectors along with Flag-Brg1 HSA expression vector and whole cell extracts were prepared. After immunoprecipitation with anti-Flag antibodies, the precipitates were blotted with the indicated antibodies (upper panels). Four percent of the

Accepted manuscript

Brg1 HSA, the signal intensities of the bands of co-precipitated Arp4-2HA were normalized

Journal of Cell Science

inputs were also loaded. To estimate the co-precipitation efficiency of Arp4-2HA with Flag-

anti-Brg1 antibodies, the precipitates were blotted with the indicated antibodies (upper

to those of the precipitated Flag-Brg1 HSA. The means and standard deviations of data from two independent experiments are shown with co-precipitation with the wild type Arp4-2HA set at 100 (lower panel). (C) Arp4 mutants with reduced binding to β-actin show reduced incorporation into the Brg1 complex. 293T cells were transfected with the indicated Arp42HA expression vectors and nuclear extracts were prepared. After immunoprecipitation with

panels). Seventeen percent of the input for Brg1, BAF170, endogenous Arp4, and Arp42HA or 0.3% of the input for β-actin were loaded. To estimate the co-precipitation efficiency of Arp4-2HA with the Brg1 complex, the signal intensities of the bands of coprecipitated Arp4-2HA were normalized to those of the precipitated endogenous Arp4. The means and standard deviations of data from two independent experiments are shown with the wild type HA-Arp4 co-precipitation with the Brg1 complex set to 100 (lower panel). (D, E) Estimation of interaction of endogenous Arp4 and transfected Arp4-2HA with endogenous Brg1 complexes or exogenous Flag-Brg1 HSA. (D) As in (B), 293T cells were transfected with the wild type Arp4-2HA expression vectors along with the Flag-Brg1 HSA expression vector and whole cell extracts were immunoprecipitated with anti-Flag or anti-HA antibodies. Precipitates were blotted with the indicated antibodies. (E) As in (C), 293T cells were transfected with the wild type Arp4-2HA expression vector and nuclear extracts were immunoprecipitated with anti-Brg1 antibodies and blotted as indicated.

34

Fig. 6. Effects of the Arp4 mutations on the interactions with Tip60 HAT complexes and cmyc-associated complexes. (A) HeLa cells stably expressing Flag-Tip60 were transfected with the indicated Arp4-2HA expression vectors and nuclear extracts were prepared. In FLAG-Tip60 (-) lanes, parental HeLa cells were used. After immunoprecipitation with antiFlag antibodies, the precipitates were blotted with the indicated antibodies (upper panels). Four percent of the input was loaded. To estimate the co-precipitation efficiency of Arp4-

Accepted manuscript

normalized to those of the precipitated Flag-Tip60. The means and standard deviations of

Journal of Cell Science

2HA with Flag-Tip60, the signal intensities of the bands of co-precipitated Arp4-2HA were

input was loaded.

data from two independent experiments are shown with co-precipitation of the wild type Arp4-2HA with Flag-Tip60 set at 100 (lower panel). (B) 293T cells were transfected with the indicated Arp4-2HA expression vectors, together with Flag-c-myc expression vector, and nuclear extracts were prepared. After immunoprecipitation with anti-Flag antibody, the precipitates were blotted with the indicated antibodies (upper panels). Four percent of the To estimate the co-precipitation efficiency of Arp4-2HA with Flag-c-

myc, the signal intensities of the bands of co-precipitated Arp4-2HA were normalized to those of the precipitated Flag-c-myc. The means and standard deviations from two independent experiments are shown with co-precipitation of the wild type Arp4-2HA with Flag-c-myc set at 100 (lower panel).

Fig. 7. Human Arp4 possesses core histone binding activity. (A) GST-Arp4 binds to core histones in vitro. GST-Arp4 or GST were incubated with purified core histones. The bound proteins were first eluted with buffer containing 1M NaCl, followed by elution with SDS. The eluted proteins were analyzed by CBB staining. Five percent of the input was loaded. (B) Effects of the Arp4 mutations on histone binding. GST pull-down assay was performed as above. Five percent of the input was loaded. To estimate the co-precipitation efficiency of core histones with GST-Arp4, the signal intensities of the bands of co-precipitated core histones were normalized to those of the precipitated GST-Arp4. The means and standard

35

deviations from three independent experiments are shown with histone binding to the wild

Journal of Cell Science

Accepted manuscript

type GST-Arp4 set at 100 (lower panel).

36

Journal of Cell Science

Accepted manuscript

Journal of Cell Science

Accepted manuscript

Journal of Cell Science

Accepted manuscript

Journal of Cell Science

Accepted manuscript

Journal of Cell Science

Accepted manuscript

Journal of Cell Science

Accepted manuscript

Journal of Cell Science

Accepted manuscript

Supplemental Materials

Heterocomplex Formation by Arp4 and !-Actin Involved in Integrity of the Brg1 Chromatin Remodeling Complex

Naoki Nishimoto et al.

Supplementary TABLE 1. Identification by DNA microarray analysis of genes whose expression was changed more than 2.5-fold in Arp4-depleted HeLa cells.

Journal of Cell Science

Accepted manuscript

Legends for Supplementary Figures.

1

Accepted manuscript Journal of Cell Science

GeneName

SystematicName

Description

SLC16A6 GDF15 KIT AK5 UNC5B CXCL1 VIT SCG2 SPINK4 UTS2 WFDC1 HLA-DMB FOS C3 ENST00000309950 HIST1H1C ALDH3A1 ABCC3 C5 NTNG1 CCL2 ROR1 EPAS1 DUSP5 TSC SH3GL2 KCNJ2 ACTA2 LPL FLNC P2RY6 EDG2 IGFBP3 THC2005199 GLULD1 GLRB AL832534 ASS CXCL1 GPNMB ITPR1 BC063022 FLJ14146

NM_004694 NM_004864

Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 6 (SLC16A6), mRNA [NM_004694] Homo sapiens growth differentiation factor 15 (GDF15), mRNA [NM_004864]

BAF53shRNA/control ratio 17.135 14.412

NM_000222 NM_174858 NM_170744 NM_001511 NM_053276

Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), mRNA [NM_000222] Homo sapiens adenylate kinase 5 (AK5), transcript variant 1, mRNA [NM_174858] Homo sapiens unc-5 homolog B (C. elegans) (UNC5B), mRNA [NM_170744] Homo sapiens chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1), mRNA [NM_001511] Homo sapiens vitrin (VIT), mRNA [NM_053276]

11.139 9.321 8.094 7.866 7.244

NM_003469 NM_014471 NM_021995 NM_021197 NM_002118

Homo sapiens secretogranin II (chromogranin C) (SCG2), mRNA [NM_003469] Homo sapiens serine protease inhibitor, Kazal type 4 (SPINK4), mRNA [NM_014471] Homo sapiens urotensin 2 (UTS2), transcript variant 1, mRNA [NM_021995] Homo sapiens WAP four-disulfide core domain 1 (WFDC1), mRNA [NM_021197] Homo sapiens major histocompatibility complex, class II, DM beta (HLA-DMB), mRNA [NM_002118]

6.102 4.807 4.564 4.434 4.427

NM_005252 NM_000064 ENST00000309950 NM_005319 NM_000691

Homo sapiens v-fos FBJ murine osteosarcoma viral oncogene homolog (FOS), mRNA [NM_005252] Homo sapiens complement component 3 (C3), mRNA [NM_000064] Homo sapiens full length insert cDNA clone ZE09G12. [AF086541] Homo sapiens histone 1, H1c (HIST1H1C), mRNA [NM_005319] Homo sapiens aldehyde dehydrogenase 3 family, memberA1 (ALDH3A1), mRNA [NM_000691]

4.377 4.222 4.215 4.194 4.161

NM_003786 NM_001735 BX538348 NM_002982 NM_005012

Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 3 (ABCC3), transcript variant MRP3, mRNA [NM_003786] Homo sapiens complement component 5 (C5), mRNA [NM_001735] Homo sapiens mRNA; cDNA DKFZp686E17275 (from clone DKFZp686E17275); complete cds. [BX538348] Homo sapiens chemokine (C-C motif) ligand 2 (CCL2), mRNA [NM_002982] Homo sapiens receptor tyrosine kinase-like orphan receptor 1 (ROR1), mRNA [NM_005012]

4.129 4.096 3.877 3.872 3.837

NM_001430 NM_004419 NM_017899 NM_003026 NM_000891

Homo sapiens endothelial PAS domain protein 1 (EPAS1), mRNA [NM_001430] Homo sapiens dual specificity phosphatase 5 (DUSP5), mRNA [NM_004419] Homo sapiens hypothetical protein FLJ20607 (TSC), mRNA [NM_017899] Homo sapiens SH3-domain GRB2-like 2 (SH3GL2), mRNA [NM_003026] Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 2 (KCNJ2), mRNA [NM_000891]

3.799 3.662 3.624 3.570 3.493

NM_001613 NM_000237 NM_001458 NM_176798 BC036034

Homo sapiens actin, alpha 2, smooth muscle, aorta (ACTA2), mRNA [NM_001613] Homo sapiens lipoprotein lipase (LPL), mRNA [NM_000237] Homo sapiens filamin C, gamma (actin binding protein 280) (FLNC), mRNA [NM_001458] Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 2, mRNA [NM_176798] Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2, transcript variant 2, mRNA (cDNA clone MGC:33157 IMAGE:5272431), complete cds. [BC036034]

3.481 3.470 3.382 3.363 3.361

NM_000598 THC2005199 NM_016571 NM_000824 AL832534

Homo sapiens insulin-like growth factor binding protein 3 (IGFBP3), mRNA [NM_000598] AF516696 voltage-gated calcium channel alpha(2)delta-3 subunit {Homo sapiens}, partial (5%) [THC2005199] Homo sapiens glutamate-ammonia ligase (glutamine synthase) domain containing 1 (GLULD1), mRNA [NM_016571] Homo sapiens glycine receptor, beta (GLRB), mRNA [NM_000824] Homo sapiens mRNA; cDNA DKFZp547I2016 (from clone DKFZp547I2016). [AL832534]

3.351 3.334 3.331 3.307 3.301

NM_054012 NM_001511 NM_002510 NM_002222 BC063022

Homo sapiens argininosuccinate synthetase (ASS), transcript variant 2, mRNA [NM_054012] Homo sapiens chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1), mRNA [NM_001511] Homo sapiens glycoprotein (transmembrane) nmb (GPNMB), mRNA [NM_002510] Homo sapiens inositol 1,4,5-triphosphate receptor, type 1 (ITPR1), mRNA [NM_002222] Homo sapiens cDNA clone IMAGE:5246259, partial cds. [BC063022]

3.276 3.216 3.212 3.200 3.193

NM_024709

Homo sapiens hypothetical protein FLJ14146 (FLJ14146), mRNA [NM_024709]

3.186

Supplementary Table 1-1 N.Nishimoto et al.

Accepted manuscript Journal of Cell Science

GeneName

SystematicName

Description

BAF53shRNA/control ratio

PCSK2 PCSK1 CTH BC038245 MGC39325 CEBPD HIST2H2AA GREM2 DHRS3 CFHL1 S100P ASNS AF220415 MGC14801 FOXA1 TM4SF5 SERPINI1 THC1836015 CD83 FLJ12541 SPOCK3 RHOV 13CDNA73 IGFBP1 SPINK5 FOXA1 BCL6 PRSS23 FOXA1 NR4A3 FBXO32 CITED4 FZD10 C9orf95 ANXA10 C1orf24 IQGAP2 ARG2 ACTG2 FLJ23153 MIG-6 CASP9 FOXA1 TMOD1

NM_002594

Homo sapiens proprotein convertase subtilisin/kexin type 2 (PCSK2), mRNA [NM_002594]

3.180

NM_000439 NM_001902 BC038245 NM_147189 NM_005195

Homo sapiens proprotein convertase subtilisin/kexin type 1 (PCSK1), mRNA [NM_000439] Homo sapiens cystathionase (cystathionine gamma-lyase) (CTH), transcript variant 1, mRNA [NM_001902] Homo sapiens, clone IMAGE:5241654, mRNA. [BC038245] Homo sapiens hypothetical protein MGC39325 (MGC39325), mRNA [NM_147189] Homo sapiens CCAAT/enhancer binding protein (C/EBP), delta (CEBPD), mRNA [NM_005195]

3.149 3.129 3.122 3.089 3.055

NM_003516 NM_022469 NM_004753 NM_002113 NM_005980

Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA [NM_003516] Homo sapiens protein related to DAN and cerberus (FLJ21195), mRNA [NM_022469] Homo sapiens dehydrogenase/reductase (SDR family) member 3 (DHRS3), mRNA [NM_004753] Homo sapiens H factor (complement)-like 1 (HFL1), mRNA [NM_002113] Homo sapiens S100 calcium binding protein P (S100P), mRNA [NM_005980]

3.037 3.037 3.035 3.000 2.997

NM_001673 AF220415 NM_032705 NM_004496 NM_003963

Homo sapiens asparagine synthetase (ASNS), transcript variant 2, mRNA [NM_001673] Homo sapiens gastric-associated differentially-expressed protein YA61P (YA61) mRNA, complete cds. [AF220415] Homo sapiens hypothetical protein MGC14801 (MGC14801), mRNA [NM_032705] Homo sapiens forkhead box A1 (FOXA1), mRNA [NM_004496] Homo sapiens transmembrane 4 superfamily member 5 (TM4SF5), mRNA [NM_003963]

2.950 2.941 2.921 2.914 2.890

NM_005025 THC1836015 NM_004233 NM_022369 BC013983

Homo sapiens serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), mRNA [NM_005025] AB011030 PRDC {Mus musculus}, complete [THC1836015] Homo sapiens CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) (CD83), mRNA [NM_004233] Homo sapiens stimulated by retinoic acid gene 6 (FLJ12541), mRNA [NM_022369] Homo sapiens sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3, mRNA (cDNA clone MGC:20285 IMAGE:4110883), complete cds. [BC013983]

2.866 2.852 2.842 2.832 2.822

NM_133639 NM_023037 NM_000596 NM_006846 NM_004496

Homo sapiens ras homolog gene family, member V (RHOV), mRNA [NM_133639] Homo sapiens hypothetical protein CG003 (13CDNA73), mRNA [NM_023037] Homo sapiens insulin-like growth factor binding protein 1 (IGFBP1), mRNA [NM_000596] Homo sapiens serine protease inhibitor, Kazal type, 5 (SPINK5), mRNA [NM_006846] Homo sapiens forkhead box A1 (FOXA1), mRNA [NM_004496]

2.795 2.769 2.755 2.754 2.743

NM_138931 NM_007173 NM_004496 NM_173200 NM_058229

Homo sapiens B-cell CLL/lymphoma 6 (zinc finger protein 51) (BCL6), transcript variant 2, mRNA [NM_138931] Homo sapiens protease, serine, 23 (SPUVE), mRNA [NM_007173] Homo sapiens forkhead box A1 (FOXA1), mRNA [NM_004496] Homo sapiens nuclear receptor subfamily 4, group A, member 3 (NR4A3), transcript variant 3, mRNA [NM_173200] Homo sapiens F-box only protein 32 (FBXO32), transcript variant 1, mRNA [NM_058229]

2.719 2.717 2.701 2.691 2.670

NM_133467 NM_007197 NM_017881 NM_007193 NM_022083

Homo sapiens Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 (CITED4), mRNA [NM_133467] Homo sapiens frizzled homolog 10 (Drosophila) (FZD10), mRNA [NM_007197] Homo sapiens chromosome 9 open reading frame 95 (C9orf95), mRNA [NM_017881] Homo sapiens annexin A10 (ANXA10), mRNA [NM_007193] Homo sapiens chromosome 1 open reading frame 24 (C1orf24), mRNA [NM_022083]

2.633 2.632 2.603 2.596 2.589

NM_006633 NM_001172 NM_001615 NM_024636 NM_018948

Homo sapiens IQ motif containing GTPase activating protein 2 (IQGAP2), mRNA [NM_006633] Homo sapiens arginase, type II (ARG2), nuclear gene encoding mitochondrial protein, mRNA [NM_001172] Homo sapiens actin, gamma 2, smooth muscle, enteric (ACTG2), mRNA [NM_001615] Homo sapiens likely ortholog of mouse tumor necrosis-alpha-induced adipose-related protein (FLJ23153), mRNA [NM_024636] Homo sapiens mitogen-inducible gene 6 (MIG-6), mRNA [NM_018948]

2.584 2.568 2.552 2.548 2.547

NM_001229 NM_004496 NM_003275

Homo sapiens caspase 9, apoptosis-related cysteine protease (CASP9), transcript variant alpha, mRNA [NM_001229] Homo sapiens forkhead box A1 (FOXA1), mRNA [NM_004496] Homo sapiens tropomodulin 1 (TMOD1), mRNA [NM_003275]

2.540 2.531 2.524

Supplementary Table 1-2 N.Nishimoto et al.

Accepted manuscript Journal of Cell Science

GeneName

SystematicName

Description

IGF1 IL11 IL7R CRYAB DACT1 LOC340529 GREM1 TGFBI TNFRSF25 LAMB3 ANXA8 AMIGO2 KIAA1446 AQP1 UNQ689 POU4F3 AF1Q TAGLN S100A16 UNC13D FOXP1 FLJ10613 HSPC054 CLU KIAA1446 TNFRSF12A S100A10 COL4A1 HOXA7 SYT13 DCBLD1 LIMS1 ACTL6A FLJ37659 COL4A2

NM_000618 NM_000641

Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1), mRNA [NM_000618] Homo sapiens interleukin 11 (IL11), mRNA [NM_000641]

BAF53shRNA/control ratio 0.166 0.170

NM_002185 NM_001885 NM_016651 BC041956 NM_013372

Homo sapiens interleukin 7 receptor (IL7R), mRNA [NM_002185] Homo sapiens crystallin, alpha B (CRYAB), mRNA [NM_001885] Homo sapiens dapper homolog 1, antagonist of beta-catenin (xenopus) (DACT1), mRNA [NM_016651] Homo sapiens hypothetical protein LOC340529, mRNA (cDNA clone IMAGE:5302003), partial cds. [BC041956] Homo sapiens cysteine knot superfamily 1, BMP antagonist 1 (CKTSF1B1), mRNA [NM_013372]

0.202 0.213 0.225 0.236 0.242

NM_000358 NM_148965 NM_000228 NM_001630 NM_181847

Homo sapiens transforming growth factor, beta-induced, 68kDa (TGFBI), mRNA [NM_000358] Homo sapiens tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 1, mRNA [NM_148965] Homo sapiens laminin, beta 3 (LAMB3), mRNA [NM_000228] Homo sapiens annexin A8 (ANXA8), mRNA [NM_001630] Homo sapiens amphoterin induced gene 2 (AMIGO2), mRNA [NM_181847]

0.258 0.262 0.264 0.264 0.279

NM_020836 NM_000385 AY358528 NM_002700 NM_006818

Homo sapiens brain-enriched guanylate kinase-associated protein (KIAA1446), mRNA [NM_020836] Homo sapiens aquaporin 1 (channel-forming integral protein, 28kDa) (AQP1), transcript variant 2, mRNA [NM_000385] Homo sapiens clone DNA66660 RSTI689 (UNQ689) mRNA, complete cds. [AY358528] Homo sapiens POU domain, class 4, transcription factor 3 (POU4F3), mRNA [NM_002700] Homo sapiens ALL1-fused gene from chromosome 1q (AF1Q), mRNA [NM_006818]

0.288 0.290 0.292 0.293 0.307

NM_003186 NM_080388 NM_199242 NM_032682 NM_019067

Homo sapiens transgelin (TAGLN), mRNA [NM_003186] Homo sapiens S100 calcium binding protein A16 (S100A16), mRNA [NM_080388] Homo sapiens unc-13 homolog D (C. elegans) (UNC13D), mRNA [NM_199242] Homo sapiens forkhead box P1 (FOXP1), mRNA [NM_032682] Homo sapiens hypothetical protein FLJ10613 (FLJ10613), mRNA [NM_019067]

0.310 0.311 0.325 0.325 0.325

AF161539 NM_203339 NM_020836 NM_016639 NM_002966

Homo sapiens HSPC054 mRNA, complete cds. [AF161539] Homo sapiens clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J) (CLU), transcript variant 2, mRNA [NM_203339] Homo sapiens brain-enriched guanylate kinase-associated protein (KIAA1446), mRNA [NM_020836] Homo sapiens tumor necrosis factor receptor superfamily, member 12A (TNFRSF12A), mRNA [NM_016639] Homo sapiens S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptide (p11)) (S100A10), mRNA [NM_002966]

0.334 0.338 0.341 0.348 0.358

NM_001845 NM_006896 NM_020826 AK098194 NM_004987

Homo sapiens collagen, type IV, alpha 1 (COL4A1), mRNA [NM_001845] Homo sapiens homeo box A7 (HOXA7), mRNA [NM_006896] Homo sapiens synaptotagmin XIII (SYT13), mRNA [NM_020826] Homo sapiens cDNA FLJ40875 fis, clone UMVEN2000069. [AK098194] Homo sapiens LIM and senescent cell antigen-like domains 1 (LIMS1), mRNA [NM_004987]

0.377 0.378 0.381 0.384 0.385

NM_178042 NM_173698 NM_001846

Homo sapiens BAF53 (BAF53A), transcript variant 3, mRNA [NM_178042] Homo sapiens hypothetical protein FLJ37659 (FLJ37659), mRNA [NM_173698] Homo sapiens collagen, type IV, alpha 2 (COL4A2), mRNA [NM_001846]

0.387 0.394 0.394

Supplementary Table 1-3 N.Nishimoto et al.