Biol Trace Elem Res DOI 10.1007/s12011-015-0487-0
Arsenic Trioxide Exposure Induces Heat Shock Protein Responses in Cock Livers Kexin Zhang 1 & Panpan Zhao 1 & Guangyang Guo 1 & Ying Guo 1 & Siwen Li 1 & Ying He 1 & Xiao Sun 1 & Hongliang Chai 1 & Wen Zhang 1 & Mingwei Xing 1
Received: 15 July 2015 / Accepted: 18 August 2015 # Springer Science+Business Media New York 2015
Abstract Arsenic is a trace element widely found in nature, and there are several forms of arsenic, including the most toxic form of trivalent arsenic. Arsenic trioxide (As2O3) is widespread in nature and tends to accumulate in animals and humans, thus causing great harm. Although the important role of heat shock proteins (HSPs) has been demonstrated in many types of mammals exposed to As2O3, the function of these proteins in poultry, especially in cocks, remains unclear. In this study, we used experimental animals (male chickens), which were fed a diet including 0, 7.5, 15, and 30 mg kg−1 As2O3, respectively, in the control, low, middle, and high groups. The livers were collected after the cocks were treated with arsenic for 30, 60, and 90 days. We detected HSP27, HSP60, HSP70, and HSP90 levels in the livers of the cocks by real-time PCR and HSP60 and HSP70 levels by Western blot. The results showed that the messenger RNA and protein expression of HSPs exposed to As 2 O 3 had obviously Kexin Zhang and Panpan Zhao contributed equally to this work. * Hongliang Chai
[email protected] * Wen Zhang
[email protected] * Mingwei Xing
[email protected] Kexin Zhang
[email protected] Panpan Zhao
[email protected] Guangyang Guo
[email protected] 1
College of Wildlife Resources, Northeast Forestry University, 26 Hexing Road, Harbin, Heilongjiang Province 150040, China
increased. These results demonstrated that arsenic toxicity affected the expression of HSP levels in cock livers. Keywords As2O3 . Cock . Liver . Heat shock proteins
Introduction Animals face a variety of environmental stressors, including toxic minerals, which are natural nonmetallic elements. Inorganic arsenic has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC) in 1980. Chronic arsenic toxicity can have varied clinical presentations, which can range from noncancerous manifestations to malignancies of the skin and different internal organs in animals [1, 2]. Researchers have demonstrated that chronic arsenic poisoning could influence the health and welfare of humans and animals [3, 4]. There was a close relationship between the inflammatory reaction in the gastrointestinal tract and arsenic trioxide (As2O3) [5]. Guo et al. have demonstrated the oxidative stress in the gastrointestinal tract tissues induced by As2O3 [6]. Regarding liver disease, arsenic poisoning could increase hepatic density and idiopathic portal hypertension [7]. As a result, the hepatic damage caused by chronic toxicity in experimental animals has become a focus of research [8]. From such studies, we know the toxicity of arsenic (As) to the liver, but most of these studies have been limited to mammals only, with few studies of birds. When living organisms are exposed to various toxic conditions, a group of highly conserved proteins, known as heat shock proteins (HSPs), is rapidly synthesized, including HSP27, HSP40, HSP60, HSP70, and HSP90 [9]. HSPs are major molecular chaperones that perform important functions in the folding/unfolding and translocation of proteins and in the assembly/disassembly of protein complexes [10]. At the
Zhang et al.
same time, HSPs are expressed constitutively in the livers of poultry species [11, 12]. HSPs have been extensively studied because of their prominent responses to diverse stressors, and the increased synthesis of these inducible proteins is involved in the protection of stressed cells and organisms [12–14]. HSP70 in the lung and liver of rats had a protective function against endotoxin tolerance [15, 16]. Additionally, the expression levels of HSP 27, HSP 70, and HSP 90 in heart and blood of chickens exposed to high temperatures have been reported; the results suggested that HSPs have a protective function against cardiac injury [17]. The liver is a major target organ of arsenic poisoning. In this study, we investigated the protein expression levels of HSP 60 and HSP 70 and the messenger RNA (mRNA) expression levels of HSP 27, HSP 60, HSP 70, and HSP 90 to damage due to arsenic toxicity in cock livers.
Materials and Methods
Primer Design To design primers, we used the cocks’ HSP27, HSP60, HSP70, HSP90, and GADPH mRNA GenBank sequences with the accession numbers in Table 1. GADPH was used as an internal reference. The primers were designed using the Primer 5 software. Total RNA Isolation and Reverse Transcription Total RNA was isolated from the liver (50 mg tissue; n = 6/ group) of each cock using RNAiso Plus reagent (Takara, China), according to the manufacturer’s instructions. The concentration of RNA was measured by the OD 260:280 ratio. Next, the complementary DNA (cDNA) was obtained through reverse transcription using a PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, China). The reverse transcription procedure used was based on the instructions from the manufacturer (Takara, China). Finally, the synthesized cDNA was diluted ten times with sterile water and was stored at −80 °C before use.
Experimental Design Real-Time Quantitative Reverse Transcription PCR All of the procedures used in this experiment were approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University according to the standards described in the guidelines. A total of 72 1-day-old cocks were randomly divided into four groups, including a control group, low-As group, middle-As group, and high-As group, and the cocks were fed either a commercial diet or an As-supplemented diet containing 7.5, 15, or 30 mg kg−1 As2O3. The animals were raised in the Laboratory Animal Center, College of Veterinary Medicine, Northeast Forestry University, China. After being treated with arsenic for 30, 60, and 90 days, the livers were dissected from the cocks after euthanasia and were collected aseptically and placed in sterile phosphate-buffered saline (PBS, 0.1 M phosphate buffer with 0.85 % NaCl, pH 7.2). Then, the products were stored at −80 °C for further use.
Table 1 Primer sequences and numbers
Real-time quantitative reverse transcription PCR was used to detect the expression of the HSP27, HSP60, HSP70, and HSP90 GADPH genes in the livers using SYBR Premix Ex Taq (Takara, China). Real-time PCR was conducted on each sample for six replications. Reaction mixtures were incubated in a BIOER LineGene 9600 Detection System (Hangzhou Bioer Technology Co., Ltd., China). Reactions were performed in 10 μL of Fast Universal SYBR Green Master (Rox) (F. Hoffmann-La Roche, Switzerland), 2 μL of diluted cDNA, 4 μL of each primer (10 M), and 4 μL of PCR-grade water. The program was performed as follows: 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 1 min, and extension at 60 °C for 20 s. The melting curve analysis showed only one peak for
Target gene (cocks)
GenBank accession number
Prime sequence (5′–3′)
PCR fragment length (bp)
Hsp90
NM_001109785.1
Forward: TCCTGTCCTGGCTTTAGTTT
143
NM_001006685.1
Reverse: AGGTGGCATCTCCTCGGT Forward: CGGGCAAGTTTGACCTAA
250
NM_001012916.1
Reverse: TTGGCTCCCACCCTATCTCT Forward: AGCCAAAGGGCAGAAATG
208
NM_205290.1
Reverse: TACAGCAACAACCTGAAGACC Forward: ACACGAGGAGAAACAGGATGAG
158
K01458
Reverse: ACTGGATGGCTGGCTTGG Forward: AGAACATCATCCCAGCGT
182
Hsp70 Hsp60 Hsp27 GADPH
Reverse: AGCCTTCACTACCCTCTTG
Arsenic Trioxide Exposure Induces HSP Responses in Cock Livers
each PCR product. The mRNA was normalized to the mean expression of GADPH and expressed as ΔΔCt. Western Blot Analysis Fifty milligrams of liver from each sample was immersed in saline, cut, and then disposed by the explanatory memorandum of sodium dodecyl sulfate (SDS) lysate (Beyotime Institute of Biotechnology, China) with tissue homogenizer. The SDS lysate contained PMSF and other inhibitors that effectively inhibit protein degradation. The supernatant of homogenate was collected by centrifuging. The protein concentrations were determined using BCA protein assay kits (Thermo Scientific, USA). Equal amounts of protein extracts were separated by SDS PAGE for 2 h at 120 V under reducing conditions on 12 % gels and were transferred to a nitrocellulose membrane (Biosharp, China) for 2 h at 100 mA in Tris-glycine buffer. The membranes were blocked with 5 % skim milk for 3 h and were then incubated with HSP antibody 60 (1:1000) and 70 (1:1000) (Hsp60 and Hsp70 polyclonal antibody production were kindly performed by Shi Wen Xu, Laboratory of the College of Veterinary Medicine, Northeast Agricultural University, Harbin, China) and GADPH (1:1000) (Beyotime Institute of Biotechnology, China) at 4 °C overnight. Then, the membranes were washed three times with PBST for 30 min. Next, they were reacted with the corresponding IgG/HRP Fig. 1 Effects of As2O3 on the gene expressions of HSP27, HSP60, HSP70, and HSP90 in the liver. Relative mRNA levels of genes were detected by realtime PCR. a–d Results of HSP27, HSP60, HSP70, and HSP90 levels after exposure to As2O3 in the liver, respectively. The relative mRNA levels from the solvent control group were used as the reference values in panels (a) to (d). Each value represents the mean ± SD of six individuals. The asterisk or double asterisk indicates that there are significant differences (p < 0.05 or p < 0.01) between the control group and the low-As group, middle-As group, and high-As group at the same time point
(1:5000) conjugated (Beijing Biosynthesis Biotechnology Co., Ltd., China) for 1 h at room temperature and were then washed three times with PBST. Protein expression was detected with an enhanced chemiluminescence (ECL) Western blotting detection kit (Thermo Scientific, USA). Finally, the membrane was exposed to an X-ray film. Statistical Analysis Statistical analysis of all the data was performed using the SPSS software, version 13.0, and was assessed by one-way ANOVA. The data are expressed as the mean ± SD. Differences were considered to be significant at p < 0.05 or p < 0.01.
Results Effects of As2O3 on the mRNA Levels of HSPs in the Livers of Cocks The expression of HSP27, HSP60, HSP70, and HSP90 in the livers of cocks was investigated at the transcriptional level by real-time PCR. GADPH was used as the internal control gene. In general, the HSP levels for all of the treatment groups increased significantly in dose- and time-dependent manners (Fig. 1), compared to the corresponding control groups (p < 0.05 or p < 0.01).
Zhang et al.
Figure 1a shows that HSP27 mRNA in the liver had an increased trend at 30 days. Compared to the corresponding control group, the expression level of HSP27 mRNA in cock livers increased but it is not statistically significantly (p > 0.05), and in the high-As group, it increased significantly (p < 0.05). Compared to the corresponding control group, the low-As group increased, but not significantly. The middle-As and high-As groups at 60 days significantly increased (p < 0.05 or p < 0.01). Compared to the corresponding control group, the low-As and middle-As groups increased, but not significantly. The high-As group at 90 days significantly increased (p < 0.01). Figure 1b shows that HSP60 mRNA in the liver increased in a dose-dependent manner at 30 days. Compared with the corresponding control group, the expression level of HSP60 mRNA increased significantly in the low-As group, middleAs group, and high-As group (p < 0.01). Compared to the control group, the low-As group increased, but not significantly (p > 0.05). The middle-As and high-As groups at 60 days significantly increased (p < 0.01). Compared to the control group, the low-As group increased, but not significantly (p > 0.05). The middle-As and high-As groups at 90 days significantly increased (p < 0.01). Figure 1c shows that HSP70 mRNA in the liver increase in a dose-dependent manner at 30 days. Compared with the corresponding control group, the expression level of HSP70 mRNA increased significantly in the low-As group, middleFig. 2 Effects of As2O3 on the expressions of HSP60, HSP70, and GADPH in cock livers: a the protein expression levels of HSP60 and HSP70 in the liver were analyzed by Western blot with specific antibodies. GADPH was used as a control. Nos. 1, 3, and 5 represented C groups at 30, 60, and 90 days, respectively. Nos. 2, 4, and 6 represented H groups at 30, 60, and 90 days, respectively. b HSP60/GADPH ratio expression levels to GADPH. c HSP70/GADPH ratio expression levels to GADPH. Each value represents the mean ± SD of three individuals. The asterisk indicates that there are significant differences (p < 0.05) between the high-As group and the corresponding control groups
As group, and high-As group (p < 0.01). Compared to the control group, the low-As group increased, but not significantly (p > 0.05). The middle-As and high-As groups at 60 days significantly increased (p < 0.01). Compared with the corresponding control group, the low-As, middle-As, and high-As groups at 90 days significantly increased (p < 0.01). Figure 1d shows that HSP90 mRNA in the liver increased in a dose-dependent manner at 30 days. Compared with the corresponding control group, the expression level of HSP60 mRNA increased significantly in the low-As group, middle-As group, and high-As group (p < 0.05 or p < 0.01). Compared with the corresponding control group, the low-As group, middle-As group, and high-As group at 60 days significantly increased (p < 0.01). Compared with the corresponding control group, the low-As, middle-As, and high-As groups at 90 days significantly increased (p < 0.05 or p < 0.01). Effects of As2O3 on the Protein Expression Levels of HSP60 and HSP70 in the Livers of Cocks The protein expression of HSP60 and HSP70 in the control group and in the high-As group of cock livers was detected by Western blot (Fig. 2). GADPH was used as a reference. Figure 2b shows that HSP60 increased at 30 and 60 days (p < 0.05) but decreased at 90 days (p < 0.05) compared with the corresponding control groups. Figure 2c shows that
Arsenic Trioxide Exposure Induces HSP Responses in Cock Livers
HSP70 increased at 30 and 60 days (p < 0.05) but decreased at 90 days (p < 0.05) compared with the corresponding control groups. Compared to the control group, the high-As group decreased, but not significantly (p > 0.05).
Discussion As is a kind of trace elements which has toxicity to animals and plants in its inorganic form. There has an evaluation of 26 elements in the pectoral muscle of As-treated chicken which suggested the needful of monitoring the concentration of As for human health [17]. Arsenic poisoning can disrupt the balance of the organism and cause characteristic skin lesions, ischemic heart disease, and cancers of various organs, especially the liver [18], which is one of the most important alexipharmic organs in vivo. It has been reported that environmental exposure to As2O3 can cause health effects associated with chronic arsenic poisoning, such as cancer [19, 20]. Therefore, we aimed to measure the hepatic As levels in As2O3-exposed cocks. As molecular chaperones, HSPs, can increase the stress capacity of cells, especially their heat capacity [21]. Heat shock proteins are protective proteins that, when they are subjected to high temperatures and other harsh environmental attacks, will generate a large number of synthetic helper cells to maintain normal physiological activities, to prevent protein interactions affecting cell health, and to promote healthy interactions [22, 23]. HSP levels can also indirectly reflect the prevalence of hepatic tumors [24–26]. HSP27 phosphorylation increases in cells exposed to mitogens and tumor promoters, as in the case of As [27–29]. In this manner, the variations in HSP27 expression are associated with strengthening and tolerance of the organ to injury induced by toxicity [30, 31]. In our research, the expression of Hsp27 was increased (p < 0.05 or p < 0.01) significantly, similar to the report by Moghimian et al. [28], who observed that acute stress and oxytocin could upregulate HSP27 expression in rat hearts. Zhu et al. also reported that manganese could induce cytotoxicity with increased HSP27 [32]. In our study, HSP27 also increased with As2O3, especially in the high-As groups, similar to the study of manganese. This result is the same as the study of immune organs exposed to As2O3 by Guo et al. [33]. HSP60 and HSP70 might play key roles in the cellular defense mechanism [34, 35]. HSP60 is a molecular chaperone in this family that guides the synthesis, transportation, and degradation of protein [36]. Schett et al. reported that cytotoxicity could cause HSP60 to increase [37]. Guo et al. also reported that As2O3 could cause HSP60 to increase in immune organs [33]. In our study, the highest level of HSP60 mRNA occurred in livers at 60 days in the high-As group, and the encoded proteins might act as important markers and
protective proteins in response to adverse environmental conditions, consistent with the findings of Schett et al. Further, the changes in the mRNA levels and protein content were relatively consistent (Fig. 1b, 2) with this study. These results were supported by Martinez et al. [38], who reported that HSP60 was the target of the humoral immune response in rats, which increased with stress. For both of the levels we detected, the expression at 90 days was reduced, perhaps because of the immune tolerance of the individual. HSP70 acts to stabilize or solubilize target proteins [39], which increase to help the body adjust when encountering stress. It was reported that early chicken embryos could induce a rapid emergent response to cope with severe heat stress by increasing HSP70 mRNA levels [40, 41]. At the same time, it was reported that atrazine and chlorpyrifos could affect the mRNA levels of HSP70 and HSC70 (heat shock cognate protein 70), causing increases in the livers of common carp [42]. Exactly like our study, the level of HSP70 significantly increased in the high-As group at 60 days. Subsequently, there was a slight decrease at 90 days compared with 60 days. As HSP70 decreased, the other proteins began to slowly decline. It was suggested that HSP70 expression might be a signal protein before others, thus indicating the liver had been damaged by toxicity. Although a few of them performed differently, it might be because of the extent of the increase was different in protein and mRNA. In our opinion, the reason was that there were many differences in toxicities in animal models. There may have been some discrepancies between the chemical species and animal species of As2O3. HSP90 can act as important protective proteins in response to disadvantageous environmental conditions. The expression of heat shock proteins HSP27, HSP90, and HSP70 was studied under conditions of acute and chronic intoxication of animals [43, 44]. At the same time, poison also caused the levels of HSP90 to change in rats [14, 45, 46]. For immune organs, HSP90 also increased in general by As2O3 [33]. In their studies, the level of HSP90 increased, as in our research. These results were supported by Xing et al., who reported that atrazine and chlorpyrifos increased Hsp60 gene transcription and protein levels in common carp. Edwards et al., Maitani et al., and Albores et al. reported that the stress response to As could increase progesterone receptor activity and cause the induction of HSP90 in the livers of rats [44, 47, 48]. Consistent with these prior studies, our results suggested that, with the duration of As2O3, HSP90 showed an increased trend in a dosedependent manner (Fig. 1d), especially in the high-As group at 60 days.
Conclusion This study was the first to measure the effects of As2O3 on the levels of HSPs in cocks. The present study suggested that the
Zhang et al.
protein expression levels of HSP60 and HSP70 and the mRNA expression levels of HSP27, HSP60, HSP70, and HSP90 increased in reaction to As2O3. Although the exact mechanism of action of these toxins remains unknown, the results of the current study suggested that As might have effects on cocks with regard to hot shock reactions. These data have laid the foundation for determining the exact mechanisms of heat shock protein changes in the liver tissues of cocks caused by As2O3. Acknowledgments This study was supported by the Heilongjiang Province Natural Science Foundation (Grant No. C2015061). Conflicts of Interest The authors declare that they have no competing interests.
References 1. 2. 3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Ahsan T, Zehra K, Munshi A, Ahsan S (2009) Chronic arsenic poisoning. J PAK MED ASSOC 59:105–107 Hall AH (2002) Chronic arsenic poisoning. Toxicol Lett 128:69–72 Kapaj S, Peterson H, Liber K, Bhattacharya P (2006) Human health effects from chronic arsenic poisoning—a review. J Environ Sci Health A Tox Hazard Subst Environ Eng 41:2399–2428 Supapong S, Phanthumchinda K, Srirattanaban J (2004) Nerve conduction studies in chronic arsenic poisoning patients. J Med Assoc Thail 87(Suppl 2):S207–S212 Xing MW, Zhao PP, Guo GY, Guo Y, Zhang KX, Tian L, He Y, Chai HL, Zhang W (2015) Inflammatory factor alterations in the gastrointestinal tract of cocks overexposed to arsenic trioxide. Biol Trace Elem Res 15:0305–0308 Guo Y, Zhao PP, Guo GY, Hu ZB, Tian L, Zhang KX, Zhang W, Xing MW (2015) The role of oxidative stress in gastrointestinal tract tissues induced by arsenic toxicity in cocks. Biol Trace Elem Res 15:0357–0359 Dick L, Parker LA, Mauro MA (1990) Chronic arsenic poisoning as a cause of increased hepatic density with CT. J Comput Assist Tomogr 14:828–829 Santra A, Maiti A, Das S, Lahiri S, Charkaborty SK, Mazumder DN (2000) Hepatic damage caused by chronic arsenic toxicity in experimental animals. J Toxicol Clin Toxicol 38:395–405 Lee H, Kang C, Yoo YS, Hah DY, Kim CH, Kim E, Kim JS (2013) Cytotoxicity and the induction of the stress protein Hsp 70 in Chang liver cells in response to zearalenone-induced oxidative stress. Environ Toxicol Pharmacol 36:732–740 Bernabo P, Rebecchi L, Jousson O, Martinez-Guitarte JL, Lencioni V (2011) Thermotolerance and hsp70 heat shock response in the cold-stenothermal chironomid Pseudodiamesa branickii (NE Italy). Cell Stress Chaperones 16:403–410 Figueiredo D, Gertler A, Cabello G, Decuypere E, Buyse J, Dridi S (2007) Leptin downregulates heat shock protein-70 (HSP-70) gene expression in chicken liver and hypothalamus. Cell Tissue Res 329: 91–101 Del RL, Quintanilla-Vega B, Brambila-Colombres E, CalderonAranda ES, Manno M, Albores A (2001) Stress proteins induced by arsenic. Toxicol Appl Pharmacol 177:132–148 Luo S, Ahola V, Shu C, Xu C, Wang R (2015) Heat shock protein 70 gene family in the Glanville fritillary butterfly and their response to thermal stress. Gene 556:132–141 Chen X, Zhu YH, Cheng XY, Zhang ZW, Xu SW (2012) The protection of selenium against cadmium-induced cytotoxicity via
the heat shock protein pathway in chicken splenic lymphocytes. Molecules 17:14565–14572 15. Flohe S, Dominguez FE, Ackermann M, Hirsch T, Borgermann J, Schade FU (1999) Endotoxin tolerance in rats: expression of TNFalpha, IL-6, IL-10, VCAM-1 and HSP 70 in lung and liver during endotoxin shock. Cytokine 11:796–804 16. Schutte A, Topp SA, Knoefel WT, Brilloff S, Mueller L, Rogiers X, Gundlach M (2001) Influence of Ginkgo Biloba extract (EGB 761) on expression of EGR-1 mRNA and HSP-70 mRNA after warm ischemia in the rat liver. Transplant Proc 33:3724–3725 17. Sun BN, Xing MW (2015) Evaluated the twenty-six elements in the pectoral muscle of As-treated chicken by inductively coupled plasma mass spectrometry. Biol Trace Elem Res 015:0418–0 18. Yu J, Bao E, Yan J, Lei L (2008) Expression and localization of Hsps in the heart and blood vessel of heat-stressed broilers. Cell Stress Chaperones 13:327–335 19. Chen CJ (2014) Health hazards and mitigation of chronic poisoning from arsenic in drinking water: Taiwan experiences. Rev Environ Health 29:13–19 20. Tsuda T, Kume Y, Yamamoto M, Nagira T, Aoyama H (1987) A case of lung cancer associated with chronic arsenic poisoning caused by neighborhood exposure of As2O3 from Toroku mine. Sangyo Igaku 29:222–223 21. Vahter M (2008) Health effects of early life exposure to arsenic. Basic Clin Pharmacol Toxicol 102:204–211 22. Zhao FQ, Zhang ZW, Wang C, Zhang B, Yao HD, Li S, Xu SW (2013) The role of heat shock proteins in inflammatory injury induced by cold stress in chicken hearts. Cell Stress Chaperones 18: 773–783 23. Pivovarova AV, Mikhailova VV, Chernik IS, Chebotareva NA, Levitsky DI, Gusev NB (2005) Effects of small heat shock proteins on the thermal denaturation and aggregation of F-actin. Biochem Biophys Res Commun 331:1548–1553 24. Yokota S, Minota S, Fujii N (2006) Anti-HSP auto-antibodies enhance HSP-induced pro-inflammatory cytokine production in human monocytic cells via Toll-like receptors. Int Immunol 18:573– 580 25. Zheng Z, Park SY, Lee M, Phark S, Won NH, Kang HS, Sul D (2011) Effects of benzo(a)pyrene on the expression of heat shock proteins, pro-inflammatory cytokines and antioxidant enzymes in hepatic tumors induced by rat hepatoma N1-S1 cells. J Korean Med Sci 26:222–230 26. Banerjee S, Mitra T, Purohit GK, Mohanty S, Mohanty BP (2015) Immunomodulatory effect of arsenic on cytokine and HSP gene expression in Labeo rohita fingerlings. Fish Shellfish Immunol 44:43–49 27. Guo Y, Ziesch A, Hocke S, Kampmann E, Ochs S, De Toni EN, Goke B, Gallmeier E (2015) Overexpression of heat shock protein 27 (HSP27) increases gemcitabine sensitivity in pancreatic cancer cells through S-phase arrest and apoptosis. J Cell Mol Med 19:340– 350 28. Moghimian M, Faghihi M, Karimian SM, Imani A, Mobasheri MB (2014) Upregulated hsp27 expression in the cardioprotection induced by acute stress and oxytocin in ischemic reperfused hearts of the rat. Chin J Physiol 57:329–334 29. Wu YL, Pan X, Mudumana SP, Wang H, Kee PW, Gong Z (2008) Development of a heat shock inducible gfp transgenic zebrafish line by using the zebrafish hsp27 promoter. Gene 408:85–94 30. Guay J, Lambert H, Gingras-Breton G, Lavoie JN, Huot J, Landry J (1997) Regulation of actin filament dynamics by p38 map kinasemediated phosphorylation of heat shock protein 27. J Cell Sci 110(Pt 3):357–368 31. Flohe S, Speidel N, Flach R, Lange R, Erhard J, Schade FU (1998) Expression of HSP 70 as a potential prognostic marker for acute rejection in human liver transplantation. Transpl Int 11:89–94
Arsenic Trioxide Exposure Induces HSP Responses in Cock Livers 32.
Zhu Y, Lu X, Wu D, Cai S, Li S, Teng X (2013) The effect of manganese-induced cytotoxicity on mRNA expressions of HSP27, HSP40, HSP60, HSP70 and HSP90 in chicken spleen lymphocytes in vitro. Biol Trace Elem Res 156:144–152 33. Guo Y, Zhao PP, Guo GY, Hu ZB, Tian L, Zhang KX, Sun Y, Zhang XG, Zhang W, Xing MW (2015) Effects of arsenic trioxide exposure on heat shock protein response in the immune organs of chickens. Biol Trace Elem Res 015:0389–0381 34. Cheng YF, Sun JR, Chen HB, Abdelnasir A, Tang S, Kemper N, Hartung J, Bao ED (2014) Association of Hsp60 expression with damage to rat myocardial cells exposed to heat stress in vivo and in vitro. Genet Mol Res 13:9371–9381 35. Tacchini L, Schiaffonati L, Pappalardo C, Gatti S, Bernelli-Zazzera A (1993) Expression of HSP 70, immediate-early response and heme oxygenase genes in ischemic-reperfused rat liver. Lab Investig 68:465–471 36. Zanin-Zhorov A, Bruck R, Tal G, Oren S, Aeed H, Hershkoviz R, Cohen IR, Lider O (2005) Heat shock protein 60 inhibits Th1mediated hepatitis model via innate regulation of Th1/Th2 transcription factors and cytokines. J Immunol 174:3227–3236 37. Schett G, Xu Q, Amberger A, Van der Zee R, Recheis H, Willeit J, Wick G (1995) Autoantibodies against heat shock protein 60 mediate endothelial cytotoxicity. J Clin Invest 96:2569–2577 38. Martinez J, Perez-Serrano J, Bernadina WE, Rodriguez-Caabeiro F (2001) HSP60, HSP70 and HSP90 from Trichinella spiralis as targets of humoral immune response in rats. Parasitol Res 87:453–458 39. Dix DJ (1997) Hsp70 expression and function during gametogenesis. Cell Stress Chaperones 2:73–77 40. Gabriel JE, Da MA, Boleli IC, Macari M, Coutinho LL (2002) Effect of moderate and severe heat stress on avian embryonic hsp70 gene expression. Growth Dev Aging 66:27–33
41.
Kukreja RC, Kontos MC, Loesser KE, Batra SK, Qian YZ, Gbur CJ, Naseem SA, Jesse RL, Hess ML (1994) Oxidant stress increases heat shock protein 70 mRNA in isolated perfused rat heart. Am J Physiol 267:H2213–H2219 42. Xing H, Li S, Wang X, Gao X, Xu S, Wang X (2013) Effects of atrazine and chlorpyrifos on the mRNA levels of HSP70 and HSC70 in the liver, brain, kidney and gill of common carp (Cyprinus carpio L.). Chemosphere 90:910–916 43. Novoselova EG, Glushkova OV, Cherenkov DA, Parfenyuk SB, Novoselova TV, Lunin SM, Khrenov MO, Guzhova IV, Margulis BA, Fesenko EE (2006) Production of heat shock proteins, cytokines, and nitric oxide in toxic stress. Biochemistry (Mosc) 71:376– 383 44. Edwards DP, Estes PA, Fadok VA, Bona BJ, Onate S, Nordeen SK, Welch WJ (1992) Heat shock alters the composition of heteromeric steroid receptor complexes and enhances receptor activity in vivo. BIOCHEMISTRY-US 31:2482–2491 45. Bagchi M, Bagchi D, Adickes E, Stohs SJ (1995) Chronic effects of smokeless tobacco extract on rat liver histopathology and production of HSP-90. J Environ Pathol Toxicol Oncol 14:61–68 46. Schiaffonati L, Rappocciolo E, Tacchini L, Cairo G, BernelliZazzera A (1990) Reprogramming of gene expression in postischemic rat liver: induction of proto-oncogenes and hsp 70 gene family. J Cell Physiol 143:79–87 47. Albores A, Koropatnick J, Cherian MG, Zelazowski AJ (1992) Arsenic induces and enhances rat hepatic metallothionein production in vivo. Chem Biol Interact 85:127–140 48. Maitani T, Saito N, Abe M, Uchiyama S, Saito Y (1987) Chemical form-dependent induction of hepatic zinc-thionein by arsenic administration and effect of co-administered selenium in mice. Toxicol Lett 39:63–70
