ISSN 0362 1197, Human Physiology, 2010, Vol. 36, No. 2, pp. 229â233. ... the frequency distribution of TFAM gene alleles in athletes and control subjects and.
ISSN 03621197, Human Physiology, 2010, Vol. 36, No. 2, pp. 229–233. © Pleiades Publishing, Inc., 2010. Original Russian Text © I.I. Ahmetov, D.V. Popov, S.S. Missina, O.L. Vinogradova, V.A. Rogozkin, 2010, published in Fiziologiya Cheloveka, 2010, Vol. 36, No. 2, pp. 121–125.
Association of Mitochondrial Transcription Factor (TFAM) Gene Polymorphism with Physical Performance in Athletes I. I. Ahmetova,b, D. V. Popova, S. S. Missinaa, O. L. Vinogradovaa, and V. A. Rogozkinb a
Institute of Biomedical Problems, Russian Academy of Sciences, Moscow, 123007 Russia b St. Petersburg Research Institute of Physical Culture, St. Petersburg, 191040, Russia Received June 16, 2009
Abstract—The distribution of allele frequencies for the Ser12Thr mitochondrial transcription factor (TFAM) gene polymorphism was studied in athletes (n = 1537) and control subjects (n = 1113) and the relationship between genotypes and aerobic physical performance was estimated in boat racers (n = 90). Genotyping was performed using analysis of restriction fragment length polymorphism (RFLP). Indices of aerobic physical performance such as maximum oxygen consumption (VO2max) and maximum aerobic power (Wmax) were examined in a test with incremental test to exhaustion, which was performed using a rowing ergometer. It was found that the frequency of the TFAM 12Thr allele in the group of enduranceoriented athletes (n =588) was significantly higher than in the control subjects (14.0% vs. 9.1%; p < 0.0001). In the group of enduranceori ented athletes, it increased with the rise of the athletes' skill level. Moreover, data on Wmax and VO2max were used to reveal the relationship between the TFAM 12Thr allele and the physical performance in athletes. Thus, the Ser12Thr TFAM gene polymorphism is associated with physical performance in athletes. Key words: TFAM, physical performance, gene, polymorphism. DOI: 10.1134/S0362119710020155
INTRODUCTION Mitochondria play an important role in the produc tion of energy, which is necessary for performance of longterm physical exercises. The human mitochondrial genome has codes for 13 proteins participating in enzy matic oxidative phosphorylation, 2 ribosomal RNAs, and 22 transport RNAs [1]. The maintenance of the opti mum level of mitochondrial DNA (mtDNA) and the expression of its genes are an important condition of energy supply of muscle activity through aerobic path way. Mitochondrial transcription factor (TFAM) gene, located at 10q21, encodes the key protein responsible for replication and transcription of mitochondrial DNA and protects cells against oxidative stress, which may contrib ute to the development of neurodegenerative disorders [2, 3]. The aerobic physical activity increases the TFAM expression and the number of mtDNA copies [4–6]. Overexpression of the Tfam gene in cardiac myocytes is associated with a twofold increase in the number of mtDNA copies and elevated ATP production [7]. How ever, mice, which have been knocked out by the Tfam gene, exhibit muscle weakness due to the impairment of the accumulation of calcium in the sarcoplasmic reticu lum [8]. Furthermore, an experimental decreased of Tfam in adipocytes via RNA interference results in the disturbance of carbohydrate metabolism and a decrease in the basal level of oxygen consumption and ATP pro
duction [9]. The expression of TFAM is regulated by tran scription factors, such as NRF1 and NRF2A. In the first exon of the TFAM gene, rs1937 G/C poly morphism was revealed; it results in serine substitution to threonine in the 12th codon of the mitochondrial tran scription factor (Ser12Thr). The rare TFAM allele 12Thr protects against Alzheimer’s disease [10, 11] and hyper trophy of the left ventricle myocardium in Russian boat racers and skaters [12]. It is also associated with long term physical endurance in divers performing the tread mill test [13]. It seems to be important to reveal the relationship between the Ser12Thr TFAM gene polymorphism and athlete’s physical performance because of the physiolog ical role of this mitochondrial transcription factor. The frequency of the TFAM 12Thr allele is supposed to be higher in those athletes who are oriented to endurance training, whereas the TFAM Ser/Thr and Thr/Thr geno types are associated with higher levels of aerobic physical performance. To test this hypothesis, we examined the frequency of the TFAM 12Thr allele in athletes of various sports and different skill levels. We used boat racing as a model for studying physical performance. This is a very hard kind of sport with a high demand for athlete’s endurance because, when boat racers row along a dis tance of 2000 m, up to 70% of the energy is supplied by aerobic metabolism [14]. In this study, we examined the frequency distribution of TFAM gene alleles in athletes and control subjects and
229
230
AHMETOV et al.
the relationship between the TFAM genotype and aerobic physical performance in boat racers. EXPERIMENTAL The sample of subjects comprised 1537 athletes in various sports. Among them, 452 subjects were women aged 20.7 ± 0.4 years and 1085 subjects were men aged 24.2 ± 2.3 years. In accordance with the type of training energy supply, we divided cyclic sports into five groups, in which the physiological basis of training exercises was similar for athletes [15]. We recorded the signs of the progression of endurance, speed, and strength, as well as power training work with its division into maximum, submaximum, high, moderate, and variable, and the division of training load cyclicity into cyclic and acyclic (table). According the moment of biological material sam pling for genotyping, 60 athletes were Honored Masters of Sport (HMSs), 171 athletes were masters of sports of international class (MSICs), 304 athletes were masters of sports (MSs), 459 athletes were candidates for masters of sports (CMSs), and 543 athletes had various sports grades for adults. Ninety boat racers were physiologically examined. They included 56 men (27 CMSs and 29 MSs) and 34 women (13 CMSs and 21 MSs). All of them were tested for aerobic and anaerobic working capacities. The sub jects were informed about the conditions of the experi ment and gave their informed written consent for partic ipation in the study. Our experiment was approved by the Physiological Unit of the Russian National Commission on Bioethics. The control group consisted of 1113 subjects, who were residents of St. Petersburg, Moscow, and Naberezh nye Chelny. Among them, 587 subjects were women 18 ± 0.1 years of age and 526 subjects were men 17.6 ± 0.1 years of age. The main condition for including the subjects into the control group was an absence of regular personal experience of athletics (as judged by the absence of any sports grade indicated in their questionnaires). For molecular genetic analysis, we used DNA sam ples prepared by the method of alkiline extraction [16] or the sorbent method employing the commercial DNK sorbA kit (Central Research Institute of Epidemiology, Ministry of Public Health of the Russian Federation) fol lowing the instructions of the manufacturer. One or the other method was used depending on the method of sam pling the biological material, namely, washout or scrape of mouth epithelial cells, respectively. The Ser12Thr polymorphism of the TFAM gene was assayed using a system of two primers. The forward primer was 5’CCAGGAGGCTCTCCGAGATTGG3’, and the reverse primer was 5’ACCAGGGTGACTCT GAACTCCTA3’. Hydrolysis of amplicons consisting of 267 base pairs (bp) was performed using BstDEI enzyme (SibEnzim, Russia). The Ser12 allele corresponded to 184 and 83bp fragments, and the 12Thr allele corre
sponded to a 267bp fragment. Estimations of the lengths of the restriction fragments in the products were per formed using electrophoretic separation in 8% polyacry lamide gel followed by staining with ethidium bromide. The gels were visualized in transmitted UV light with the use of an ETS VilberLourmat transilluminator (France). Aerobic capacities were examined in a test with grow ing load, which was performed using a PM 3 mechanical rowing ergometer (Concept II, United States). The start ing load was 150 W for men and 100 W for women. Each step lasted for 3 min, and resting intervals between the steps were 30 s. Exercises were performed until failure, which was expressed as a decrease in the power of the rowing stroke to a level 30 W below the predetermined level and a respiratory coefficient of >1.1. The athletes could not always perform the exercise for the entire 3min period at the last step of the test; therefore, we cal culated the maximum power as follows: ( Wn – Wn – 1 ) × tn W max = W n – 1 + , 180 where Wn is the mean power at the last step, W; Wn – 1 is the mean power at the next to last step, W; tn is the period of exercise performance at the last step, s. During test performance, for each respiratory cycle, we recorded the indices of respiratory metabolism and the heart rate (beats/min) using a MateMax 3B gas ana lyzer (Cortex, Germany) and a Vmax 229 device (Sen sorMedics, United States). Maximum oxygen consump tion (VO2max) was calculated using the mean values of the indices of respiratory metabolism measured for the last 30 s at each test step. Statistical analysis was performed using the Graph Pad InStat software package. We calculated mean values (M), standard errors of the means (±SEM), and standard deviations, (SD). We compared the frequencies of alleles in the samples using the χ2 test for large samples and exact Fisher’s test for small samples. The physiological indices in the groups were compared with the use of the unpaired test. The differences were considered signifi cant at p < 0.05. RESULTS AND DISCUSSION 1. Analysis of genotypes and TFAM allele frequencies distribution in athletes and control subjects. We analyzed the genotype and allele frequency distributions of the Ser12Thr TFAM gene polymorphism in the control group and athletes. We found that the TFAM 12Thr allele frequency in the control group was 9.1% and was similar in women and men, specifically, 9.4 and 9.0%, respec tively. The distribution of genotypes in the control sample was the following: Ser/Ser, 82.6%; Ser/Thr, 16.7%; and Thr/Thr, 0.7%. This agreed with the Hardy–Weinberg equilibrium (χ2 = 0.07; d.f. = 2; p = 0.96) (table). The TFAM 12Thr allele frequency in the group of ath letes was 11.8%, which was significantly higher than 9.1% HUMAN PHYSIOLOGY
Vol. 36
No. 2
2010
ASSOCIATION OF MITOCHONDRIAL TRANSCRIPTION FACTOR
231
Distribution of the absolute and relative frequencies of the TFAM genotypes and alleles in different groups of athletes and the control group Genotypes Group
Sports
n
I
Biathlon Ski races 15–50 km Racewalking Marathon Bicycle roadraces Swimming 5–25 km Triathlon All II Skiing races 5–10 km Boat racing Skate racing 5–10 km Swimming 800–1500 m All III Kayaking Running 800–1500 m Short track Skating 1–3 km Swimming 200–400 m All IV Allround skating Alpine skiing Artistic gymnastics Basketball Boxing Diving Ice hockey Mountain bike Modern pentathlon Shooting sport Ski jumping Football Tennis Wrestling All V Bodybuilding Jumping (athletics) Powerlifting Running 100–400 m Skating 500–1000 m Swimming 50–100 m Throwing, shotput Weightlifting All All athletes Control group
34 78 24 6 109 21 29 301 64 193 4 26 287 35 14 8 9 27 93 68 13 54 33 36 9 16 10 19 44 14 42 29 97 484 73 12 26 122 28 34 17 60 372 1537 1113
* Significant (p < 0.05) difference from the control group. HUMAN PHYSIOLOGY
Vol. 36
No. 2
2010
12Thr allele
Ser/Ser
Ser/Thr
Thr/Thr
%
24 53 16 6 80 17 20 216 52 138 2 24 216 31 9 8 7 19 74 59 12 43 23 31 5 12 8 16 40 12 36 23 68 388 57 11 23 94 21 30 16 47 299 1193 919
9 24 7 0 28 4 8 80 11 52 2 2 67 4 5 0 2 8 19 8 1 11 10 5 3 4 2 3 4 2 5 5 27 90 16 1 2 24 7 4 1 13 68 324 186
1 1 1 0 1 0 1 5 1 3 0 0 4 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 1 1 2 6 0 0 1 4 0 0 0 0 5 20 8
16.2 16.7 18.8 0 13.8 9.5 17.2 15.0 10.2 15.0 25.0 3.8 13.1 5.7 17.9 0 11.1 14.8 10.2 7.4 3.8 10.2 15.2 6.9 27.8 12.5 10.0 7.9 4.5 7.1 8.3 12.1 16.0 10.5 11.0 4.2 7.7 13.1 12.5 5.9 2.9 10.8 10.5 11.8 9.1
p 0.076 0.0029* 0.042* 0.55 0.033* 0.92 0.059
