Association of steroid receptor coactivator AIB1 with estrogen receptor ...

Breast Cancer Research and Treatment 70: 89–101, 2001. © 2001 Kluwer Academic Publishers. Printed in the Netherlands.

Report

α Association of steroid receptor coactivator AIB1 with estrogen receptor-α in breast cancer cells David O. Azorsa, Heather E. Cunliffe, and Paul S. Meltzer Cancer Genetics Branch, National Human Genome Research Institute, The National Institutes of Health, Bethesda, MD, USA

Key words: AIB1, breast cancer, estrogen receptor, transcriptional coactivators

Summary The steroid receptor coactivator AIB1 (amplified in breast cancer-1) is a transcriptional coactivator which has been found to be amplified in breast cancer. We have now investigated the role of the AIB1 protein in breast cancer cell lines. Although detectable levels of AIB1 were present in most cell lines, high levels of AIB1 expression were observed only in the ER-positive cell lines MCF-7 and BT-474 by western blot analysis. Newly developed monoclonal antibodies (mAbs) were used in several assays to show an association between AIB1 and estrogen receptor-α (ER). AIB1 and ER co-localized to the nucleus of ER positive cell lines as shown by immunofluorescence microscopy, and a functional association of native AIB1 and ER in MCF-7 nuclear extracts was shown by EMSA. Recombinant ER also recruited AIB1 protein from nuclear extracts, shown by EMSA and by precipitation of ER-complex proteins bound to a biotinylated-ERE DNA target. Additionally, anti-AIB1 mAbs were able to immunoprecipitate ER from nuclear extracts of chemically cross-linked cells but not from uncross-linked cells. Both immunoprecipitation and oligonucleotide precipitation studies demonstrated the presence of p300 and CBP as part of the ER transcriptional complex. These results suggest that AIB1 and ER do associate physically in ER-positive breast cancer cell lines. We propose that in AIB1 amplified breast cancers, a heightened AIB1/ER association may play a crucial role in the progression of these tumors. Abbreviations: aa: amino acid; ER: estrogen receptor-α; rER: recombinant estrogen receptor-α; ERE: estrogen response element; ELISA: enzyme-linked immunosorbent assay; EMSA: electrophoretic mobility shift assay; HAT: histone acetyltransferase; KLH: keyhole limpet hemacyanin; i.p.: intraperitoneal; i.v.: intravenous; mAb: monoclonal antibody; RT: room temperature

Introduction Gene amplification represents a mechanism by which increases in copy number can result in overexpression of genes that promote tumor growth. In breast cancer, several commonly amplified chromosomal regions have been described which harbor oncogenes known to be involved in disease etiology [1]. We previously used hybrid selection to identify genes in an amplified region at 20q11-q13.2 from breast cancer cells [2]. One gene at 20q12 designated AIB1 (amplified in breast-cancer-1) was amplified in about 10%

of primary tumors. AIB1 is also overexpressed in approximately two-thirds of breast and ovarian cancers [3]. Further analysis of breast tumors showed a correlation between AIB1 amplification and over-expression with both estrogen and progesterone receptor positivity as well as tumor size [4]. The structure of AIB1 showed strong homology to the transcriptional coactivators SRC-1 [5] and TIF2 [6]. AIB1 is also known as ACTR [7], TRAM [8] RAC3 [9], SRC-3 [10] and the mouse ortholog is designated p/CIP [11]. Coactivators in the SRC-1 family are 160 kDa in size and have conserved structural features including

90

DO Azorsa et al.

a hormone receptor binding domain that contains LXXLL motifs, a CBP/p300 interaction domain, basic helix-loop-helix (bHLH) domains, and Per-ArntSim (PAS) domains [reviewed in [12–14]]. A number of studies have shown that these coactivators can potentiate activity from many nuclear receptors including the estrogen receptor-α (ER) [3, 5, 6, 15, 16]. An important mechanism of transcriptional activation by nuclear receptors is histone acetylation. Several groups have reported that CBP, p300, CBPassociated factor (pCAF), SRC-1 and ACTR possess histone acetyltransferase (HAT) activity [7, 17–20]. These studies suggest that liganded nuclear receptors induce transcription from target genes by recruitment of HAT-coactivator complexes, which alter chromatin from a repressed to an activated state. Furthermore, ACTR itself was recently reported to be acetylated by CBP/p300 [21]. This may be required for dissociation of the p160 molecule from the DNA-bound nuclear receptor, thereby downregulating receptor activity. ER is member of the steroid receptor superfamily and functions as a ligand-dependent transcription factor necessary for the growth and differentiation of normal mammary glands and ovaries. The role that ER plays in breast and ovarian cancer has been the subject of intensive investigations. ER status is an important tool in the management of breast cancer since ER-positive tumors are associated with later recurrence, improved patient outcome and a more favorable response to endocrine therapy. All three p160 coactivators possess functional similarities in terms of potential receptor interaction. The important question of functional redundancy between these coactivators therefore remains. Several reports now suggest that there is a distinct division in activity between the coactivators, particularly with respect to AIB1 [11, 22]. It also appears likely that the relative contribution of each coactivator depends on cell/tissue type and the relative intrinsic level of each coactivator. All three p160 coactivators have the ability to bind ER in vitro and co-activate ER-mediated transcription in an estrogen dependent fashion using reporter transfection assays. Importantly, although SRC-1 can enhance estrogen-dependent ER-mediated gene expression, the SRC-1 knockout mouse does not exhibit abnormalities of mammary development [23]. However, AIB1 is overexpressed in a majority of mammary tumors and its expression correlates with ER-positivity [3, 4], suggesting that AIB1 may be the coactivator specifically

involved in breast tumor pathogenesis due to aberrant ER-mediated gene regulation. The functional significance of AIB1 in normal mouse mammary gland has very recently been addressed using targeted deletion of the mouse ortholog [24, 25]. Xu et al., found that the endogenous SRC-3 promoter directs marked gene expression in the mammary epithelium and animals null for SRC-3 demonstrates impaired morphogenesis of the mammary ductal system [24]. This contrasts with the minimal effect of SRC-1 deletion on the mammary gland, and suggests that AIB1 may be a critical steroid receptor coactivator in mammary gland. However, p/CIP knock out mice developed by Wang et al., did not show developmental differences from wild type litter mates [25]. In this report, we examined the association of ER with AIB1 in breast cancer cell lines containing AIB1 amplification. Our results indicate a direct interaction of these transcription factors both in vitro and in vivo. This study is consistent with the hypothesis that AIB1 overexpression provides ER-positive tumors with a selective growth advantage due to aberrant ER signaling.

Materials and methods Materials All products used in cell culture were of tissue culture grade and endotoxin free. Dulbecco’s Modified Eagle Medium (DMEM), NCTC-109 Medium, RPMI-1640 media, fetal bovine serum (FBS), HEPES, 8-Azaguanine, HT supplement, HAT supplement, OPI supplement, PEG-4000, DMSO, and Glutamax II were purchased from Life Technologies (Gaithersburg, MD). Nutridoma-CS was purchased from Boehringer Mannheim (Indianapolis, IN). Cells The breast cancer cell lines MCF-7, BT-20, BT-474, SK-BR-3, MDA-MB-361, MDA-MB-436, MDAMB-453, and MDA-MB-468 were obtained from the ATCC (Rockville, MD). UACC-812 was obtained from the University of Arizona Cancer Center, Tucson, Arizona. HBL-100 was a gift from Dr Fern Murdoch, USUHS, Bethesda, MD. The cell lines were maintained in complete RPMI-1640 (RPMI-1640 media supplemented with 10% FBS, 1 mM L-glutamine and penicillin/streptomycin). The murine myeloma cell line P3x63Ag8.653 was a generous gift from

Association of AIB1 and estrogen receptor-α Dr. James E.K. Hildreth, The Johns Hopkins University School of Medicine, Baltimore, MD. Hybridomas and the myeloma cell line P3x63Ag8.653 were maintained in HY media (DMEM supplemented with 10% FBS, 10% NCTC-109, 10 mM HEPES, 0.2 U/ml insulin, 0.45 mM pyruvate, 1 mM oxaloacetate, and 2 mM Glutamax II). The murine fibroblast cell line NIH-3T3 was a kind gift from Dr. John W. Daly, NIDDK, Bethesda, MD. NIH-3T3 cells were maintained in complete DMEM (DMEM media supplemented with 10% FBS, 1 mM L-glutamine and penicillin/streptomycin). All cells were grown at 37◦C in a humidified 5% CO2 incubator. Antibodies The anti-AIB1 mAbs AX15.1, AC3 and AAP.1 were all developed in this laboratory. AX15.1 is previously described [26]. AC3 and AAP.1 were produced using peptides as immunogens as described below. The antiASC-2 mAb A3C1 developed in this laboratory was previously described [27]. The anti-CD81 mAb Z81 was previously described [28]. Rabbit anti-tubulin IgG was purchased from ICN (Costa Mesa, CA). The antiER mAbs SRA-1000 and SRA-10101 were purchased from StressGen (Victoria, BC). The anti-ER polyclonal antibody HC-20, anti-CBP antibody A-11 and anti-p300 antibody N-19 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG Fc and HRP-goat anti-rabbit H&L were purchased from Jackson Immunoresearch (West Grove, PA). Control mIgG1 protein MOPC-21 was purchased from Sigma (St. Louis, MO). Production of monoclonal antibodies Monoclonal antibodies were prepared as previously described [26, 28] with the following modifications: Peptides corresponding to AIB1 aa 588–602 (NSRDHLSDKESKESS) and aa 1402–1419 (NMNPMPMSGMPMGPDQKY) were synthesized by Genosys (The Woodlands, TX) with an additional cysteine at the N-terminus for coupling. Peptides were coupled to KHL and ovalbumin using a Maleamide conjugation kit (Pierce). Female Balb/c mice (6–8 weeks old) were injected i.p. with 100 µg of KLH conjugated with peptides in Hunter’s adjuvant (Sigma) followed by additional i.p. injections of 100 µg of purified KLH peptide in Hunter’s adjuvant at two weeks intervals. Two weeks after the third injection, one mouse received an i.p. injection of 75 µg of purified KLH

91

peptide in PBS and i.v. injections of 30 µg of purified KLH peptide in PBS for three consecutive days. A day later, the spleen of the mouse was removed and fused with the myeloma cell line P3x63Ag8.653 as previously described using 50% PEG with 5% DMSO [26]. Fused cells were resuspended in HY media supplemented with 20% FBS, HAT, and Nutridoma-CS and seeded in eight flat bottom 96-well plates. Hybridoma colonies were screened for secretion of mAbs that bound to ovalbumin-coupled peptide by ELISA and by western blot analysis as previously described [29]. Hybridomas secreting mAbs of interest were subcloned twice by limiting dilution. Final hybridoma clones were isotyped using an isotyping kit (Boehringer Mannheim). Tissue culture supernatants from the final clones were collected, treated with 0.02% sodium azide, and stored at 4◦ C. Western blot analysis Detergent lysates of cell lines were prepared by lysis with RIPA buffer (50 mM Tris–HCl pH 7.5, 5 mM EDTA, 150 mM NaCl containing 1% NP-40, 0.5% deoxycholate, 0.1% SDS) with 1X complete protease inhibitor cocktail (Boehringer Mannheim). Lysate containing 60 µg of total protein was diluted in 2X non-reducing sample buffer and proteins were separated by SDS-PAGE. Proteins were transferred to Immobilon-P nylon membrane (Millipore, Bedford, MA) and blocked with 5% non-fat milk in PBS for 18 h at 4◦ C. Membranes were washed 3X in PBS-T (PBS containing 0.1% Tween-20) and incubated for 1 h at RT with primary antibodies in 1% casein. After washing 3X with PBS-T, membranes were incubated with a 1 : 20000 dilution of HRP-goat anti-mouse Fc or HRP-goat anti-rabbit in 5% milk for 1 h at RT. The membranes were washed 3X with PBS-T prior to protein detection using ECL chemiluminescent substrate (Amersham, Arlington Heights, IL) and exposed to autoradiography film (Hyperfilm-ECL, Amersham). Membranes were stripped of bound IgG by incubating in 62.5 mM Tris–HCl pH 7.5, 2% SDS, 100 mM 2-mercaptoethanol for 30 min at 65◦ C. Stripped membranes were washed in PBS and blocked with 5% non-fat dried milk prior to being probed with another antibody. Immunoprecipitations Full length AIB1 protein was labeled with 35 Smethionine using rabbit reticulocyte lysate (Promega, Madison WI) to in vitro-transcribe/translate from a

92

DO Azorsa et al.

pBluescript plasmid containing the AIB1 coding region. A dilution of the in vitro-translated product was incubated with the mAbs and immunoprecipitated with the addition of rabbit anti-mouse IgG and Protein G-Agarose (Life Technologies). Pellets were washed 5X with TEN (50 mM Tris-HCl pH 7.5, 5 mM EDTA, 150 mM NaCl, 1% NP-40) lysis buffer, separated by SDS-PAGE, dried and exposed to autoradiography film. Transfection of NIH-3T3 cells The vectors pFLAG-CMV-2 and pFLAG-CMV-2BAP were a generous gift from Dr. Colin Duckett, NCI, Bethesda, MD. A BamHI/NheI fragment was generated from pBluescript II-SK+ AIB1, which contains the AIB1 cDNA and ligated to a BglII/XbaI fragment of pFLAG-CMV-2. The resulting plasmid pFLAG-AIB1 has a substitution of the first nine amino acids of AIB1 with the FLAG sequence. Transfectionquality plasmid preparations were generated using QIAgen Maxi-prep kit (Valencia, CA). NIH-3T3 cells were grown to 50–60% confluency and transfected with 1.0 µg of either pFLAG-CMV-2-BAP or pFLAGAIB1 plasmid using Lipofectamine (Life Technologies) as per manufacturer’s instructions. Cells were incubated for 18 h, washed and fixed with 2% paraformaldehyde and permeablized and blocked with 1% BSA/0.1% Triton X-100. Cells were incubated with either anti-FLAG mAb M1 (Sigma) or mAb AAP.1 for 1 h at RT. After washing, cells were incubated with 10 µg/ml FITC-goat anti-mouse IgG, Fc (Jackson Immunoresearch) for 1 h at RT. After final washing, DAPI mounting media (Vector Laboratories, Burlingame, CA) and coverslips were added and slides were viewed using a Zeiss Axiophot fluorescent microscope (Thornwood, NY). Fluorescence microscopy Adherent cells were grown on chamber slides (Nunc, Naperville, IL) to 70% confluency. Cells were fixed with 4% paraformaldehyde, permeablized with 1 : 1 methanol/acetone and blocked with 5% normal goat serum/1% casein/0.5% BSA/0.1% Triton X-100. Cells were incubated with hybridoma culture supernatant for 1 h at RT. After washing with PBS, the cells were incubated with 2 µg/ml Rhodamine-conjugated goat anti-mouse IgG and 2 µg/ml FITC-conjugated goat anti-rabbit IgG (Jackson Immunoresearch) for 1 h at RT. After a final wash, DAPI mounting media and

coverslips were added and slides were analyzed using a fluorescent microscope (Zeiss Axiophot). Electrophoretic mobility shift assay (EMSA) Nuclear extract was prepared from freshly harvested MCF-7 or MDA-MB-436 cells according to the method of Dignam et al. [30] and subjected to EMSA using a double-stranded ERE probe (5 TAATAGGTCACAGTGACCTGATTCC) from Geneka Biotechnology (Montreal, Quebec). Probe DNA was 32 P-end labeled and purified using a Micro BioSpin column (Bio-Rad, Hercules, CA). Labeled ERE (0.5 ng; approximately 20,000 cpm/µl) was premixed in 10 mM HEPES pH 7.9, 10% Glycerol, 1 mM DTT, 0.1 µg/µl poly(dI-dC) • poly(dI-dC), 0.5µg/µl BSA (total of 10 µl per reaction). Ten µg of MCF-7 or 7 µg of MDA-MB-436 nuclear extract was premixed in 1X binding buffer (10 mM HEPES pH 7.9, 50 mM KCl, 10 mM CaCl2 , 10 mM EDTA) and incubated for 15 min at RT. Where indicated, 1.0 pmol of recombinant human ERα (rER) (PanVera) was included in this incubation. Ten µl of probe premix was added to 10 µl of protein premix and incubated a further 25 min. For competition assays, 50X excess cold wild type or mutant ERE (5 -TAATACCGCACAGTGAAATGATTCC) was included in the nuclear extract premix. Similarly for supershifts, 1.0 µg of specific or control antibody was included in the protein premix. Samples were size separated by electrophoresis in 4% polyacrylamide gels containing 2.5% glycerol and 0.25X TBE. ERE-oligonucleotide precipitation of ER-complexed proteins Oligonucleotide precipitation was conducted similarly to a method described by Blanco et al. [31]. Wild type (5 -GATCTCGAGTCAGGTCACAGTGACCTGA) and mutant (5 -GATCTCGAGTCACCGCACAGTGAAATGA) ERE consensus oligonucleotides were purchased from Genosys with sense strands 5 biotinylated. Complementary oligonucleotides were annealed and conjugated to streptavidin-coated magnetic porous glass particles (MPG-streptavidin) from CPG Inc. (Lincoln Park, NJ). One mg (100 µl) of resuspended MPG-streptavidin was separated using a magnetic particle separator and washed 3X with 100 µl 1 M KCl. Biotinylated ERE or mutant ERE (800 pmoles) was diluted 10 fold in 1 M KCl and added to the MPG-streptavidin pellet. After 5 min incubation with

Association of AIB1 and estrogen receptor-α frequent mixing, the ERE-bound MPG streptavidin particles were magnetically recovered, washed 3X in 100 µl 2 M NaCl, and resuspended in 100 µl TE buffer. Confirmation that 95–100% of ERE had bound to MPG-streptavidin was determined via EtBr dot quantitation assay. ERE (100 pmoles) was premixed in HGEKC buffer (20 mM HEPES pH 7.9, 10% glycerol, 0.5 mM EDTA, 50 mM KCl, 10 mM CaCl2 ) containing 1 mM DTT, 0.5 mg/ml BSA, 0.5 mg/ml poly(di-dC) • poly(dI-dC) in a total volume of 200 µl. In a separate tube, 500 µg of nuclear extract and 20 pmoles of rER were premixed in 1X HGEKC buffer containing 20 pmoles of 17-β-estradiol and 1X complete protease inhibitor (Boehringer Mannheim), in a final volume of 200 µl. After 15 min preincubation, the ERE and protein samples were combined, and mixed for 15 min at RT. ERE-bound proteins were separated magnetically, washed 3X with 100 µl of 1X HGEKC and eluted with 0.5 M KCl, or solubilized with SDS-PAGE sample buffer for western blot analysis.

Coprecipitation of AIB1 and ER Cells were grown in growth media to 70% confluency, washed twice with PBS and treated with 1 mM DSP [Dithiobis(succinimidylpropionate)] (Pierce, Rockford, IL) for 30 min at 4◦ C. Crosslinking was quenched by the addition of Tris–HCl to a final concentration of 100 mM and incubation for 15 min at 4◦ C. Cells were washed in PBS, scraped, and pelleted by centrifugation. Nuclear extracts from the cell pellets were prepared using NE-PER (Pierce) and precleared using 100 µl of Pansorbin cells (Calbiochem, La Jolla, CA). Approximately 200 µg of nuclear extract was added to 5 µg of mAb bound to 25 µl goat-anti-mouse IgG-Agarose (Sigma) and incubated for 18 h at 4◦ C. Agarose pellets were washed 2X with RIPA buffer containing 2 M KCl then 2X with RIPA buffer. Bound cross-linked protein complexes were released by adding PAGE sample buffer and boiling for 3 min. Proteins were separated by SDS-PAGE and transferred to nylon for western blot analysis. Detection of AIB1 was facilitated by blocking the membrane with Superblock reagent (Pierce), incubation with 1 µg/ml of biotinylated-AC3 for 1 h, and incubation with HRP-streptavidin (1 : 50000 dilution) for detection. Biotinylation of AC3 was conducted using NHS-LC-biotin (Pierce) as previously described [29].

93

Results Characterization of anti-AIB1 peptide monoclonal antibodies MAbs produced against AIB1 peptides were screened for recognition of AIB1 by ELISA and western blot analysis as done for anti-AIB1 mAb AX15.1 [26]. One mAb recognizing AIB1 peptide NSRDHLSDKESKESS (aa 588–602) was characterized and designated AAP.1. Another mAb recognizing AIB1 peptide NMNPMPMSGMPMGPDQKY (aa 1402–1419) was characterized and designated AC3. Both AAP.1 and AC3 are of the IgG1 isotype and were specific for only their respected peptide sequences by ELISA (data not shown). The peptide sequences were in regions that shared less than 30% sequence identity with SRC-1 and TIF-2. MAbs AAP.1 and AC3 immunoprecipitated the 160 kDa AIB1 band similar to the previously described anti-AIB1 mAb AX15.1 [26] (Figure 1(A)). A panel of anti-AIB1 mAbs was tested for immunoreactivity to fixed cells for immunofluorescent detection. AAP.1 and AC3 were the only mAbs able to recognize AIB1 in this assay. NIH-3T3 cells were transfected with expression plasmids for FLAGtagged bacterial alkaline phosphatase (pFLAG-CMVBAP) or FLAG-tagged AIB1. Detection of expressed proteins using the anti-FLAG mAb M1 indicated a cytoplasmic localization for BAP and a nuclear localization of AIB1. The mAb AAP.1 also recognized FLAG-tagged AIB1 similar to the anti-FLAG mAb, but did not recognize endogenous AIB1 from NIH3T3 cells or FLAG-BAP (Figure 1(B)). Of interest, transfected AIB1 appeared to be concentrated in a nuclear dot pattern. Similar results were seen using mAb AC3. Overexpression of AIB1 protein in breast cancer cell lines Expression of ER and coactivators AIB1 and SRC-1 in breast cancer cell lines was examined by western blot analysis (Figure 2). In a panel of 11 breast cancer cell lines, those which contained the AIB1 gene amplification (BT-474 and MCF-7), also overexpressed AIB1 protein. The AIB1/tubulin densitometry ratio of these two cell lines was 1.10 and 0.86 respectively, almost three-fold the average of the ratios from non-AIB1 amplicon containing cell lines (average AIB1/tubulin ratio = 0.36). The AIB1 amplicon

94

DO Azorsa et al.

Figure 1. Recognition of AIB1 by anti-AIB1 mAbs. (A) MAbs AC3 and AAP.1 recognize AIB1. AIB1 was in vitro-translated from a full length AIB1 cDNA in pBluescript II SK+ and labeled with 35 S-methionine as described in materials and methods. Reaction mixture containing 3 × 106 cpm of labeled-AIB1 was incubated with control IgG MOPC-21 or anti-AIB1 mAbs AX15.1, AAP.1 and AC3. The resulting immune complexes were precipitated with rabbit anti-mouse IgG (H&L), and Protein-G-Sepharose, separated by SDS-PAGE, and detected by autoradiography. (B) MAb AC3 localizes AIB1 to the nucleus. NIH-3T3 cells were grown on chamber slides and transfected with 1 µg of pFLAG-CMV-BAP or pFLAG-AIB1. The cells were allowed to grow for 24 h and fixed with paraformaldehyde as describe in materials and methods. Cells were incubated with either 1.0 µg/ml anti-FLAG mAb M1 or anti-AIB1 mouse monoclonal AAP.1. Bound antibodies were detected using FITC-goat anti-rabbit IgG. DAPI was used to stain the nucleus.

containing cells expressed lower amounts of SRC1 (average SRC-1/tubulin ratio = 0.07) when compared to non-AIB1 amplicon containing cells (average SRC-1/tubulin ratio = 0.72). The AIB1 amplicon containing cell lines also expressed high levels of ER (ER/tubulin ratios = 0.57 and 1.38) compared to non-

AIB1 amplicon containing cells (average ER/tubulin ratio = 0.13). Of the cell lines not containing the AIB1 amplicon, only T-47D had high expression of ER (ER/tubulin ratio = 1.03). Low ER expression can be seen in the UACC-812 cell line, which was previously reported to be ER-negative [32], and very low

Association of AIB1 and estrogen receptor-α

Figure 2. Expression of ER and coactivators in breast cancer cell lines. Samples from lysates containing 60 µg of proteins from breast cancer cell lines were separated on a 7.5% SDS-PAGE gel and transferred to nylon membranes. The panel of cells included breast cancer cell lines BT-474 and MCF-7 that contain AIB1 gene amplifications. The membranes were incubated with primary antibodies as noted and a horseradish-peroxidase secondary antibody. Detection was achieved using a chemiluminscent substrate.

amounts were seen in the BT-20 cell line only after very long exposures (data not shown). Expression of coactivators p300 and CBP was also examined in the panel of breast cancer cell lines. High levels of one or both of these proteins were detected in all cell lines that expressed ER. These results are consistent with our previous observation that cells with AIB1 mRNA overexpression, due to AIB1 gene amplification, show strong concomitant ER expression. Co-localization of AIB1 and estrogen receptor-α To investigate whether AIB1 and ER associated in breast cancer cells, we used antibodies to show that both localize to the nucleus. Cell lines BT-474 and MCF-7, which have AIB1 gene amplification, were treated with mouse anti-AIB1 mAb AAP.1 and rabbit anti-ER antibody HC-20 (Figure 3). Both antibodies showed highly specific staining and indicate both AIB1 and ER were localized to the nucleus. The ER-negative cell line MDA-MB-436 also showed significant AIB1 staining. Association of AIB1 and ER by EMSA and oligo-precipitation Direct association of AIB1 and ER was shown using the electrophoretic mobility shift assay (EMSA) and

95

by oligo-precipitation of an ER complex (Figure 4). Nuclear extracts from two breast cancer cell lines, MDA-MB-436 (ER-negative) and MCF-7 (ER-positive) were prepared. To demonstrate ER-specific binding to ERE target DNA by EMSA we used both human recombinant ER (rER) and endogenous ER from nuclear extracts. Figure 4(A) lane 1 shows purified rER binds poorly to the ERE probe, however in the presence of nuclear extract from the ER-negative cell line MDA-MB-436, a strong complex forms (Figure 4(A) lane 3). This observation is consistent with a previous report [33]. A lower molecular weight non-specific ERE-bound complex was also detected. This complex does not contain ER as it forms with MDA-MB-436 nuclear extract alone (Figure 4(A), lane 2). Three different ER-specific antibodies were used to supershift the larger complex (Figure 4(A), lanes 4–6) confirming the ER : ERE association. A weak supershifted band was observed using an AIB1-specific mAb, but not using a control IgG antibody of the same isotype (Figure 4(A), lanes 7, 8 respectively). This result suggests rER recruits AIB1 protein from MDA-MB-436 nuclear extract during assembly on the ERE. We propose that the weak AIB1 supershift may be in part, explained by the minimal level of AIB1 protein expressed in MDA-MB-436 cells. To detect a stronger ER:AIB1 association by supershift assay, we repeated the experiment using nuclear extract from MCF-7 cells which strongly express ER and AIB1. The upper mobility shift in Figure 4(B) lane 3 suggested we can detect binding of endogenous ER with ERE. However, we had difficulty demonstrating the presence of ER in this complex by supershift assay (shown later in Figure 4(C)). This observation indicated either that this complex cannot be recognized by the ER-specific antibody in the supershift assay, or that the majority of the protein in this band shift is not ER. The latter is consistent with previous reports that numerous protein species can recognize and compete for ERE-motif binding [34, 35]. By comparing Figure 4(B) lanes 3 and 4, addition of rER to MCF-7 nuclear extract appears to efficiently drive formation of an ERE-bound complex of slightly higher molecular weight. An ERspecific antibody readily supershifted this complex (Figure 4(B) lane 5) confirming it to be ER-specific. Importantly, a strong AIB1-specific supershift was also observed from this complex (Figure 4(B) lane 6), suggesting AIB1 has been recruited to the rER : ERE complex during assembly. No supershifted product was observed using the control IgG antibody in several replicate experiments (data not shown). To address our

96

DO Azorsa et al.

Figure 3. Co-localization of AIB1 and ER in AIB1 gene amplified cell lines. ER-positive cell lines containing AIB1 amplification (BT-474 and MCF-7) and the ER-negative cell line MDA-MB-436 were grown on chamber slides and fixed with paraformaldehyde as describe in materials and methods. Cells were incubated with anti-AIB1 mouse monoclonal AAP.1 and rabbit polyclonal anti-ER antibody HC-20. FITC-goat anti-rabbit and rhodamine-goat anti-mouse IgG were used for detection of bound antibodies. DAPI was used to stain the nucleus. Both AIB1 and ER localized to the nucleus of AIB1 amplified cells, while only AIB1 was detected in MDA-MB-436 cells.

consistent observations suggesting that, though difficult to detect, endogenous ER from MCF-7 nuclear extract could form an ERE-ER complex in this assay, we repeated our EMSA supershift assays using excess nuclear extract without rER (Figure 4(C)). In this assay, lane 2 is the same as Figure 4(B) lane 3, although the gel has been deliberately over-exposed. The two band shifts in Figure 4(C) lane 2 were competed away using wild type ERE (Figure 4(C), lane 3). The lower non-specific band, plus some of the upper band was competed using mutant ERE (Figure 4(C), lane 4), indicating that any complexed ER is most likely to be present in the upper band. Accordingly, Figure 4, lanes 5 and 6 show that a proportion of this product can be supershifted with two ER-specific antibodies. The reason for the relatively weak supershift cannot be determined from this experiment, although it is most likely due to the presence of other proteins which bind to the ERE. Importantly, we observed an AIB1 supershift from the ERE-bound proteins (Figure 4(C), lane

7), suggesting an endogenous ER : AIB1 association in MCF-7 cells. Incubation of ERE probe alone with AIB1 or ER-specific antibodies produced no mobility shifts (data not shown). To validate and extend our observation that addition of purified ER to nuclear extracts appears to preferentially drive formation of ERE : ER complex (compare lanes 3 and 4 in Figure 4(B)), we have developed a larger scale assay to precipitate this complex. The same ratio of recombinant ER and MCF7 nuclear extract used for EMSA was incubated in the presence of biotin-labeled wild-type or mutant ERE-target DNA. ERE-bound proteins were precipitated using streptavidin-coated magnetic particles and eluates were subjected to western blot analyses (Figure 4(D)). We assayed the complex proteins bound to the biotinylated ERE for ER, AIB1, p300 and CBP and observed all of these proteins in the bound fraction. In these experiments, the binding reaction mixtures containing wild-type ERE probe quantitatively depleted


97

Figure 4. Involvement of AIB1 in ER : ERE association by electrophoretic mobility shift assay. Nuclear extracts from the breast cancer cell lines MDA-MB-436 and MCF-7 were prepared and analyzed by EMSA using 32 P-labeled ERE as described in the materials and methods. (A) EMSA using MDA-MB-436 nuclear extract. Recombinant human ER (rER) was incubated with ERE alone (lane 1), or with nuclear extract and ERE (lanes 3–8). Arrowhead indicates the weak rER mobility shift in lane 1. A non specific mobility shift, not related to ER is indicated (n.sp). The presence of ER and AIB1 in the ER : ERE complex indicated was confirmed by inclusion of specific antibodies in supershift assays. ER polyclonal was HC-20, anti-ER mAb1 was SRA-1000, mAb2 was SRA-1010. Anti-AIB1 mAb was AC3. Control IgG1 mAb is MOPC-21. (B) Similar experiment as described in (A), using MCF-7 nuclear extract. (C) EMSA using MCF-7 nuclear extract without additional rER. An ER-specific protein complex (lane 2, upper band) was identified using excess competition wild type and mutant ERE oligonucleotides (lanes 3 and 4 respectively). The presence of ER (lane 5 and 6) and AIB1 (lane 7) in this complex was confirmed by supershift assays. Antibodies used are as described in (A). (D) Oligoprecipitation of an ER complex containing AIB1, p300 and CBP. Biotinylated ERE was incubated with rER and nuclear extract from MCF-7 cells. Bound proteins were precipitated by adding streptavidin-coated magnetic porous glass particles (MPG-streptavidin). Eluted proteins were analyzed by western blot analysis and shown to contain AIB1, p300 and CBP. Fifteen µg of input nuclear extract loaded as control. The amount of eluate electrophoresed for detection with each antibody was 10% for ER, 35% for AIB1 and 50% for CBP and p300.

98

DO Azorsa et al.

ER and substantially depleted AIB1 from the nuclear extract. In contrast, a smaller proportion of CBP/p300 was bound. This is consistent with a report that the p160-CBP/p300 interaction is relatively weak [36], or that the precipitated protein complex is fragile during the wash steps prior to elution. No proteins were detected in the eluate from the mutant ERE probe (data not shown). We were unable to precipitate an ERE : ER complex from MCF-7 nuclear extract in the absence of rER, which appears to be consistent with the EMSA data. Association of AIB1 and ER in breast cancer cell lines by cross-linking and immunoprecipitation Association of AIB1 with ER was confirmed using immunoprecipitation of DSP [Dithiobis(succinimidylpropionate)]-cross-linked proteins. Immunoprecipitation of AIB1 and ER from nuclear extracts of untreated T-47D cells (Figure 5(A)) or DSP-cross-linked T-47D cells (Figure 5(B)) showed direct association of ER with AIB1. AIB1 protein was immunoprecipitated by the anti-AIB1 mAbs AAP.1 and AC3 from both extracts, and it was also immunoprecipitated by anti-ER mAb from DSP-cross-linked extract. Likewise, ER was immunoprecipitated by anti-ER mAb from both extracts and by anti-AIB1 mAbs from DSP-crosslinked extract. Similar results were seen using extract from MCF-7 cells (data not shown). Taken together, these results show that AIB1 does interact directly with ER in vivo. To confirm an association of additional proteins with the AIB1-ER complex, we performed immunoprecipitations by anti-AIB1 mAbs of crosslinked proteins from the MCF-7 cell line (Figure 5(C)). AIB1 and ER were immunoprecipitated by anti-AIB1 mAbs but not control antibodies. The coactivators p300 and CBP were also immunoprecipitated by antiAIB1 mAbs but not control mAb confirming the oligo precipitation results.

Discussion The results of this study demonstrate that ER physically associates with the steroid receptor coactivator AIB1 in breast cancer cell lines and that both are part of a complex that involves p300 and CBP. The functional significance of this association is highlighted by our observation that AIB1 gene amplification and protein overexpression correlates with ER expression

Figure 5. AIB1 and ER are physically associated and part of a complex that includes p300 and CBP in breast cancer cell lines. The breast cancer cell line T-47D was grown to 75% confluency and proteins were either left untreated (A) or chemically cross-linked using 1 mM DSP [Dithiobis(succinimidylpropionate)] in PBS (B). Nuclear extracts were prepared from the DSP treated and untreated cells and incubated with anti-AIB1 mAbs AC3 and AAP1, anti-ER mAb SRA-1010, anti-ASC2 mAb A3C1 or control mAb MOPC-21. Immune complexes were precipitated and subjected to standard western blot procedures using 1.0 µg/ml biotinylated-AC3 (anti- AIB1) and anti-ER. Membranes were stripped and reprobed with anti-p300 and anti-CBP as previously described. (C) Association of ER with AIB1 was shown using cross-linking and immunoprecipitation. The breast cancer cell line MCF-7 was grown to 75% confluency and proteins were chemically cross-linked using 1 mM DSP in PBS. Nuclear extract was prepared from the cross-linked cells and immunoprecipitated with anti-AIB1 mAbs AC3 and AAP1 or control anti-CD81 mAb Z81.1. Immune complexes were precipitated and analyzed as described in methods.

in breast cancer cells. Our results, together with previous reports that AIB1 enhances ER-mediated gene expression [3], and that AIB1 amplification and overexpression correlates with ER status in breast cancer [4, 37–39], strongly suggest that AIB1 amplification plays a crucial role in the progression of a subset of ER-positive tumors. To study the interaction of AIB1 and ER, it was necessary to develop novel AIB1-specific mAbs that were immunoreactive in a wide variety of experiments. Two such antibodies were developed and proved invaluable to this study. First, mAb AAP.1 demonstrated highly specific immunofluorescent staining of endogenous and transfected AIB1 in fixed cells, allowing us to confirm nuclear localization of AIB1. Second, mAb AC3 proved useful in demonstrating a functional association of AIB1 in an ER : ERE complex by EMSA. AC3 also efficiently immunoprecipitated endogenous AIB1, ER and CBP/p300, confirming interactions between these proteins.

Association of AIB1 and estrogen receptor-α It is widely accepted that estrogen dependent transcription involves p160 coactivators. In particular, interactions between ER and p160 proteins have been demonstrated using GST-fusion proteins and yeast two hybrid systems, which showed that ER has the potential to interact with each of the p160 coactivators [3, 8, 11]. In addition, coactivators have been shown to increase transcription of ER-responsive reporter genes [3, 5, 6, 10, 15, 16]. The data presented in this study describes a direct interaction between endogenous ER with the endogenous p160 coactivator AIB1. Importantly, it remains to be established if ER associates preferentially with AIB1, or whether the other p160 coactivators also interact with ER in cells that coexpress more than one of these molecules. The existence of three p160 coactivators with distinct patterns of tissue specific expression and their distinct activities with respect to various nuclear receptors creates a complex and nuanced system modulating the response of a tissue to steroid hormones. The tissue specific functions of coactivators are being clarified by studies of targeted deletions in mice [23–25]. The strong mammary phenotype of the SRC-3 (AIB1) null mutation and the activity of the SRC-3 promoter in mouse mammary epithelium seen by Xu et al., are consistent with our observations of AIB1 amplification in breast cancer. The nature of the association of steroid receptors with coactivators has also been the subject of many studies. A recent report by Tikkanen et al., has shown that endogenous AIB1 and ER interact in MCF-7 cells [40]. The AIB1-ER interaction was ligand dependent and partially inhibited by tamoxifen. Also, an ER-SRC-1 complex was not detected. Our results confirm the AIB1-ER interaction in MCF-7 cells which contain the AIB1 amplicon, but we also show an AIB1-ER interaction in T47-D cells which do not contain the amplicon. At the biochemical level, several other reports support specificity in coactivator activity [11, 22]. Crystallographic study of the coactivator GRIP1 (the murine ortholog of TIF-2) complexed with ER shows that a short α-helix of GRIP1 binds to a hydrophobic groove in the AF-2 domain of ER [41]. This groove can be selectively occupied by the antagonist 4-hydroxytamoxifen. Although, ligandedsteroid receptors associate with coactivators via the AF-2 transactivation domain, the AF-1 domain has also been shown to associate with p160 coactivators [42, 43]. This suggests that in the presence of excess AIB1, the weak transactivating properties of the AF-1 domain might mediate ligand independent transcrip-

99

tion. Another study which addressed the specificity of SRC-3 (AIB1) with respect to either ER or ER-β reported that SRC-3 can specifically enhance ligand dependent transactivation by ER and not ER-β [10]. Furthermore, association studies showed that SRC-3 had a much higher affinity for ER than for ER-β. A recent study by Tai and coworkers, shows that stable overexpression of SRC-1 in the ER-positive breast cancer cell line MCF-7 potentiated cell growth due to increased transcriptional activation of endogenous estrogen-responsive genes [44]. Although this indicates that SRC-1 overexpression can stimulate ERmediated signaling, this result does not address the issue of physiologically relevant coactivator-ER specificity. Using semi-quantitative reverse transcriptionPCR in normal mammary tissue, primary tumors and breast cancer cell lines, Berns et al., showed that the expression of SRC-1 did not correlate with ER expression [45]. Interestingly, they found the highest levels of SRC-1 in normal tissue and lowest in the breast cancer cell lines. Thus, Shim et al., used immunocytochemistry to show that in the rat mammary epithelium, SRC-1 and ER were primarily segregated in distinct subsets of cells, while in the stroma, SRC-1 and ER were only occasionally seen in the same cell type [46]. More recently, Stenoien, et al., showed that transfected CFP-ER and GFP-SRC-1 do co-localize to the same nuclear matrix foci in response to estrogen but not estrogen antagonists [47]. However, the system used does require an artificial introduction by transfection of both ER and SRC-1, which might result in local increased concentrations of the steroid receptor and coactivator. We observed large dot-like structures in our transfection studies with FLAG-tagged AIB1. Whether these structures are physiologically relevant or a result of transfection with expression vectors remains indeterminate. We propose that in breast tumors containing amplification of 20q12, AIB1 is overexpressed and functions to potentiate cell growth. Its overabundance and association with ER would allow it to act as the primary coactivator in ER-mediated transcription. The role for AIB1 in cells containing amplification of this gene could be more complex and might involve AIB1 interacting with other steroid receptors such as progesterone receptor. Additionally, there is evidence that p160 coactivators may act on non-nuclear receptor pathways including NF-kappaB, CREB, and AP-1, potentially broadening the effects of AIB1 overexpression [11, 48, 49]. It will be of interest to determine whether endogenous AIB1 does interact with other

100

DO Azorsa et al.

nuclear receptors or unrelated transcription factors in these cells. These issues will need to be resolved to fully understand the selective pressures favoring clonal expansion of clones bearing AIB1 amplification during tumor progression. Acknowledgements We thank John Lueders (Cancer Genetics Branch, NHGRI, Bethesda, MD) for his technical assistance with the cell lines. We are very grateful to Richard Jove (Department of Biochemistry and Molecular Biology, University of South Florida College of Medicine, Tampa, FL) for his helpful direction in establishing the electrophoretic mobility shift assay. We would also like to thank Fern Murdoch, Department of Pathology and Laboratory Medicine, University of Wisconsin, Madison, WI for her helpful discussion.

References 1. Devilee P, Schuuring E, van de Vijver MJ, Cornelisse CJ: Recent developments in the molecular genetic understanding of breast cancer. Crit Rev Oncog 5: 247–270, 1994 2. Guan XY, Xu J, Anzick SL, Zhang H, Trent JM, Meltzer PS: Hybrid selection of transcribed sequences from microdissected DNA: isolation of genes within amplified region at 20q11-q13.2 in breast cancer. Cancer Res 56: 3446–3450, 1996 3. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS: AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277: 965–968, 1997 4. Bautista S, Valles H, Walker RL, Anzick S, Zeillinger R, Meltzer P, Theillet C: In breast cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with estrogen and progesterone receptor positivity. Clin Cancer Res 4: 2925–2929, 1998 5. Onate SA, Tsai SY, Tsai MJ, O’Malley BW: Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270: 1354–1357, 1995 6. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H: TIF2, a 160 kDa transcriptional mediator for the liganddependent activation function AF-2 of nuclear receptors. Embo J 15: 3667–3675, 1996 7. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM: Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90: 569–580, 1997 8. Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW: TRAM-1, A novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272: 27629–27634, 1997 9. Li H, Gomes PJ, Chen JD: RAC3, a steroid/nuclear receptorassociated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94: 8479–8484, 1997

10. Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR, Frail DE: A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J Biol Chem 273: 27645–27653, 1998 11. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG: The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387: 677–684, 1997 12. Leo C, Chen JD: The SRC family of nuclear receptor coactivators. Gene 245: 1–11, 2000 13. McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, O’Malley BW: Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Mol Biol 69: 3–12, 1999 14. Glass CK, Rosenfeld MG: The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14: 121–141, 2000 15. Kalkhoven E, Valentine JE, Heery DM, Parker MG: Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. Embo J 17: 232–243, 1998 16. Hong H, Kohli K, Garabedian MJ, Stallcup MR: GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17: 2735–2744, 1997 17. Bannister AJ, Kouzarides T: The CBP co-activator is a histone acetyltransferase. Nature 384: 641–643, 1996 18. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y: The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87: 953–959, 1996 19. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y: A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382: 319–324, 1996 20. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW: Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389: 194–198, 1997 21. Chen H, Lin RJ, Xie W, Wilpitz D, Evans RM: Regulation of hormone-induced histone hyperacetylation and gene activation via acetylation of an acetylase. Cell 98: 675–686, 1999 22. Li H, Chen JD: The receptor-associated coactivator 3 activates transcription through CREB-binding protein recruitment and autoregulation. J Biol Chem 273: 5948–5954, 1998 23. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW: Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279: 1922–1925, 1998 24. Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, O’Malley BW: The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc Natl Acad Sci USA 97: 6379–6384, 2000 25. Wang Z, Rose DW, Hermanson O, Liu F, Herman T, Wu W, Szeto D, Gleiberman A, Krones A, Pratt K, Rosenfeld R, Glass CK, Rosenfeld MG: Regulation of somatic growth by the p160 coactivator p/CIP. Proc Natl Acad Sci USA 97: 13549–13554, 2000 26. Azorsa DO, Meltzer PS: Production and characterization of monoclonal antibodies to the steroid receptor coactivator AIB1. Hybridoma 18: 281–287, 1999 27. Lee SK, Anzick SL, Choi JE, Bubendorf L, Guan XY, Jung YK, Kallioniemi OP, Kononen J, Trent JM, Azorsa D, Jhun


28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

BH, Cheong JH, Lee YC, Meltzer PS, Lee JW: A nuclear factor, ASC-2, as a cancer-amplified transcriptional coactivator essential for ligand-dependent transactivation by nuclear receptors in vivo. J Biol Chem 274: 34283–34293, 1999 Azorsa DO, Moog S, Cazenave JP, Lanza F: A general approach to the generation of monoclonal antibodies against members of the tetraspanin superfamily using recombinant GST fusion proteins. J Immunol Meth 229: 35–48, 1999 Azorsa DO, Moog S, Ravanat C, Schuhler S, Follea G, Cazenave JP, Lanza F: Measurement of GPV released by activated platelets using a sensitive immunocapture ELISA–its use to follow platelet storage in transfusion. Thromb Haemost 81: 131–138, 1999 Dignam JD, Lebovitz RM, Roeder RG: Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489, 1983 Blanco JC, Minucci S, Lu J, Yang XJ, Walker KK, Chen H, Evans RM, Nakatani Y, Ozato K: The histone acetylase PCAF is a nuclear receptor coactivator. Genes Dev 12: 1638–1651, 1998 Meltzer P, Leibovitz A, Dalton W, Villar H, Kute T, Davis J, Nagle R, Trent J: Establishment of two new cell lines derived from human breast carcinomas with HER-2/neu amplification. Br J Cancer 63: 727–735, 1991 Biswas DK, Reddy PV, Pickard M, Makkad B, Pettit N, Pardee AB: Calmodulin is essential for estrogen receptor interaction with its motif and activation of responsive promoter. J Biol Chem 273: 33817–33824, 1998 Klinge CM, Bowers JL, Kulakosky PC, Kamboj KK, Swanson HI: The aryl hydrocarbon receptor (AHR)/AHR nuclear translocator (ARNT) heterodimer interacts with naturally occurring estrogen response elements. Mol Cell Endocrinol 157: 105–119, 1999 Gray WG, Gorski J: Identification and characterization of an estrogen-responsive element binding protein repressed by estradiol. Biochemistry 35: 11685–11692, 1996 McKenna NJ, Nawaz Z, Tsai SY, Tsai MJ, O’Malley BW: Distinct steady-state nuclear receptor coregulator complexes exist in vivo. Proc Natl Acad Sci USA 95: 11697–11702, 1998 Tanner MM, Grenman S, Koul A, Johannsson O, Meltzer P, Pejovic T, Borg A, Isola JJ: Frequent amplification of chromosomal region 20q12-q13 in ovarian cancer. Clin Cancer Res 6: 1833–1839, 2000 Thenot S, Charpin M, Bonnet S, Cavailles V: Estrogen receptor cofactors expression in breast and endometrial human cancer cells. Mol Cell Endocrinol 156: 85–93, 1999

101

39. Kurebayashi J, Otsuki T, Kunisue H, Tanaka K, Yamamoto S, Sonoo H: Expression levels of estrogen receptor-alpha, estrogen receptor-beta, coactivators, and corepressors in breast cancer. Clin Cancer Res 6: 512–518, 2000 40. Tikkanen MK, Carter DJ, Harris AM, Le HM, Azorsa DO, Meltzer PS, Murdoch FE: Endogenously expressed estrogen receptor and coactivator AIB1 interact in MCF-7 human breast cancer cells [In Process Citation]. Proc Natl Acad Sci USA 97: 12536–12540, 2000 41. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL: The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95: 927–937, 1998 42. Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang SM, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR, Kushner PJ: Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol Endocrinol 12: 1605–1618, 1998 43. Tremblay A, Tremblay GB, Labrie F, Giguere V: Ligandindependent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1. Mol Cell 3: 513–519, 1999 44. Tai H, Kubota N, Kato S: Involvement of nuclear receptor coactivator SRC-1 in estrogen-dependent cell growth of MCF-7 cells. Biochem Biophys Res Commun 267: 311–316, 2000 45. Berns EM, van Staveren IL, Klijn JG, Foekens JA: Predictive value of SRC-1 for tamoxifen response of recurrent breast cancer. Breast Cancer Res Treat 48: 87–92, 1998 46. Shim WS, DiRenzo J, DeCaprio JA, Santen RJ, Brown M, Jeng MH: Segregation of steroid receptor coactivator-1 from steroid receptors in mammary epithelium. Proc Natl Acad Sci USA 96: 208–213, 1999 47. Stenoien DL, Mancini MG, Patel K, Allegretto EA, Smith CL, Mancini MA: Subnuclear trafficking of estrogen receptoralpha and steroid receptor coactivator-1. Mol Endocrinol 14: 518–534, 2000 48. Na SY, Lee SK, Han SJ, Choi HS, Im SY, Lee JW: Steroid receptor coactivator-1 interacts with the p50 subunit and coactivates nuclear factor kappaB- mediated transactivations. J Biol Chem 273: 10831–10834, 1998 49. Lee SK, Kim HJ, Na SY, Kim TS, Choi HS, Im SY, Lee JW: Steroid receptor coactivator-1 coactivates activating protein-1-mediated transactivations through interaction with the c-Jun and c-Fos subunits. J Biol Chem 273: 16651–16654, 1998 Address for offprints and correspondence: Paul S. Meltzer, NHGRI/ NIH, Building 49 Room 4A10, 49 Convent Drive Bethesda, MD 20892-4470, USA; Tel.: 301-594-5283; Fax: 301-480-3281