Till now no pharmacogenetic study of TP53 codon 72 (Arg72Pro) and CDH1 ... CDH1 rs16260 genetic polymorphism in Bangladeshi population for the first time.
Cancer Epidemiology 49 (2017) 46–52
Contents lists available at ScienceDirect
Cancer Epidemiology The International Journal of Cancer Epidemiology, Detection, and Prevention journal homepage: www.cancerepidemiology.net
Association of TP53 codon 72 and CDH1 genetic polymorphisms with colorectal cancer risk in Bangladeshi population Sanzana Fareen Rivua,1, Mohd Nazmul Hasan Apua,1, Samia Shabnaza , Noor Ahmed Nahida , Md. Reazul Islama , Mir Md. Abdullah Al-Mamuna , Zabun Naharb , Sikder Nahidul Islam Rabbic, Maizbha Uddin Ahmeda , Mohammad Safiqul Islamd,* , Abul Hasnata a
Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Dhaka 1000, Bangladesh Department of Pharmacy, University of Asia Pacific, Dhaka, Bangladesh c Pharmacogenetics Lab, Labaid Limited, Dhaka, Bangladesh d Department of Pharmacy, Noakhali Science and Technology University, Sonapur, Noakhali 3814, Bangladesh b
A R T I C L E I N F O
Article history: Received 28 January 2017 Received in revised form 6 April 2017 Accepted 16 May 2017 Available online xxx Keywords: Colorectal cancer Genetic polymorphisms TP53 codon 72 CDH1 Bangladeshi population
A B S T R A C T
Till now no pharmacogenetic study of TP53 codon 72 (Arg72Pro) and CDH1 rs16260 (-160CA; rs16260), has been described to affect CDH1 expression [30] and hence may directly influence susceptibility to cancer. In different ethnic groups it has been recognized as a risk factor for lung, breast, prostate, colorectal, gastric and endometrial cancers [31–33]. Moreover, a recently conducted casecontrol study on Bangladeshi population revealed a high risk association between TP53 Arg72Pro and CDH1 rs16260 polymorphisms and breast cancer development [26]. Since TP53 Arg72pro and CDH1 rs16260 polymorphisms has been proven to be a risk factor of colorectal cancer in different ethnicities [20–24,31–33] and also for breast cancer development in Bangladeshi population [26], there might have a correlation between TP53 Arg72Pro and CDH1rs16260 polymorphisms with colorectal cancer risk in Bangladeshi population. Furthermore, no study has been conducted regarding this possible correlation in Bangladeshi population. We, therefore, expect to find out that probable association of TP53 Arg72Pro and CDH1 rs16260 genetic polymorphisms with colorectal cancer risk in Bangladeshi population for the very first time.
47
2. Materials and methods 2.1. Study population Total 288 colorectal cancer patients were recruited during the period of February 2015 to November 2015. All patients were histologically diagnosed with colorectal cancer who reported in National Institute of Cancer research and Hospital (NICHR), Ahasania Mission Cancer Hospital, Dhaka Medical College Hospital (DMCH), Bangabandhu Sheikh Mujib Medical University (BSMMU). Another 295 healthy volunteers were included in this case-control study matched by age and sex with the patients. All the information was collected by trained nurses in presence of physicians through a detailed questionnaire. All patients and/or legal guardians signed a written consent and ethical committee of the respective hospitals approved all the ethical issues regarding the study. The study was conducted according to the description of Helsinki and its following revisions [34] and the genotyping analysis was performed in the laboratory of pharmacogenetics and pharmacokinetics of the Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Bangladesh. 2.2. Genotyping Genomic DNA was isolated from the blood samples collected from all patients according to our published method [35]. Amplification of genomic DNA was performed using the predesigned forward and reverse primers [26]. PCR-restriction fragment length polymorphism (RFLP) method was used to genotype both the TP53 Arg72Pro and CDH1 rs16260 allele. PCR products of 309 bp and 217 bp were obtained for TP53 Arg72Pro and CDH1rs16260 SNPs respectively. Conditions for PCR amplifications are presented in Table 1. Digestion of 309 bp PCR product of TP53 Arg72Pro was done with BstUI (NEB, USA) by incubating at 60 C for 4 h which generated two fragments of 175 bp & 134 bp in case of Arg allele while for Pro allele it generated only one fragment of 309 bp. Restriction enzyme HincII (NEB, USA) (37 C overnight) cleaved the A allele of CDH1 rs16260 giving two fragments of 129 bp & 88 bp but did not cleaved the C allele (only one fragment of 217 bp). These DNA fragments were stained with ethidium bromide and visualized on 2% agarose gel electrophoresis (Figs. 1 and 2). More than 25% of samples were randomly re-evaluated for confirmation. 2.3. Statistical analysis Statistical analyses were performed using SPSS software package, version 17.0 (SPSS, Inc., Chicago, IL). Deviation of genotype frequencies in the control group from patient group under Hardy–
Table 1 Primers, PCR conditions, restriction enzymes (RE), and expected DNA fragments on digestion to determine the genotype. Allele
Primer Sequence
PCR Conditions
RE
DNA fragments
Codon 72
FP 50 -TTCACCCATCTACAGTCC-30 RP 50 -CTCAGGGCAACTGACCGT-30
94 C 30 s 54 C 30 s 72 C 30 s
BstUI
NH 175,134 HE 309, 175, 134 MH 309
CDH1
FP 50 - GTGTAAAAGCCCTTTCTGATCCC -30 RP 50 - CACCTGCCGGCCACAGCCAATCA -30
94 C 40 s 56 C 30 s 72 C 50 s
HincII
NH 217 HE 217, 129, 88 MH 129, 88
FP = Forward Primer; RP = Reverse Primer; RE = Restriction Enzyme; NH = Normal Homozygote; HE = Heterozygote; MH = Mutant Homozygote.
48
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
The Male/Female ratio for patient group is 1.5 and that for control group is 1.2. The most prevalent primary tumor site is colon (63.2%) and the majority of the patients had stage II disease (37.2%) (Table 2). In case of CDH1 rs16260 polymorphism, parameters like female patients (OR = 1.83, 95% CI = 1.13–2.92, p < 0.05), stage III disease patients (OR = 2.03, 95% CI = 1.12–2.66, p < 0.05) were found to have a statistically significant risk association with colorectal cancer (Table 3). No other parameter was found to be significantly associated with TP53 rs1042522 and CDH1 rs16260 polymorphisms. 3.2. TP53 rs1042522 polymorphism
Fig. 1. Restriction Endonuclease (BstUI) digestion fragment of p53 with codon 72 polymorphism (2% agarose gel). Lane M: 50 bp molecular marker; Lane 1–9: Restriction digestion products; Lane 5 shows the wild (Arg/Arg) form(175 and 134 bp); Lanes 1, 2, 4, 6, 8 and 9 show the heterozygous (Arg/Pro) form(309, 175 and 134 bp); Lanes 3 and 7 show the mutant (Pro/Pro) form(309 bp).
Fig. 1 shows the DNA fragment patterns of BstUI digestion of the PCR product carried out to identify the variations at codon 72. Two bands (175 bp & 134 bp) in lane 5 demonstrated Arg/Arg homozygous genotype, three bands (309 bp, 175 bp & 134 bp) in lanes 1, 2, 4, 6, 8 and 9 demonstrated Arg/Pro heterozygous genotype and one band (309 bp) in lanes 3 and 7 indicated the presence of Pro/Pro mutant homozygous genotypes. The genotype frequencies in cases and controls are presented in Table 4. The percent distribution of Arg/Arg homozygous genotype was statistically lower in patients than in controls (30.9% vs. 53.9%). Patients carrying Arg/Pro heterozygous genotype was found to have 2.58-fold elevated risk of colorectal cancer compared to Arg/ Arg genotype carriers (adjusted OR = 2.58, 95% CI = 1.77–3.77, p < 0.05). The Pro/Pro genotype was statistically found to be responsible for colorectal cancer (adjusted OR = 2.92, 95% CI = 1.78– 4.78, p < 0.05) and shows 2.92 times greater risk of developing colorectal cancer. Similarly, the combination of Arg/Pro & Pro/Pro genotype also increased the colorectal cancer risk significantly (adjusted OR = 2.70, 95% CI = 1.90–3.82, p < 0.05). 3.3. CDH1 rs16260 polymorphism Digestion by HincII illustrated the mutation of CHD1 rs16260 (Fig. 2). Complete digestion of 217 bp fragment into 129 bp and 88 bp fragments demonstrated that both alleles were A/A mutant homozygous (lane 5). Lanes 1, 2, 4, 8 and 9 showed incomplete digestion that indicated the presence of C/A heterozygous form. Both alleles were C/C in lanes 3, 6 and 7. The frequency of C/C genotype was found higher for both patient and control and considered to be the reference. Number of patients carrying C/A heterozygous genotype is higher than that of in control group (36.5% vs 24.1%) and comprises a high risk factor of
Fig. 2. Restriction Endonuclease (HincII) digestion fragment of CDH1 rs16260 (2% agarose gel). Lane M: 50 bpmolecularmarker; Lane 1–9: Restriction digestion products; Lanes 3, 6 and 7 show the wild (C/C) form (217 bp); Lanes 1, 2, 4, 8 and 9 show the heterozygous (C/A) form (217, 129 and 88 bp); Lane 5 shows the mutant (A/A) form (129 and 88 bp).
Weinberg equilibrium (HWE) was measured by chi-square test (x2). A multivariate logistic regression analysis was performed to assess the odd ratios (OR) and 95% confidence interval adjusted to age and sex. In all of the analyses, p < 0.05 was considered as statistical significant. 3. Results 3.1. Characteristics of study population The study included 172 males (59.7%) and 116 females (40.3%) colorectal cancer patients with a mean age of 54 years (range 23–68) and the control group comprised of 163 males (55.3%) and 132 females (44.7%) with a mean age of 51.5 years (range 31–71).
Table 2 Demographic characteristics of the patients and controls. Variables
Cases n = 288 (%)
Controls n = 295 (%)
Age (years) 60
33 (11.46) 182 (63.19) 73 (25.35)
95 (32.20) 170 (57.63) 30 (10.17)
Sex Male Female
172 (59.72) 116 (40.28)
163 (55.25) 132 (44.75)
Primary tumor location Colon Rectum
182 (63.19) 106 (36.81)
Tumor Stage I II III IV
54 (18.75) 107 (37.15) 99 (34.38) 28 (9.72)
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
49
Table 3 Correlation of TP53 Arg72Pro and CDH1 rs16260 polymorphisms with clinicopathological characteristics of the patients. Characteristics
TP53 Carrier (n = 199)
TP53 Noncarrier (n = 89)
OR (95% CI)
pvalue
CDH1 Carrier (n = 126)
CDH1 Noncarrier (n = 162)
OR (95% CI)
p-value
53
15
>0.05
28
40
92
55
>0.05
59
88
>60
54
19
>0.05
39
34
45–60 + >60
146
74
–
98
122
0.87 (0.50– 1.51) 0.83 (0.55– 1.27) 1.43 (0.84– 2.43) Ref
>0.05
45–60
1.79 (0.95– 3.39) 0.85 (0.55– 1.31) 1.44 (0.80– 2.61) Ref
Sex Male Female
125 74
47 42
Ref 0.66 (0.40– 1.10)
– >0.05
65 61
107 55
Ref 1.83 (1.13– 2.92)
– 0.05
75 51
107 55
Ref 1.32 (0.82– 2.14)
– >0.05
Tumor Stage I II
36 74
18 33
– >0.05
28 44
26 63
71
28
>0.05
44
55
IV
18
10
>0.05
10
18
Ref 1.77 (0.98– 3.17) 2.03 (1.12– 3.66) 1.41 (0.58– 3.42)
– >0.05
III
Ref 1.12 (0.56– 2.26) 1.27 (0.62– 2.59) 0.90 (0.35– 2.35)
Age 0.05 >0.05 –
0.05
Table 4 Genotype frequencies of TP53 Arg72Pro and CDH1 rs16260 gene polymorphisms in cases and controls. Genotype
Cases n = 288 (%)
Control n = 295 (%)
Adjusted Odd ratio (95% CI)
p- value
TP53 Arg72Pro Arg/Arg Arg/Pro Pro/Pro Arg/Pro + Pro/Pro
89 (30.90) 138 (47.92) 61 (21.18) 199 (69.10)
159 (53.90) 98 (33.22) 38 (12.88) 136 (46.10)
Ref 2.58 (1.77–3.77) 2.92 (1.78–4.78) 2.70 (1.90–3.82)
–
