Automated maintenance of embryonic stem cell ... - Wiley Online Library

COMMUNICATION

TO THE

EDITOR

Automated Maintenance of Embryonic Stem Cell Cultures Stefanie Terstegge,1,2 Iris Laufenberg,2 Jo¨rg Pochert,3 Sabine Schenk,1,2 Joseph Itskovitz-Eldor,4 Elmar Endl,5 Oliver Bru¨stle1,2 1

Institute of Reconstructive Neurobiology, Life & Brain Center, University of Bonn and Hertie Foundation, Bonn, Germany; telephone þ49 228 6885 500; fax þ49 228 6885 501; e-mail: [email protected] 2 Life & Brain GmbH, Bonn, Germany 3 Hamilton Life Science Robotics, Bonaduz, Switzerland 4 Department of Obstetrics and Gynecology, Rambam Medical Center, Haifa, Israel 5 Institute of Molecular Medicine and Experimental Immunology, University of Bonn Medical Center, Bonn, Germany Received 9 December 2005; accepted 1 June 2006 Published online 7 September 2006 in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/bit.21061

ABSTRACT: Embryonic stem cell (ESC) technology provides attractive perspectives for generating unlimited numbers of somatic cells for disease modeling and compound screening. A key prerequisite for these industrial applications are standardized and automated systems suitable for stem cell processing. Here we demonstrate that mouse and human ESC propagated by automated culture maintain their mean specific growth rates, their capacity for multigermlayer differentiation, and the expression of the pluripotency-associated markers SSEA-1/Oct-4 and Tra-1-60/ Tra-1-81/Oct-4, respectively. The feasibility of ESC culture automation may greatly facilitate the use of this versatile cell source for a variety of biomedical applications. Biotechnol. Bioeng. 2007;96: 195–201. ß 2006 Wiley Periodicals, Inc. KEYWORDS: embryonic stem cell; cell culture standardization; cell culture automation; cell growth; pluripotency; screening

Introduction In the age of systems biology, the cell as the smallest unit of life continues to gain in importance as a model in fundamental research and in pharmacological and toxicological screening. Embryonic stem cells (ESC) are capable of unlimited self-renewal, can be induced to differentiate into

all somatic cell types (Keller, 2005), are amenable to genetic modification and available from several species including mice and humans (Evans and Kaufman, 1981; Martin, 1981; Reubinoff et al., 2000; Thomson et al., 1998). These unique properties do not only make ESC an ideal tool for the study of developmental processes. They also offer perspectives for the in vitro derivation of somatic cell types not easily available as primary cells including human neurons, cardiomyocytes, insulin-producing cells, and others (Assady et al., 2001; Kehat et al., 2004; Zhang et al., 2001). Many efforts concentrate on the generation of ESC-derived somatic cells as starting material for cell and tissue repair (Bru¨stle et al., 1999; Perrier et al., 2004; Soria et al., 2000). While much basic research is still needed to enable the clinical use of ESC progeny, ESC-derived somatic cells could in the mid-term open new perspectives for pharmaceutical and toxicological screening. In this context, the growing number of diseasespecific hESC lines available from preimplantation genetic diagnosis (Verlinsky et al., 2005) represent an attractive tool for compound screening and development. While automated processing has become a standard feature of many laboratory techniques in biochemistry, genome analysis, and proteomics, cell culture still largely relies on manual intervention. This is due to the sensitivity of mammalian cells, contamination issues in antibiotic-free cultures, and the need for visual control and appropriate response to cell density and morphology in complex cell culture paradigms. Requirements for co-culture steps and complex differentiation protocols (Bru¨stle et al., 1999;

Correspondence to: O. Bru¨stle Contract grant sponsors: ESTOOLS (European Commission 6th Framework Programme); Hertie Foundation; DFG Contract grant numbers: LSHG-CT-2006-018739; BR 1337/3-2

ß 2006 Wiley Periodicals, Inc.

Biotechnology and Bioengineering, Vol. 96, No. 1, January 1, 2007

195

Glaser et al., 2005; Lumelsky et al., 2001) further add to the difficulties of automated ESC culture. On the other hand, conventional manual cell culture remains afflicted with interindividual variations, including possible genomic instability, thus lacking the standardization and reproducibility required for large-scale analytic and preparative applications. Here we describe a system for the maintenance of ESC cultures (Cellhost), which automates cell plating, media change, growth factor addition, and cell harvesting and which has shown long-term sterility in antibiotic-free culture. The development of automated ESC culture should provide another milestone for the use of this versatile cell source in pharmacological and toxicological screening.

Materials and Methods

platform to two robot-accessible incubators (Kendro, Hanau, Germany) for storage of cell culture plates (378C, 5% CO2 atmosphere; capacity of 153 SBS format multiwell cell culture plates) and media (48C; capacity of 20 media tubs). Both incubators are equipped with barcode readers. In a typical process, a media tub specified by the user is transferred from the incubator to the heating element where it is warmed up to 378C. Subsequently, a cell culture plate determined by the user is transported from the incubator to the pipetting station. Employing the liquid level detection system, the Cellhost assures that the media tub contains sufficient media for a media change of the complete plate. Used media is removed entirely from the plate by means of the plate lifter and fresh media is added. While the cell culture plate and the media tub are returned to the incubators, the plate trail is updated with information on the operated process, date, user, media tub barcode, and media tub lot number.

Instrumentation The Cellhost system (Fig. 1) is based on a Hamilton Microlab STAR workstation adapted to cell culture requirements. Specifically, a plate lifter for tilting cell culture plates was implemented to allow for complete removal of supernatant during media changes. The robotic arm was adapted to simulate manual movements during cell plating. This process was adjusted according to different requirements for the homogeneous plating of single cell mESC and of hESC aggregates. Furthermore, a heater-shaker module (CAT, Staufen, Germany) for gelatin-coating and trypsintreatment and heating elements for warming up cell culture media were installed. The entire unit was devised to operate according to the pipetting principle of monitored air displacement technology. In order to limit costs for disposables, we implemented a washing station for reusable pipetting needles coupled to a Millipore water purification system. Apart from this washing station, the automated system includes neither tubing nor system liquid, thus avoiding frequent sources of contamination. The pipetting station is contained in a sterile housing with laminar air flow and UV decontamination routine (Bigneat Ltd, Waterlooville, UK). Two linear transfer units connect the pipetting

Plate Tracking Barcode labeled plates are used on the system to allow tracking in Hamilton’s CellTrack database. All plates on the system are registered in a plate list, giving access to information such as plate barcode, the status of the plate with respect to the cell culture process, and the date of the last status change. Furthermore, all processing steps of an individual plate are documented in plate trails, including time and date, operator information, lot numbers of media, and manually performed actions such as microscopic examination of cell cultures.

Culture and Differentiation of Mouse ESC Murine ESC (line J1; Li et al., 1992) were cultured for 4 weeks according to the established manual procedure and by the automated system. Gelatin-coated (0.1%) six-wellplates were seeded with g-irradiated murine embryonic fibroblasts 24 h prior to ESC plating. ESC were plated at a density of 1.3 105 cells/cm2. ES cell medium was composed of 20% FCS (Invitrogen, Karlsruhe, Germany),

Figure 1. The Cellhost system is composed of a pipetting workstation contained in a laminar air flow cabinet and of two robot-accessible incubators for the storage of cell cultures and media (A). The pipetting workstation features several tools tailored for cell culture applications, such as a plate lifter for the complete removal of media from cell culture plates, heating positions for cell culture media, and a heater-shaker module for enzyme-treatment of cell cultures (B).

196

Biotechnology and Bioengineering, Vol. 96, No. 1, January 1, 2007 DOI 10.1002/bit

106 U/L LIF (Chemicon, Hofheim, Germany), 1% nonessential amino acids, 0.1 mM 2-mercaptoethanol and DMEM (all from Invitrogen). Media were changed every day, and cells were passaged every other day using trypsinEDTA (Invitrogen). For both manual and automated culture, centrifugation steps were performed in a Megafuge 1.0R (Kendro) at the exterior of the automated system. After every passage, cells were subjected to morphological evaluation, determination of cell numbers, and immunocytochemical analysis. Every day, glucose consumption and lactate production of the cells were monitored by analyzing the used cell culture media with a YSI 2700 Select biochemical analyzer (Kreienbaum, Langenfeld, Germany). Differentiation of murine ESC cultured for 4 weeks by the automated system was initiated by spontaneous embryoid body (EB) formation in bacterial culture dishes in medium composed of 20% FCS, 1% non-essential amino acids, 0.1 mM 2-mercaptoethanol, and DMEM (all from Invitrogen). After 2 weeks of suspension culture, EBs were analyzed by immunocytochemistry.

Culture of Human ESC Human ESC (hESC) lines H9.2 and I3 were cultured as described previously (Amit et al., 2000) either manually or by the automated system. Briefly, hESC were expanded on g-irradiated primary mouse embryonic fibroblasts (MEF) derived from the mouse strain CD1 in culture medium that was composed of KnockOut DMEM supplemented with 20% KnockOut Serum Replacement, 1% non-essential amino acids, 1 mM glutamine, 0.1 mM 2-mercaptoethanol, and 4 ng/mL FGF-2 (all from Invitrogen). Culture media were changed every day and hESC were subcultured every 4–5 days using 1 mg/mL collagenase type IV (Invitrogen). Collagenase treatment and associated centrifugation steps were performed at the exterior of the automated system. As for mESC, hESC were subjected to morphological evaluation, determination of cell numbers, and immunocytochemical analysis after each passage. Glucose consumption and lactate production of the cells were monitored daily. Differentiation of hESC cultured for 4 weeks by the automated system was initiated by spontaneous EB formation in bacterial culture dishes in medium composed of 20% FCS, 1% non-essential amino acids, 1 mM L-glutamine, and Knockout-DMEM (all from Invitrogen). After 3 weeks of suspension culture, EBs were analyzed by immunocytochemistry.

Immunocytochemical Analysis Adherent cultures were fixed with 4% PFA for 10 min at room temperature (RT) and rinsed with PBS. Whole EBs were fixed with 4% PFA for 30 min at RT, rinsed with PBS, and incubated in 30% sucrose for 3 h. EBs were subsequently

embedded in Tissue-Tek (Sakura, Zoeterwoude, Netherlands), frozen, and sectioned into 13-mm slices. For SSEA-1 stainings, cells were preincubated with 5% fetal calf serum (FCS, Invitrogen) for 1 h at RT. For Oct-4, AFP, Cytokeratin, and Desmin stainings, cells were permeabilized with 0.5% Triton-X100 for 20 min and preincubated with 5% FCS and 0.1% Triton for 1 h at RT. Cells were incubated over night at RT with primary antibodies in the appropriate preincubation solution (mouse-anti-SSEA-1 1:80, Developmental Studies Hybridoma Bank, DSHB, Iowa City, IA; rabbit-anti-Oct-4, 1:400, Santa Cruz Biotechnology, Inc., Santa Cruz, CA; rabbit-anti-AFP, 1:200, DakoCytomation, Hamburg, Germany; mouse-anti-Cytokeratin, 1:200, Chemicon; rabbit-anti-Desmin, 1:100, Chemicon). Antigens were visualized using appropriate fluorophore-conjugated secondary antibodies (goat-antimouse-Cy3, 1:500, Jackson Immuno Research, West Grove, PA; goat-anti-rabbit-Cy3, 1:200, Jackson Immuno Research; goat-anti-mouse-rhodamine, 1:100, Jackson Immuno Research; goat-anti-rabbit-FITC, 1:200, Jackson Immuno Research). Nuclear stainings were performed with DAPI (Sigma, Steinheim, Germany, dilution 1:10,000 in 10 mM sodium hydrogen carbonate, pH 8.2) for 2 min. Negative controls for antibody specificity were performed by omitting the primary antibodies. Quantitative analysis was carried out by counting the number of immunoreactive cells per total number of viable cells as determined by DAPI staining. At least 800 cells were analyzed for each marker and experiment.

Flowcytometry Tra-1-81 and Tra-1-60 expression levels of hESC were determined by flow cytometry. The cells were triturated to a single cell suspension using accutase (PAA, Pasching, Austria) and adjusted to a final density of 1 106 cells in 500 mL PBS containing the primary monoclonal IgM antibodies TRA-1-81 or TRA-1-60 at the appropriate concentration (Chemicon, dilution 1:500). Antigens were visualized using a Cy-5-conjugated secondary antibody (1:500; Jackson Immunoresearch). Unspecific binding and autofluorescence were controlled using cells treated similarly except that primary or secondary antibody were absent during incubation. After a final wash, cells were resuspended in 500 mL PBS containing 1.2 mg/mL Hoechst 33258 (Sigma, Deisenhofen, Germany) to discriminate dead cells, and cells were incubated for an additional 5 min at RT prior to flow cytometric analysis. Fluorochromes were excited and recorded on a three-laser LSRII analytical flow cytometer (BD Biosciences, Heidelberg, Germany). Excitation and emission settings were 405 nm excitation and 440/40 band pass filter for Hoechst and 635 nm laser excitation and 660/ 20 band pass filter for Cy5. Data were analyzed and arranged for presentation using Flowjo analysis software (Tree Star, Inc., Ashland, OR).

Terstegge et al.: Automated ES Cell Culture Biotechnology and Bioengineering. DOI 10.1002/bit

197

Quantitative RT-PCR Analysis After 4 weeks of automated cell culture, RNA was isolated from hESC using the RNeasy kit (Qiagen, Hilden, Germany) and reverse transcription was carried out with the Expand Reverse Transcriptase kit (Roche, Mannheim, Germany). Real-time PCR was performed with the iCycler iQ Multicolor real-time PCR detection system (Biorad, Mu¨nchen, Germany) using the SYBR-Green detection method. The specificity of the PCR products was controlled by melt curve analysis and subsequent gel electrophoresis. Relative quantification of gene expression was carried out according to the DDCP-method. Glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) was chosen as the reference gene. Manually cultured cells constituted the control population. Human specific primer sequences (forward, reverse), product length, and product melting point were as follows: Oct-4 AGAACAATGAGAACCTTCAGGAGA, CTGGCGCCGGTTACAGAACCAA, 286 bp, 898C; Nanog GCTTGCCTTGCTTTGAAGCA, TTCTTGACTGGGACCTTGTC, 255 bp, 86.58C; Rex-1 GCGTACGCAAATTAAAGTCCAGA, CAGCATCCTAAACAGCTCGCAGAAT, 306 bp, 878C; GAPDH CTGCTTTTAACTCTGGTAAAGT, GCGCCAGCATCGCCCA, 213 bp, 86.58C.

Karyotype Analysis After 4 weeks of automated culture, hESC were cultured for two passages on Matrigel-coated dishes (BD Biosciences) in the presence of fibroblast-conditioned medium in order to obtain feeder-free cultures. Subconfluent cultures were

incubated with 0.2 mg/mL Colcemid for 23 h, trypsinized and resuspended in 0.075 M KCl. Following incubation at 378C for 10 min, three drops of fixative (three parts methanol, one part acetic acid) were added to the suspension. After centrifugation, two washing steps with fixative were performed. Metaphase spreads were prepared on glass microscope slides. G-banding was performed by incubation for 55 s with 2.5 mL Bactotrypsin (BD Biosciences)/mL PBS and subsequent staining with 5% Giemsa solution (Sigma, Deisenhofen, Germany). At least 20 metaphase spreads were analyzed.

Results and Discussion ESC cultures represent some of the most sensitive cell culture paradigms. Proliferation and differentiation of ESC typically require extensive manual intervention, which, at the same time, makes the cultures highly susceptible to interindividual variations. However, standardization and reproducibility are essential prerequisites for using ESC and ESC-derived somatic cell types for analytic and therapeutic applications. As a first step in this direction we have developed the Microlab STAR pipetting workstation to an automated unit meeting the specific requirements of murine and human ESC culture. As co-culture with mitotically inactivated MEFs is still frequently used in ESC proliferation, the system was devised to include steps for automated MEF plating and maintenance. By programming the robotic arm to imitate human hand movements during cell plating we achieved an even

Figure 2.

Growth rate and metabolic activity of embryonic stem cells (ESC) are not altered by automated culture. Mean specific growth rate (A, mESC; B, hESC), glucose consumption, and lactate production rates (C, mESC; D, hESC) of ESCs cultured by the automated system are comparable to those of manually cultured cells. Quantitative results are depicted as mean SD of at least three independent experiments. t-tests revealed P-values of 0.78 (growth rate, mESC), 0.80 (growth rate, hESC), 0.91 (glucose consumption rate, mESC), 0.28 (glucose consumption rate, hESC), 0.66 (lactate production rate, mESC), and 0.77 (lactate production rate, hESC), indicating that there are no statistical differences between automated and manual culture. Growth rates of 0.7 and 0.2 day1 correspond to doubling times of 1 day and 3.5 days, respectively.

198


distribution of MEF, yielding a homogeneous monolayer. The integrity of the fibroblast layer was maintained during media changes and subsequent ESC plating. Specific operating programs for the robotic arm permitted homo-

geneous plating of mouse and human ESC without disruption or damage of the underlying feeder cells. Upon automated plating, both mESC and hESC colonies showed the typical morphologies observed during manual culture.

Figure 3.

Embryonic stem cells propagated by the Cellhost system maintain expression of pluripotency-associated markers. After 4 weeks of automated mESC culture, the expression levels of the pluripotency-associated markers Oct-4 (A, B, C) and SSEA-1 (D, E, F) are comparable to manual controls. Similarly, hESC cultures propagated by the robotic system maintain the expression of Oct-4, Tra-1-60, and Tra-1-81 as determined by immunofluorescence analysis (G, H, I) and flowcytometry (J, K). Nuclei are stained with DAPI (blue). Scale bar ¼ 100 mm. Quantitative immunofluorescence data are based on at least three independent experiments and are mean SD. Flowcytometrical data are taken from single representative experiments. Feeder cells and dead cells were eliminated from analysis by gating according to forward scatter and sideward scatter properties and Hoechst 33258 uptake. Open histograms correspond to negative controls and filled histograms represent staining of the indicated pluripotency-associated markers. Maintenance of pluripotency-associated marker expression could be confirmed by quantitative RT-PCR for Oct-4, Rex-1, and Nanog (L). Quantitative RT-PCR data are based on at least three independent experiments and are presented as mean SD. Ratios were calculated according to the DDCP-method. G-banding analysis revealed that automated hESC cultures maintained a stable karyotype (46XX, M). Karyograms were arranged employing CytoVision Ultra software (Applied Imaging, Inc., San Jose). Analysis of at least 20 metaphases was performed.


199

Figure 4. Preservation of the in vitro differentiation potential. After 4 weeks of automated culture, mESC (A, B, C) and hESC (D, E, F) readily form embryoid bodies expressing the germ layer-associated markers cytokeratin (A, D; ectoderm), desmin (B, E; mesoderm), and a-fetoprotein (AFP, C, F; endoderm). Nuclei are counter-stained with DAPI (blue). Scale bar ¼ 50 mm.

mESC colonies were compact in shape, and hESC colonies displayed clearly discernible borders. Repeated media changes by the automated system did not compromise the integrity of the fibroblast-ESC co-culture (data not shown). No microbial contamination was observed even after propagation of ESC in antibiotic-free media for up to 4 weeks. Throughout long-term culture, growth characteristics of ESC propagated in the Cellhost system were comparable to those of the manual control. During 4 weeks of culture, mean specific growth rates of mESC and hESC maintained by the automated system were 0.72 0.06 and 0.223 0.003 day1, respectively, thus equaling those of the manual controls (Fig. 2A and B). Metabolic analysis revealed that glucose consumption of both mESC (0.9 0.17 mM day1 108 cells) and hESC (5.28 0.9 mM day1 108 cells) was not affected by automated culture. Lactate production rates for mESC (2.45 0.44 mM day1 108 cells) and hESC (11.99 1.15 mM day1 108 cells), too, did not differ significantly (P > 0,05) from the manual controls (Fig. 2C and D). By immunocytochemical analysis, we could show that during 4 weeks of automated culture, the expression of the pluripotency-associated markers Oct-4 and SSEA-1 was maintained in mESC cultures (Fig. 3). With 96 2%, the percentage of Oct-4-expressing cells in the automated mESC culture equaled that of the manual culture (97 1%; Fig. 3A–C). The surface marker SSEA-1 was expressed in 94 2% of mESC cultured by the automated system compared to 92 2% of manually cultured cells (Fig. 3D–F). Similarly, with 96 1% positive cells, the expression level of Oct-4 in automated hESC cultures did not differ from the manual control (96 1%; Fig. 3G–I). Flowcytometry revealed that 87 4% of hESC cultured by the Cellhost system stained positive for the pluripotency-associated surface marker Tra-1-60 (manual control: 84 2%; Fig. 3J) while 89 2% were positive for Tra-1-81 (manual control: 86 5%; Fig. 3K). These data were confirmed by

200

quantitative RT-PCR analysis. Comparing expression values between manual and automated hESC cultures by the DDCP method, we obtained ratios of 0.77 0.8 for Oct-4, of 1.27 0.66 for Rex-1, and of 1.4 0.51 for Nanog (Fig. 3L). These results indicate that automated cell culture did not significantly alter gene expression levels for pluripotencyassociated transcription factors. After 4 weeks of automated cell culture, hESC maintained a stable karyotype (46XX, Fig. 3M). Embryoid body (EB) formation was induced in order to assess the in vitro differentiation potential of ESC after 4 weeks of automated culture. Both mESC and hESC cultured by the automated system readily formed EBs. Immunocytochemical analysis of cryosectioned EBs demonstrated the presence of a-fetoprotein-, desmin-, and cytokeratin-positive cells for both mESC (Fig. 4A–C) and hESC (Fig. 4D–F). These results indicate that ESC maintained for 4 weeks by the automated system retain their multi-germlayer differentiation potential. It was the aim of this study to devise an automated system that reliably maintains ESC cultures without affecting growth characteristics and in vitro multi-germlayer differentiation potential. Based on cumulative data including cell morphology, growth characteristics, pluripotency-associated marker expression, and in vitro differentiation data, we propose that these requirements can be fulfilled by the Cellhost system. In the time period examined, we observed no overt karyotype abnormalities. However, as with any cell culture system, long-term studies across several months will be required to comprehensively address this issue. Further steps such as implementation of a centrifuge and automated optical read-out systems for cell density, morphology, and fluorescence may be used to increase the stand-alone time of the system and to enable high throughput screening of ES cell-based assays. We thank Peter Kiesau, Dieter Erkenrath (Hamilton Life Science Robotics), Barbara Ley (Life & Brain GmbH), and Nunc GmbH & Co.


KG for their support. We are grateful to Nina Limbach (Institute of Reconstructive Neurobiology) and to Christina Ergang (Institute of Human Genetics, University of Bonn Medical Center) for help with the G-banding protocol. Part of this work was supported by the DFG (BR 1337/3-2), by the Hertie Foundation and by the European Commission within the 6th Framework Programme through ESTOOLS (LSHG-CT-2006-018739).

References Amit M, Carpenter MK, Inokuma MS, Chiu CP, Harris CP, Waknitz MA, Itskovitz-Eldor J, Thomson JA. 2000. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 227(2):271–278. Assady S, Maor G, Amit M, Itskovitz-Eldor J, Skorecki KL, Tzukerman M. 2001. Insulin production by human embryonic stem cells. Diabetes 50(8):1691–1697. Bru¨stle O, Jones KN, Learish RD, Karram K, Choudhary K, Wiestler OD, Duncan ID, McKay RD. 1999. Embryonic stem cell-derived glial precursors: A source of myelinating transplants. Science 285(5428): 754–756. Evans MJ, Kaufman MH. 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature 292:154–156. Glaser T, Perez-Bouza A, Klein K, Brustle O. 2005. Generation of purified oligodendrocyte progenitors from embryonic stem cells. FASEB J 19(1):112–114. Kehat I, Khimovich L, Caspi O, Gepstein A, Shofti R, Arbel G, Huber I, Satin J, Itskovitz-Eldor J, Gepstein L. 2004. Electromechanical integration of cardiomyocytes derived from human embryonic stem cells. Nat Biotechnol 22(10):1282–1289.

Keller G. 2005. Embryonic stem cell differentiation: Emergence of a new era in biology and medicine. Genes Dev 19(10):1129–1155. Li E, Bestor TH, Jaenisch R. 1992. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69(6): 915–926. Lumelsky N, Blondel O, Laeng P, Velasco I, Ravin R, McKay R. 2001. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292(5520):1389–1394. Martin GR. 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA 78(12):7634–7638. Perrier AL, Tabar V, Barberi T, Rubio ME, Bruses J, Topf N, Harrison NL, Studer L. 2004. Derivation of midbrain dopamine neurons from human embryonic stem cells. Proc Natl Acad Sci USA 101(34): 12543–12548. Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. 2000. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nat Biotechnol 18(4):399–404. Soria B, Roche E, Berna G, Leon-Quinto T, Reig JA, Martin F. 2000. Insulinsecreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 49(2):157–162. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshal VS, Jones JM. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145–1147. Verlinsky Y, Strelchenko N, Kukharenko V, Rechitsky S, Verlinsky O, Galat V, Kuliev A. 2005. Human embryonic stem cell lines with genetic disorders. Reprod Biomed Online 10(1):105–110. Zhang SC, Wernig M, Duncan ID, Bru¨stle O, Thomson JA. 2001. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat Biotechnol 19(12):1129–1133.


201