Automation of genomic DNA isolation from formalin-fixed, paraffin ...

Pathology – Research and Practice 208 (2012) 705–707

Contents lists available at SciVerse ScienceDirect

Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp

Original article

Automation of genomic DNA isolation from formalin-fixed, paraffin-embedded tissues Soya S. Sam a , Kimberly A. Lebel b , Cheryl L. Bissaillon b , Laura J. Tafe a , Gregory J. Tsongalis a , Joel A. Lefferts a,∗ a b

Department of Pathology, Dartmouth-Hitchcock Medical Center, Lebanon, NH, United States Department of Pathology, Baystate Health Center, Springfield, MA, United States

a r t i c l e

i n f o

Article history: Received 13 July 2012 Received in revised form 7 August 2012 Accepted 17 August 2012 Keywords: FFPE tissue DNA isolation Qiagen EZ1 Tissue Kit Real-time PCR

a b s t r a c t Isolation of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue remains a laborious task for clinical laboratories and researchers who need to screen several samples for genetic variants. The objective of this study was to evaluate DNA isolation methods from FFPE tissues and to choose an efficient method with less hands-on time to obtain DNA of optimum concentration and purity for use in routine molecular diagnostic assays. Three methods were compared in this study: Gentra Puregene Tissue Kit, EZ1 DNA Tissue Kit and QIAamp FFPE Tissue Kit. Samples consisted of FFPE tissues of head/neck and lung tumor resections. Quality control for the extraction process end product included determination of the concentration and purity of isolated DNA and the ability to amplify a housekeeping gene, GAPDH, using real-time PCR assay. The hands-on-time required was less for the EZ1 protocol compared to the other methods. The average DNA concentration obtained was 112, 61 and 40 ng/␮l, respectively, for the Gentra Puregene Tissue Kit, Qiagen EZ1 DNA Tissue Kit and QIAamp FFPE Tissue Kit. The purity and quality of samples obtained using the different DNA isolation methods were comparable. Comparative evaluation of three DNA isolation methods indicated that the Qiagen EZ1 method surpassed the other methods with reduced hands-on-time to produce optimum concentration of quality DNA for use in routine molecular analyses. © 2012 Elsevier GmbH. All rights reserved.

Introduction With the advent of molecular profiling technologies, there are tremendous opportunities to screen and comprehensively evaluate biomarkers and unlock the molecular mechanisms pertaining to various diseases. Worldwide, millions of FFPE tissues are archived in hospitals and tissue banks, and these tissues represent a rich source of information on genetic events involved in different aspects of clinical conditions [1]. Formalin fixation and paraffinembedding have been the clinical standard for preserving these valuable samples [2,3]. FFPE tissues have several advantages over fresh or frozen tissue samples in that it is easy to handle and has inexpensive long-term storage [4]. Though FFPE tissue is often the only choice for clinical molecular applications, isolation of DNA from FFPE tissues is challenging. The fixation of tissues causes modifications and consequent cross-linkage of biomolecules by formaldehyde, a principal active

∗ Corresponding author at: Department of Pathology, Dartmouth-Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756, United States. Tel.: +1 603 650 8116. E-mail address: [email protected] (J.A. Lefferts). 0344-0338/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2012.08.008

component of formalin. The nucleic acids tend to undergo degradation in an extremely acidic environment which, in turn, affects the downstream applications [1,5,6]. Moreover, the extraction of DNA from these samples remains a challenge for clinical laboratories and researchers screening multiple samples for genetic variants as conventional extraction procedures are very laborious and timeconsuming for processing of samples in a busy clinical laboratory setting. Nevertheless, FFPE tissue archives constitute a resource for retrospective biomarker discovery from which valuable epidemiological data on several diseases could be elucidated [7]. Therefore, the objective of this study was to develop an efficient method with less hands-on time to obtain DNA of optimum concentration and purity from FFPE tissues, for use in routine downstream applications. The three different Qiagen isolation methods that were tested were the Gentra Puregene tissue isolation method (manual), EZ1 DNA Tissue Kit (automated isolation with upfront processing) and QIAamp DNA FFPE Tissue Kit (manual spin column). Materials and methods Five tissue samples were randomly selected that included three head/neck (floor of the mouth/left lateral tongue/bilateral

706

S.S. Sam et al. / Pathology – Research and Practice 208 (2012) 705–707

neck dissection) and two lung (right and left upper lobes) tumor resections. For all experiments, we used FFPE tissue rolls (two consecutive 10 ␮m thick sections) and unstained slides (four consecutive 5 ␮m thick sections) obtained from the paraffin blocks of the tumor tissues. The tissue rolls were collected in 1.5 ml micro-centrifuge tubes (USA Scientific, FL, USA), and the unstained sections from slides were scraped using a sterile scalpel blade (BD Bard-ParkerTM , no. 11) and collected into micro-centrifuge tubes that contained appropriate deparaffinizing or lysis buffer depending on the method. Qiagen Gentra Puregene tissue isolation method This protocol initially uses xylene to remove the paraffin from the tissues which include several steps of incubation, centrifugation and removal of supernatant without disturbing the pellet. This was followed by ethanol wash using absolute and 95% ethanol where similar steps were followed as above. Cell lysis solution was added to the pellet, followed by addition of proteinase K and incubated overnight at 56 ◦ C. To the completely digested tissue lysate, we added RNase A Solution and protein precipitation solution. The supernatant obtained on spinning down the samples was added to a tube containing isopropanol and mixed by inverting gently about 50 times. The DNA pellet was washed by adding 70% ethanol and inverting several times. After final centrifugation and removing the supernatant, the tubes were air-dried for evaporation of residual ethanol. DNA hydration solution was added and vortexed for 5 s followed by incubation at 65 ◦ C for 1 h to dissolve the DNA. EZ1 DNA Tissue Kit isolation method Isolation of DNA using the Qiagen EZ1 DNA Tissue Kit was performed according to the manufacturer’s instructions with minor modifications. Completely submerged tissues sections in 180 ␮l of extraction buffer, G2, were incubated for 5 min at 75 ◦ C with vigorous mixing (500 rpm) on a thermomixer. The temperature of thermomixer was lowered to 56 ◦ C and allowed the samples to cool to 56 ◦ C. Proteinase K was added and incubated at 56 ◦ C overnight. Additional proteinase K was added, and the incubation was continued for 2 h the next morning. The samples were centrifuged and homogenized by pipetting up and down a few times. After centrifuging the samples once more, the supernatant was transferred to new sample tubes and subjected to automated DNA isolation on a BioRobot EZ1 workstation (Qiagen) equipped with a DNA Paraffin Section card and EZ1 DNA Tissue Kit cartridges. QIAamp FFPE Tissue Kit isolation method The protocol was performed according to the manufacturer’s instructions with certain modifications. The initial part of the protocol was similar to Gentra Puregene isolation technique, where xylene deparaffinization and ethanol wash was adopted. After removing the residual ethanol, the pellet was resuspended in buffer ATL followed by addition of proteinase K and incubated at 56 ◦ C overnight. On the following morning, additional proteinase K was added and the incubation was continued for 2 h. The completely lysed samples were then incubated at 90 ◦ C for 1 h in order to reverse formaldehyde cross-linking. After a brief centrifugation of the lysate tubes, RNase A was added and incubated for 2 min at room temperature. Buffer AL and 95% ethanol were added to the samples and vortexed thoroughly. Whole lysate was then transferred to QIAamp MinElute column placed in a 2 ml collection tube. This was centrifuged and the QIAamp MinElute column was placed into a clean 2 ml collection tube. Buffer AW1 was added to the column, centrifuged, and the column was placed in a clean 2 ml collection tube. This step was repeated using AW2 buffer as well. After

centrifuging, the column was placed in a 1.5 ml tube, and Buffer ATE was added to the center of the membrane. After incubating at room temperature for 1 min, the samples were centrifuged and the DNA was collected into the tubes. Evaluation of DNA samples The volume of DNA eluted from all the three methods was 50 ␮l. The total amount of DNA from three purification methods was determined by measuring the absorbance at 260 nm (A260 ), and the purity was assessed by calculating the A260 /A280 ratio using the Nanodrop 1000 spectrophotometer (Thermo Scientific, Rockford, IL). Further, the DNA concentrations of the samples were normalized to 10 ng/␮l, and real-time PCR was performed for a housekeeping gene, GAPDH, using the Applied Biosystems 7500 Fast real-time PCR system. The reaction was carried out using SYBR GREEN master mix (Applied Biosystems) containing AmpliTaq Gold polymerase in a standard PCR buffer. The sequences for forward and reverse primers of GAPDH were TCTCTGCTGTAGGCTCATTTGCAG and CATGGTTCACACCCATGACGAACA. The thermocycling conditions were as follows: initial denaturation at 95 ◦ C for 15 min, followed by 45 cycles of denaturation at 94 ◦ C for 15 s, annealing at 55 ◦ C for 30 s and extension at 72 ◦ C for 30 s. Results Purification of DNA spanned two days for all the three methods tested in the study. Hands-on-time was lowest for the EZ1 protocol (as little as 10 min) compared to the QIAamp FFPE DNA Tissue Kit (45 min) and Gentra Puregene Tissue Kit (3 h). The Gentra Puregene protocol yielded the most DNA followed by the EZ1 method while the QIAamp method produced relatively lower yield with average concentrations of 112, 61 and 40 ng/␮l, respectively. The purity was comparable for all the samples isolated using the three protocols with average A260 /A280 ratios between 1.75 and 1.89. The concentration of DNA obtained from tissue rolls was comparatively higher than slide specimens while purity was nearly similar for rolls and slides for each of the methods used (Table 1). DNA isolated using the EZ1 and QIAamp Tissue Kit protocols performed best in the real-time PCR. The GAPDH target could be amplified successfully and specifically from the isolated DNA samples from all three DNA isolation protocols. The samples normalized to the same concentration from different methods showed comparable CT values with slightly higher average CT values obtained with the Gentra Puregene DNA. The average CT values for the amplification of the GAPDH gene from 10 ng/␮l genomic DNA were 31.5, 29.6 and 29.3 for Gentra Puregene, EZ1 and QIAamp methods, respectively (Table 1). Discussion Currently, FFPE tissues are increasingly used for molecular analyses both in clinical and research laboratories. The removal of the paraffin wax encasing the thin layer of tissue and isolation of sufficient intact DNA are major obstacles to working with these samples. In recent years, the methods and protocols for the isolation of nucleic acids from FFPE tissues have improved enormously [8–10]. For use in routine molecular diagnostics, a successful isolation protocol should be effective, reproducible, less labor-intensive and time-consuming. Here, we describe an efficient protocol for the isolation of genomic DNA from FFPE tissue samples. Based on our observations, the Gentra Puregene Tissue Kit produced highest yield, however, hands-on-time required to isolate the DNA was significantly higher than the other two methods. The real-time PCR performed using the GAPDH gene served as a quality control measure of our DNA purification methods. Generally,

S.S. Sam et al. / Pathology – Research and Practice 208 (2012) 705–707

707

Table 1 Comparison of parameters analyzed for the Qiagen DNA isolation methods. Sample A

ng/l Gentra EZ1 QIAamp A260 /A280 Gentra EZ1 QIAamp CT a Gentra EZ1 QIAamp a

Sample B

Sample C

Sample D

Sample E

Roll

Slide

Roll

Slide

Roll

Slide

Roll

Slide

Roll

Slide

127 38 29

64.4 27 21

151 102 38

73 54 29

131 86 46

83 65 26

208 80 65

146 62 46

73.7 58 62

66 37 44

1.70 1.73 1.68 33.6 30.3 29.9

1.78 1.78 1.88 35.2 31.7 29.4

1.91 1.77 1.98 32.8 31.0 31.3

1.73 1.81 1.90 29.8 31.4 29.3

1.69 1.78 1.93 28.6 27.8 28.1

1.82 1.82 1.92 29.9 27.4 27.0

1.88 1.85 2.00 30.3 28.8 28.8

1.55 1.82 1.86 30.7 28.3 28.6

1.80 1.83 1.84 31.2 29.1 29.7

1.68 1.78 1.88 32.8 30.5 30.6

All samples were normalized to 10 ng/␮l concentration for real-time PCR.

the samples that are too degraded for analysis of housekeeping genes are unsuitable for downstream applications that amplify DNA sequences of similar length [3]. The GAPDH target could be amplified from all isolated DNA samples with lower CT values from EZ1 and QIAamp isolated samples compared to the Gentra protocol. This could indicate a decrease in DNA quality or an increased presence of PCR inhibitors in the DNA obtained with the Gentra protocol. The EZ1 method surpassed the other DNA isolation methods with reduced hands-on-time to produce optimum concentration of high quality DNA for use in routine molecular analyses. Methods that yield high quality DNA with optimum concentration and relatively less hands-on-time for isolation are important factors to consider while processing the DNA samples for downstream applications. The EZ1 method meets those requirements to be used for routine molecular analyses. The method utilizes magnetic-particle technology and therefore produces high-quality DNA suitable for direct use in various molecular applications such as amplification or other enzymatic reactions. The deparaffinization buffer used in the EZ1 protocol remains in the sample tube while Proteinase K digestion is carried out. Thus, the sample loss during the deparaffinization is avoided as sample pelleting and removal of paraffin containing supernatant is not required for this protocol. Initial heating followed by cooling results in sticking of paraffin to the tube walls, and this allows for efficient digestion of the tissues [11]. The main difference in the amount of isolated DNA between the EZ1 and spin column protocols can be attributed to sample loss in silica columns during several processing steps. However, the average A260 /A280 ratios obtained from both the protocols were between 1.8 and 1.89. The results from the real-time PCR demonstrate that the EZ1 method can be potentially used for isolating DNA for downstream molecular applications. Recently, DNA isolated from FFPE tissue using the EZ1 DNA tissue method has been used to investigate high throughput sequencing technologies in cancer genomics, which further supports our observations that the method could be successfully used for downstream applications, allowing for an integrative analysis of tissue samples [12]. In summary, the EZ1 protocol requires less hands-on-time to yield optimum DNA concentration and quality and is found to be

an efficient method for purifying DNA from FFPE tissues. This is a significant factor when the isolation of DNA has to be routinely employed in clinical laboratories for various genetic analyses as molecular techniques are moving rapidly from research to routine use in diagnostic pathology.

References [1] N. Blow, Tissue preparation: tissue issues, Nature 448 (2007) 959–963. [2] U. Lehmann, H. Kreipe, Real-time PCR analysis of DNA and RNA extracted from formalin-fixed and paraffin-embedded biopsies, Methods 25 (2001) 409–418. [3] V.J. Gnanapragasam, Unlocking the molecular archive: the emerging use of formalin-fixed paraffin-embedded tissue for biomarker research in urological cancer, BJU Int. 105 (2010) 274–278. [4] N. Ludyga, B. Grünwald, O. Azimzadeh, S. Englert, H. Höfler, S. Tapio, M. Aubele, Nucleic acids from long-term preserved FFPE tissues are suitable for downstream analyses, Virchows Arch. 460 (2012) 131–140. [5] M.T. Gilbert, T. Haselkorn, M. Bunce, J.J. Sanchez, S.B. Lucas, L.D. Jewell, E. Van Marck, M. Worobey, The isolation of nucleic acids from fixed, paraffinembedded tissues-which methods are useful when? PLoS One 2 (2007) e537. [6] G. Turashvili, W. Yang, S. McKinney, S. Kalloger, N. Gale, Y. Ng, K. Chow, L. Bell, J. Lorette, M. Carrier, M. Luk, S. Aparicio, D. Huntsman, S. Yip, Nucleic acid quantity and quality from paraffin blocks: defining optimal fixation, processing and DNA/RNA extraction techniques, Exp. Mol. Pathol. 92 (2012) 33–43. [7] W.Y. Huang, T.M. Sheehy, L.E. Moore, A.W. Hsing, M.P. Purdue, Simultaneous recovery of DNA and RNA from formalin-fixed paraffin-embedded tissue and application in epidemiologic studies, Cancer Epidemiol. Biomarkers Prev. 19 (2010) 973–977. [8] J.F. Regan, M.R. Furtado, M.G. Brevnov, J.A. Jordan, A sample extraction method for faster, more sensitive PCR-based detection of pathogens in blood culture, J. Mol. Diagn. 14 (2012) 120–129. [9] J.B. Okello, J. Zurek, A.M. Devault, M. Kuch, A.L. Okwi, N.K. Sewankambo, G.S. Bimenya, D. Poinar, H.N. Poinar, Comparison of methods in the recovery of nucleic acids from archival formalin-fixed paraffin-embedded autopsy tissues, Anal. Biochem. 400 (2010) 110–117. [10] C.J. Huijsmans, J. Damen, J.C. van der Linden, P.H. Savelkoul, M.H. Hermans, Comparative analysis of four methods to extract DNA from paraffin-embedded tissues: effect on downstream molecular applications, BMC Res. Notes 3 (2010) 239. [11] Unlocking your FFPE archive: critical factors for molecular analysis of FFPE samples Qiagen FFPE Brochure, 2010. Available at: http://www.qiagen.com/literature/render.aspx?id=200780 [12] M. Kerick, M. Isau, B. Timmermann, H. Sültmann, R. Herwig, S. Krobitsch, G. Schaefer, I. Verdorfer, G. Bartsch, H. Klocker, H. Lehrach, M.R. Schweiger, Targeted high throughput sequencing in clinical cancer settings: formaldehyde fixed-paraffin embedded (FFPE) tumor tissues, input amount and tumor heterogeneity, BMC Med. Genom. 4 (2011) 68.