B Chromosome Polymorphism in Maize Landraces

Copyright Ó 2007 by the Genetics Society of America DOI: 10.1534/genetics.107.075440

B Chromosome Polymorphism in Maize Landraces: Adaptive vs. Demographic Hypothesis of Clinal Variation Vero´nica V. Lia,*,†,‡,1 Viviana A. Confalonieri*,† and Lidia Poggio*,† *Department of Ecology, Genetics, and Evolution, Universidad de Buenos Aires, Buenos Aires, Argentina C1428EHA, †Consejo Nacional de Investigaciones Cientı´ficas y Te´cnicas (CONICET), Buenos Aires, Argentina C1033AAJ and ‡Instituto de Biotecnologı´a, CICVyA, Instituto Nacional de Tecnologı´a Agropecuaria, Castelar, Buenos Aires, Argentina B1712WAA Manuscript received May 3, 2007 Accepted for publication July 27, 2007 ABSTRACT Cytogenetic analysis of maize landraces from northwestern Argentina has revealed an altitudinal cline in the mean number of B chromosomes (B’s) per plant, with cultivars growing at higher altitudes exhibiting a higher number of B’s. Altitudinal and longitudinal clines are frequently interpreted as evidence of selection, however, they can also be produced by the interplay between drift and spatially restricted gene flow or by admixture between previously isolated populations that have come into secondary contact. Here, we test the adaptive significance of the observed altitudinal gradient by comparing the levels of differentiation in the mean number of B’s to those obtained from 18 selectively neutral loci ½simple sequence repeats (SSRs) among seven populations of the cline. The adequacy of alternative genetic-differentiation measures was determined, and associations between cytogenetic, genetic, and altitudinal distances were assessed by means of matrix- correspondence tests. No evidence for association between pairwise FST and altitudinal distance or B-chromosome differentiation was found. The contrasting pattern of altitudinal divergence between the mean number of B’s per plant and the genetic differentiation at SSR loci indicates that demographic processes cannot account for the observed levels of divergence in the mean number of B’s.

B

chromosomes (B’s) are nonessential, extra chromosomes that have been found in all major groups of plants and animals ( Jones and Rees 1982). They are recognized by three criteria: (i) they are dispensable and can be present or absent from individuals within a population, (ii) they do not pair or recombine with any members of the standard diploid (or polyploid) set of A chromosomes at meiosis, and (iii) their inheritance is non-Mendelian and irregular (Beukeboom 1994). B chromosomes’ origin and maintenance in natural populations have been a matter of debate over the past 50 years (Blackwood 1956; Jones and Rees 1982; Carlson 1986; Porter and Rayburn 1990; Carlson and Roseman 1992; Jones 1995). According to the most recent views, these are selfish genetic elements that are derived from the A complement and that maintain their polymorphism by a series of accumulation mechanisms (e.g., mitotic nondisjunction, reduction of meiotic loss) or, much more rarely, by providing their carriers a selective advantage. They can attain extremely high frequencies in natural populations, depending both on the degree to which a particular species can tolerate these additional elements and on the strength of the accumulation mechanisms (Camacho et al. 2000).

1 Corresponding author: Instituto de Biotecnologı´a, CICVyA, INTA Los Reseros y Las Caban ˜ as S/N Castelar, Buenos Aires, Argentina B1712WAA. E-mail: [email protected]

Genetics 177: 895–904 (October 2007)

These interactions result in a dynamic system, which has been interpreted as a host–parasite relationship between the A and B chromosomes ( Jones and Houben 2003). B chromosomes are of particular interest in maize (Zea mays ssp. mays L.). Numerical polymorphisms have been described in a large number of maize landraces (Mcclintock et al. 1981; Chiavarino et al. 1995; Naranjo et al. 1995; Rosato et al. 1998), with differences in the number of B’s being one of the main factors contributing to intraspecific genome-size variation. Although several accumulation mechanisms have been reported for maize B chromosomes (Roman 1947,1948; Carlson and Chou 1981; Carlson and Roseman 1992), the significance of the distinctive patterns of occurrence of these supernumerary elements in different native populations still remains unclear. Attempts to correlate B chromosome frequencies with cytogenetical and environmental variables have yielded somewhat contradictory results. No association was found between the number of B’s and DNA content or the number of heterochromatic bands in 12 Arizona populations (Porter and Rayburn 1990), while negative correlations were reported between B’s and the amount of heterochromatin in both North American and Italian populations (Longley 1938; Bianchi et al. 1963). Bretting and Goodman (1989) noted a generally negative correlation between B chromosomes and altitude in 300

896

V. V. Lia, V. A. Confalonieri and L. Poggio

Mesoamerican populations, but this association was not encountered by Porter and Rayburn (1990). The cytogenetic studies conducted by Rosato et al. (1998) and Poggio et al. (1998) in 21 native populations from northwestern Argentina revealed a negative correlation between the mean number of B’s per plant and the number of heterochromatic bands and a positive correlation between the mean number of B’s per plant and altitude. According to these authors, B’s would be tolerated at high frequencies in those populations with lower numbers of heterochromatic bands, so as to maintain a relatively constant amount of nuclear DNA or an ‘‘optimal’’ nucleotype (sensu Bennett 1987). Although selective pressures may indeed be acting on the conservation of total genomic DNA, this hypothesis does not account for the positive correlation between B’s and altitude. Altitudinal and longitudinal clines of morphological traits, or allelic frequencies, have long been interpreted as evidence of selection. However, clines can also be produced by the interplay between drift and spatially restricted gene flow (isolation by distance) or by admixture between previously isolated populations that have come into secondary contact (Confalonieri et al. 1998; Storz and Dubach 2004). One means of distinguishing between adaptive vs. nonadaptive causes of clinal variation is to compare the relative levels of between-population divergence in the trait under study and in neutral DNA markers (Storz 2002). The rationale behind this approach is that the effects of selection are generally locus specific, whereas demographic processes are expected to have relatively uniform effects across the entire genome (Cavalli-Sforza 1966; Lewontin and Krakauer 1973). Rosato et al. (1998) suggested that the altitudinal cline of B chromosomes found in maize landraces from northwestern Argentina could be the product of selective forces. However, no experimental data were provided to support this assertion. The aim of the present study is to test the adaptive significance of the altitudinal cline of B chromosomes by using neutral molecular markers ½single sequence repeats (SSRs) to assess the levels of genetic divergence of the populations studied by Rosato et al. (1998). If the B chromosome gradient is due to demographical processes related to the history of the populations, the levels of divergence estimated by the neutral markers should also exhibit a clinal pattern of variation. In contrast, if the B polymorphism is in fact subject to selection across the altitudinal gradient, the levels of divergence estimated by the neutral markers should show no association with altitude or B chromosome differentiation among populations.

MATERIALS AND METHODS The seven populations included in this study are a subset of those previously analyzed by Rosato et al. (1998) and were selected on the basis of seed availability from the original

collections performed by these authors during 1994–1995. Populations are distributed spanning an altitudinal distance of 2090 m and over a linear distance of 649 km. Voucher specimens, collection sites, racial identification, cultivar altitudes, mean number of B’s per plant, and sample sizes are given in Table 1. The geographical distribution of populations is presented in Figure 1. Selection of SSR loci: Since simple-sequence-repeat variation is generally considered to be selectively neutral (Schlo¨tterer and Wiehe 1999), a set of SSR loci distributed across the 10 maize chromosomes was used to assess population differentiation at neutral loci. Eighteen SSR were selected from a preliminary survey of 39, with only those loci with unambiguous interpretation being used for analysis. Each chromosome pair was represented by two unlinked loci, except for pairs 8 and 9, in which a single locus was studied. Details of the used loci, including chromosomal location (bin number), putative repeat motifs, and associated primers, are shown in Table 2. Additional information on these loci can be found at the Maize Genetics and Genomics Database (http://www.maizegdb. org/ssr.php). SSR typing: DNA was extracted from 2- to 3-day-old seedlings according to Dellaporta et al. (1983). PCR reaction mixtures contained 1 ml of DNA extract (50 ng), 30 ng each primer, 125 mm each dNTP, 1.5 mm MgCl2, 0.5 unit Taq DNA polymerase (Promega, Madison, WI), 13 PCR buffer and sterile double-distilled water to a final volume of 25 ml. A touchdown cycling profile (annealing temperature 65°–55°) was used and PCR products were separated on a 6% denaturing polyacrylamide gel (8 m urea) following standard procedures. Gels were silver stained with Silver Sequence DNA Staining Reagents (Promega). Alleles were identified by comparison with products of known size using GelPro Analyzer 4.0 (Media Cybernetics, Bethesda, MD). Data analysis: Allele frequencies were calculated with the direct-count method using Fstat version 2.9.3.2 (Goudet 2001). Genotypic linkage disequilibrium was analyzed using Genepop version 3.4. (Raymond and Rousset 1995). Significance levels were modified according to Bonferroni procedures at an overall a ¼ 0.05 (Rice 1989). Genetic differentiation measures: The analysis of SSR data usually entails the use of either of two classes of population differentiation measures: allele identity-based statistics derived from the infinite allele model (IAM) (Kimura and Crow 1964) or allele size-based statistics derived from the stepwise mutation model (SMM) (Kimura and Ohta 1978). SSR markers are frequently assumed to evolve under the SMM, however, the relative efficiency of both types of measures is not only dependent on the mutational process underlying SSR polymorphism, but also on the relative contributions of mutation, drift, and migration. Of the 18 loci included in this study, locus bnlg1018, bnlg1209, bnlg1287, bnlg1070, bnlg1182, bnlg1866, bnlg1732, bnlg1360, and bnlg252 were demonstrated to evolve in a stepwise fashion by Vigouroux et al. (2002); variation at loci bnlg1700 and bnlg1165 was shown to be consistent with the SMM and variation at loci phi121, phi059, nc135, phi037, phi069, phi127, and phi029 was found not to be consistent with this model (Lia et al. 2007). Since the accurate estimation of population differentiation is fundamental in the present study, the allele-size randomization test of Hardy et al. (2003) was used to determine whether allele identity-based (e.g., FST, Wright 1978) or allele size-based statistics (e.g., RST, Slatkin 1995) were most adequate to analyze the stepwise evolving loci. The principle of the test is based on obtaining a distribution of a statistic under the null hypothesis that differences in allele sizes do not contribute to population differentiation. Throughout the

Cytogenetic and Genetic Variation in Maize Landraces

897

TABLE 1 Maize landraces included in the present study

Population identification

Vouchera

Collection site

6167

VAV 6167

6485

VAV 6485

6480

VAV 6480

6484

VAV 6484

6476

VAV 6476

6313

VAV 6313

6482

VAV 6482

El Puesto, Dpto. Santa Victoria, Salta, Argentina Colonia San Jose´, Dpto. Tilcara, Jujuy, Argentina La Cie´naga de Pumamarca, Dpto. Tumbaya, Jujuy, Argentina Tumbaya, Dpto. Tumbaya, Jujuy, Argentina Termas de Reyes, Dpto. Capital, Jujuy, Argentina Los Toldillos, Dpto. Ambato, Catamarca, Argentina La Candelaria, Dpto. Candelaria, Salta, Argentina

Cultivar altitude (m.a.s.l.)

Mean no. of B’s per plantc

Sample size

Altiplano

3000

1.294

14

Blanco

2670

1.795

13

Amarillo Grande

2420

1.596

25

Amarillo Chico

2010

0.204

20

Amarillo Chico

1690

0.255

14

Pisingallo

1600

0.685

16

910

0.122

24

Landraceb

Orgullo Cuarento´n

m.a.s.l, meters above sea level; Dpto., Departamento. a Voucher specimens are deposited at the ‘‘Laboratorio de Recursos Gene´ticos Vegetales N.I. Vavilov’’ (VAV), Faculty of Agronomy, University of Buenos Aires. b Taxonomic identification based on morphological criteria. c Data from Rosato et al. (1998).

randomization procedure, genotypes are defined in terms of allelic states and are not modified, but allele sizes are randomly reassigned among allelic states. The test can thus be designed by comparing the observed RST value to the distribution of permuted RST (pRST) values obtained for all possible configurations of allele-size permutations (or a representative subset of them). A significant test implies that RST performs better than FST, a nonsignificant test implies that FST performs better than RST. The test was conducted as implemented in the spatial pattern analysis of genetic diversity (SPAGeDi) software (Hardy and Vekemans 2002). Global and pairwise u, an unbiased estimate of FST (Weir and Cockerham 1984), were calculated over all loci with the Fstat software package (Goudet 2001). The significance of u values, hereafter referred to as FST, was tested by permuting

genotypes rather than alleles among samples, as this is the preferred method when the Hardy–Weinberg equilibrium is rejected within samples, and was corrected for multiple comparisons using Bonferroni procedures at an overall a ¼ 0.05. Correlation analyses: All tests involving B chromosome comparisons were performed using the variable mean number of  as originally defined by Rosato et al. (1998), B’s per plant (B) which corresponds to the number of B’s per individual averaged across the total number of individuals evaluated in each population. To analyze the relationship between allele frequencies and altitude, and allele frequencies and mean number of B’s per plant, allele frequencies were calculated for each locus and population and used to compute Spearman’s coefficient of rank correlation (rs) with the STATISTICA software package (StatSoft, Tulsa, OK). Significance levels were corrected for multiple comparisons using Bonferroni procedures at an overall a ¼ 0.05. The association between genetic differentiation at SSR loci and B chromosome differentiation, altitudinal distance, and geographic distance was determined using simple Mantel tests (Mantel 1967) as implemented in ISOLDE routine of Genepop version 3.4 (Raymond and Rousset 1995), with FST as a measure of genetic differentiation. Following the approach of Perfectti et al. (2004), B chromosome differentiation among populations was computed as DB ¼ jBi  Bj j, where Bi and Bj represent the mean number of B chromosomes per plant for the ith and jth populations. Altitudinal distances were computed as jxi  xj j, where xi and xj represent altitudes for the ith and jth populations.

RESULTS Figure 1.—Geographic localities of the seven populations included in this study.

A total of 126 individuals were genotyped at the 18 SSR loci. Seventeen loci were polymorphic, with the

898

V. V. Lia, V. A. Confalonieri and L. Poggio TABLE 2 Details of the 18 SSR loci used in this study

Locus bnlg1866 phi037 bnlg1018 phi127 phi029 bnlg1182 nc135 bnlg252 bnlg1700 bnlg1287 bnlg1165 bnlg1732 bnlg1070 phi069 phi121 bnlg1209 phi059 bnlg1360

Primers

Chromosome location (bin)

Repeat motif

Forward 59–39

Reverse 59–39

1.03 1.08 2.04 2.08 3.04 3.09 4.01 4.06 5.03 5.04 6.01 6.05 7.03 7.05 8.03 9.04 10.02 10.07

AG CT AG GTCT CCCT-CT AG AG — AG AG AG AG AG GAC CCG AG ACC AG

CCCAGCGCATGTCAACTCT CCCAGCTCCTGTTGTCGGCTCAGAC CGAGGTTAGCACCGACAAAT ATATGCATTGCCTGGAACTGGAAGGA TTGTCTTTCTTCCTCCACAAGCAGCGAA AGCCGAGTCAGTTCGAGGTA CACAAAGAGCAGCCCACTTT CGTTCTCCGTACAGCACAGACCAACGT GTCACATCCATGTAGTGCACG GCCCTACCTGTTCTGTCTCG CGCTTGCATCATCTCAAGAA AACTTTTGGCATTGCACTGG TTCCAGTAAGGGAGGTGCTG AGACACCGCCGTGGTCGTC AGGAAAATGGAGCCGGTGAACCA GTCCCGGGCAGAATAATACC AAGCTAATTAAGGCCGGTCATCCC TCTGCTCATCCACAACTTGC

CCCCGGTAATTCAGTGGATA TCCAGATCCGCCGCACCTCACGTCA CGAGTAAATGCTCTGTGCCA AATTCAAACACGCCTCCCGAGTGT ATTTCCAGTTGCCACCGACGAAGAACTT CAGGGGCTTGAGGTGAGTTA AAGTTGCTGACATCGATCCA CTCAGATGAACTCCTCAGCAGCTGTAGCCT GGCACCCTTTTGAAACCTTT TGTCCCATACCTCAACGTGA TTCAAGTTTAGCCACCCACC CGTAAGTGCACACGGCATTA TAAGCAACATATAGCCGGGC AGTCCGGCTCCACCTCCTTC TTGGTCTGGACCAAGCACATACAC TTCCTCCTTGAAGTGCTCGT TCCGTGTACTCGGCGGACTC AGAACGTGAAGCTGAGCGTT

only monomorphic locus being phi121. The total number of alleles detected was 184 and the mean number of alleles per locus and population was 5.032 (range: 4.333–6.055). No evidence of linkage disequilibrium was found among loci. Allele frequencies per locus and population are provided as supplemental Table S1 at http://www.genetics.org/supplemental/. Estimates of genetic differentiation (FST vs. RST) The adequacy of FST and RST statistics as measures of genetic differentiation was evaluated using the allele size permutation test of Hardy et al. (2003). Since deviations from the SMM at some loci can reduce the power of the test, only those loci known to conform to model assumptions were included in the analysis. To determine whether differences in the mutational behavior of the loci under study could influence the results of the test, two global estimates were computed: (a) a 9-loci estimate using those SSR found to evolve in a strictly stepwise fashion by mutation-accumulation experiments (Vigouroux et al. 2002) and (b) an 11-loci estimate including bnlg1165 and bnlg1700, whose allele-nucleotide substitution patterns are compatible with the SMM (Lia et al. 2007), although a fit to the model has not been tested experimentally. Allele permutations did not reveal any significant contribution of stepwise mutations to population differentiation with either of the two global estimates (Table 3). Single-locus comparisons were conducted for the 11 loci, with the number of permutations ranging from 120 to 1000 depending on the number of alleles at each locus. The majority of loci (8/11) showed RST values that were not significantly different from pRST. However,

RST was significantly larger than pRST at loci bnlg1866, bnlg1360, and bnlg1165 (Table 3), suggesting that mutation rates are not homogeneous among the 11 SSR loci studied. Overall, the results of the permutation tests indicate that differences in allele sizes do not contribute to population differentiation and that divergence is caused mainly by drift, with gene flow, and/or the reciprocal of

TABLE 3 Contribution of stepwise-like mutations to genetic differentiation as determined by the allele size permutation test of HARDY et al. (2003)

Bnlg1018 Bnlg1209 Bnlg1287 Bnlg1070 Bnlg1182 Bnlg1866 Bnlg1732 Bnlg1360 Bnlg252 Bnlg1700 Bnlg1165 Global (9 loci) Global (11 loci)

RST

pRST (95% C.I.)a

P

0.3266 0.0467 0.0578 0.0063 0.3256 0.3198 0.0050 0.2751 0.2454 0.2937 0.1861 0.2309 0.2310

0.2323 (0.0350–0.4661) 0.1326 (0.0169–0.3021) 0.1097 (0.0156–0.2250) 0.1186 (0.0013–0.2935) 0.2781 (0.0027–0.4790) 0.0911 (0–0.2811) 0.0567 (0–0.1794) 0.1017 (0.0022–0.2379) 0.1826 (0.0339–0.3805) 0.1711 (0.0321–0.3373) 0.0730 (0.0016–0.1595) 0.1633 (0.0874–0.2455) 0.1587 (0.08345–0.2490

0.1968 0.8901 0.7542 0.9670 0.4326 0.0130* 0.9131 0.0080** 0.2298 0.0919 0.0060** 0.0629 0.0559

Values are given for each locus and the multilocus estimates. *P , 0.05, **P , 0.01. a Central pRST and 95% confidence interval values obtained after random permutations of allele sizes.

Cytogenetic and Genetic Variation in Maize Landraces

899

TABLE 4 Genetic differentiation, altitudinal distance, geographic distance, and B chromosome differentiation for each pairwise combination of populations

Population pair 6167-6485 6167-6480 6167-6484 6167-6476 6167-6313 6167-6482 6485-6480 6485-6484 6485-6476 6485-6313 6485-6482 6480-6484 6480-6476 6480-6313 6480-6482 6484-6476 6484-6313 6484-6482 6476-6313 6476-6482 6313-6482

FST

Altitudinal distance (m)

Geographic distance (km)

DB

0.0381** 0.0467** 0.0380** 0.0778** 0.2279** 0.1332** 0.0263** 0.0408** 0.0718** 0.1956** 0.1164** 0.0480** 0.0627** 0.1951** 0.1157** 0.0955** 0.2407** 0.1533** 0.1599** 0.0748** 0.1673**

330 580 990 1310 1400 2090 250 660 980 1070 1760 410 730 820 1510 320 410 1100 900 780 690

151 172 184 220 649 429 22.3 32.4 67.4 509 282 13.2 48.4 491 265 35.1 477 253 440 218 240

0.501 0.302 1.090 1.039 0.609 1.172 0.199 1.591 1.540 1.110 1.673 1.392 1.341 0.911 1.474 0.051 0.481 0.082 0.430 0.133 0.563

**P , 0.01.

the divergence time, being large compared to the mutation rate. Under this scenario, FST should be preferred over RST (Gaggiotti et al. 1999; Hardy et al. 2003). In addition, given that 7 of the 18 SSRs included in this study do not conform to the SMM, the use of FST allows for the 18 loci to be pooled into a single measure of genetic differentiation, even though they have different evolutionary dynamics. Population structure: The analysis of SSR variation revealed a significant degree of genetic subdivision among populations (FST ¼ 0.115, 95% C.I. ¼ 0.094– 0.142). FST values for pairwise comparisons and their significance levels are given in Table 4. A strong pattern of isolation by distance was evident, as revealed by a positive association between pairwise FST and pairwise geographic distances (rs ¼ 0.861, P ¼ 0.009, 5000 permutations) (Figure 2). Genetic differentiation and clinal variation: To investigate whether particular alleles were correlated with altitude or with the B chromosome cline, the frequencies of 183 alleles were compared against altitude and the mean number of B’s per plant by means of Spearman’s coefficient of rank correlation. None of the alleles exhibited a systematic pattern of variation across the altitudinal cline and no association was found between allele frequencies and the mean number of B’s per plant (P . 0.05 for the 183 comparisons).

Figure 2.—Differentiation among populations. Multilocus estimates of pairwise differentiation (FST/1  FST) are plotted against geographic distances. The regression is y ¼ 0.0332x 1 0.0003.

The positive correlation between the mean number of B’s per plant and altitude was originally reported by Rosato et al. (1998) for a sample of 16 populations using simple linear correlations. To verify this correlation for the subset of populations included in this study and to test the sensitivity of the Mantel test to detect such association, the Mantel matrix permutation test was performed for the 7 populations studied here, considering pairwise differences in cultivar altitude and in the mean number of B’s per plant (DB). Again, a positive correlation was found between both variables (rs ¼ 0.484, P ¼ 0.037, 5000 permutations) (Figure 3A), supporting the use of the Mantel test for further comparisons. Despite being distributed across the altitudinal cline, the seven populations analyzed here are not distributed on a linear transect; thus, differences in altitude may not always reflect differences in linear geographic distances. However, there seems to be an overall accordance between these measures, since a positive correlation was found between both distances (rs ¼ 0.493, P ¼ 0.031, 5000 permutations). Given the positive correlations between DB and pairwise altitudinal distances, and pairwise geographic and altitudinal distances, the correlation between DB and geographic distance was also tested, showing no significant association (rs ¼ 0.019, P ¼ 0.445, 5000 permutations) (Figure 3B). As mentioned earlier, if the altitudinal cline of B chromosomes is due to demographic processes, then a positive correlation is also expected between differences in cultivar altitude and the levels of differentiation assessed with the neutral markers. No evidence for association between pairwise FST and altitudinal distance was found (rs ¼ 0.325, P ¼ 0.147, 5000 permutations) (Figure 3C). An additional prediction of the demographic hypothesis is that differences in the mean number of B’s per plant should also be positively correlated with population differentiation at neutral markers. No significant

900

V. V. Lia, V. A. Confalonieri and L. Poggio

Figure 3.—Genetic differentiation and clinal variation. Plots of (A) pairwise DB against altitudinal distances between populations, (B) pairwise DB against geographic distances between populations, (C) pairwise FST against altitudinal distances between populations, and (D) pairwise DB against pairwise FST.

association was found between DB and pairwise FST (rs ¼ 0.091, P ¼ 0.653, 5000 permutations) (Figure 3D), indicating that between-population differences in the mean number of B’s per plant are independent of their neutral genetic background. A compelling example is given by the pairwise comparison involving populations 6476 and 6480, which in spite of showing a rather low FST value (FST ¼ 0.064) it also exhibits one of the highest differences in the mean number of B’s per plant (DB ¼ 1.341). DISCUSSION

The results presented here support the adaptive significance of the altitudinal cline of B chromosomes originally described by Rosato et al. (1998). The contrasting pattern of altitudinal divergence between the mean number of B’s per plant and the genetic differentiation at SSR loci indicates that demographic processes cannot account for the observed levels of divergence in the mean number of B’s (Figure 3). No evidence of clinal variation was found at the 18 SSR loci included in this study, either on a global or on an individual basis, as demonstrated by the lack of correlation between allele frequencies and altitude. Moreover, if the altitudinal cline of B chromosomes had been the product of secondary contact, the effects of admixture would have been readily detectable. Admixture is expected to produce a bimodal distribution of pairwise FST values and linkage disequilibrium among loci that have different allele frequencies in the separate source populations (Storz and Dubach 2004). However, none of these phenomena was apparent.

The positive association between geographic and genetic distances (Figure 2) suggests that the seven populations distributed along the cline are at migrationdrift equilibrium (Hutchinson and Templeton 1999). This implies that there are no significant barriers to dispersal and that the clinal distribution of B chromosomes persists, even in the presence of gene flow. Tests of natural selection along environmental clines often rely on the comparison of the population structures of the characters on which selection may act and on that of neutral molecular markers (Gockel et al. 2001). Here, comparison of the levels of neutral genetic differentiation with both the mean number of B’s per plant and pairwise altitudinal distances explicitly incorporates the relevant environmental variable into the analysis. Previous authors have used partial matrix correspondence tests to determine whether the association between morphological and environmental variables remained significant after controlling for neutral genetic divergence within the context of isolation by distance (Gubitz et al. 2000; Storz 2002). Partial correlation analyses were not required in the present study, given that neither DB nor pairwise altitudinal distances showed a significant association with pairwise FST. It could be argued that between-population differences in the mean number of B’s per plant do not provide an accurate estimate of B chromosome differentiation, since it may not be clear whether this measure represents genetic or phenotypic variation. To be meaningful, pairwise differences in the mean number of B’s should be intimately related to the genetic variation underlying this character. The genetic basis

Cytogenetic and Genetic Variation in Maize Landraces

of the mechanisms involved in the transmission of maize B’s seems to support this assumption. Three main accumulation mechanisms determine the number of B’s: (i) directed nondisjunction in the second pollen grain mitosis (Roman 1947; Carlson and Chou 1981), (ii) preferential fertilization by male gametes carrying B’s (Roman 1948), and (iii) reduction of meiotic loss (Carlson and Roseman 1992). Recent studies on the dynamics of B transmission have demonstrated that a single autosomal gene controls preferential fertilization when B’s are transmitted on the male side (Chiavarino et al. 1998, 2001), whereas on the female side a low transmission allele from a different autosomal locus seems to be implicated in promoting meiotic loss (Gonza´lez-Sa´nchez et al. 2003). How could selection act on the maintenance of the cline? Some effects of the B chromosomes appear to be attributable to the products of their genes, as is the case with genes controlling resistance to rust in the B chromosomes of Avena sativa (Dherawattana and Sadanaga 1973) and with the genes conferring resistance to antibiotics in the B chromosomes of the fungus Nectria haematococca (Miao et al. 1991). Maize B chromosomes are highly repetitive in nature and share the vast majority of their sequences with the regular complement (Peacock et al. 1981; Cheng and Lin 2003, 2004). Transcription of B-specific sequences was recently reported for the first time by Lamb et al. (2007). Portions of a retroposon-derived element were found to be differentially expressed in B-carrying individuals and the absence of polyadenylation suggested they are not translated into proteins. How the expression of these elements relates to the B life cycle is still unclear; however, their involvement in the altitudinal gradient described here cannot be discarded. If not a consequence of their gene products, the selective advantages, or disadvantages, of B’s may stem from their physical presence in the nucleus. There is ample evidence that B chromosomes can affect a multitude of cellular and physiological processes in both plants and animals (for a review, see Camacho et al. 2000; Jenkins and Jones 2004). Among the most remarkable, B chromosomes have been shown to affect mean cell chiasma frequency and the distribution of chiasmata within the A complement ( Jones 1995; Colombo and Confalonieri 2004; Riera et al. 2004). Similar effects have been reported for maize (Hanson 1969), where the late replicating heterochromatin of the B’s has been proposed to extend the first meiotic prophase therefore lengthening the time during which recombination takes place (Rhoades and Dempsey 1972). In addition to an increase in recombination, several cytological abnormalities have been demonstrated to derive from the presence of B’s in maize plants. Micronucleus formation and A chromosome instability were found to be significantly increased in the tapetal cells of B-carrying individuals (Chiavarino et al.

901

2000), and reduced pollen viability was encountered in female high B-transmission lines, particularly in those plants having B’s (Gonza´lez-Sa´nchez et al. 2004). The selective basis of the cline does not necessarily imply that selection is acting directly on maize B chromosomes, because the positive association between B’s and altitude could also be a by-product of selection at other traits. Earlier studies have shown that the occurrence of two or more B’s induces loss of chromosomal segments from A chromosomes containing large blocks of heterochromatin (knobs) (Rhoades and Dempsey 1973). Given that maize knobs replicate very late relative to euchromatin (Pryor et al. 1980; Buckler et al. 1999) and that this may impact the rate of cell division and plant development, it has been suggested that large amounts of heterochromatin are not favored under the harsher climates and shorter growing seasons of high-altitude elevations (Reeves et al. 1998; Buckler et al. 1999). In agreement with this proposal, a negative correlation between altitude and knobs was found in the populations analyzed by Rosato et al. (1998), as well as a negative correlation between knobs and the mean number of B’s per plant. In this context, the increase in the number of B’s as a function of altitudinal distances may be interpreted as a consequence of their effects on the amount of heterochromatin in the autosomes. Although maize B’s are also heterochromatic, and they have been shown to lengthen replication time, ‘‘preference’’ for some type of heterochromatin over the other may still exist, as it has been reported that the different classes of heterochromatin have their own distinctive impact on the duration of the cell cycle (Pryor et al. 1980). An alternative explanation to the adaptive basis of the cline may reside in the genes controlling B transmission. As previously mentioned, two autosomal loci seem to govern these mechanisms (Chiavarino et al. 2001; Gonza´lez-Sa´nchez et al. 2003). If linkage disequilibrium exists between those alleles favoring B transmission and the alleles of some other locus subjected to selection in response to altitude, then the observed cline could be produced as a result of hitchhiking. Implications for B chromosome evolution in maize: Regardless of the identity and the nature of the selective forces acting on the maintenance of the cline, the implications of our findings in terms of B chromosome evolutionary dynamics still need to be considered. The two most widely accepted models of B-chromosome evolution are the heterotic model (White 1973) and the parasitic or selfish model ( Jones 1985). The heterotic model assumes an equilibrium balance between the positive fitness effects of B chromosomes (which show no accumulation mechanisms) when they occur in low numbers and their negative effects when they occur in high numbers. For the parasitic–selfish model, the equilibrium is the result of B chromosome accumulation and of its detrimental effects on the fitness

902

V. V. Lia, V. A. Confalonieri and L. Poggio

of B-chromosome carriers (Camacho et al. 2000). A nonequilibrium model of long-term evolution has also been proposed by Camacho et al. (1997) on the basis of the behavior of B chromosomes in the grasshopper Eyprepocnemis plorans. According to this model, B’s are neutralized by the A genome through the evolution of genes that suppress drive. Such neutralized B chromosomes are destined to disappear after a long period of stochastic fluctuation, in the course of which the B’s can mutate into a new parasitic variant with high drive that restarts the cycle again. Overall, the three models can be envisaged as particular instances of genomic conflict between A and B chromosomes, each model involving different strategies of attack and defense within a host–parasite relationship (Frank 2000). However, which one of them best explains the B-chromosome polymorphism described here is not easy to determine. The evidence provided in this study indicates that selective forces are acting on the maintenance of the altitudinal cline in the mean number of B’s. However, clinal variation may arise either as a consequence of a beneficial effect of B’s at higher elevations or as a result of B’s being negatively selected at lower elevations, but increasingly tolerated with altitude. Strict compliance to the heterotic model would imply assuming the first case scenario and the absence of accumulation mechanisms, a criterion which is clearly not met by maize B’s. Conversely, the secondcase scenario is easily reconciled with a parasitic model in which the antagonistic forces leading to the equilibrium state in each population (i.e., accumulation and fitness reduction) change in magnitude as altitude increases. Although our observations can indeed be interpreted under the assumptions of the parasitic model, this model does not fully incorporate the complexities of the interaction between the A and B chromosomes studied here. The nonequilibrium model of long-term evolution, in which B influences may shift from parasitic to neutral and even beneficial, provides a more suitable framework for the interpretation of our results. High variation for B transmission rate (KB) has been reported among individuals from population 6313 on both the male (KB ¼ 0.98–0.17) and the female (KB ¼ 0.58–0.31) side, and the genetic component of this variation has been demonstrated (Rosato et al. 1996; Chiavarino et al. 2001; Gonza´lez-Sa´nchez et al. 2003). Although the transmission rate of B’s has not been determined for the remaining populations of this study, these results indicate that a polymorphic system already exists in the A complement to counteract B accumulation mechanisms and thus promote B neutralization. In its final stage, the model suggests the possibility that neutralization can be overcome by the regeneration of new B variants that recuperate drive. We have no evidence for the generation of new B variants in maize landraces, and no differences in the size or morphology of B’s were detected among the populations of the cline.

A coevolution model of B attack and A defense has already been proposed in maize to explain the distinctive B-transmission dynamics in males and females (Gonza´lez-Sa´nchez et al. 2003). From these results it was concluded that two autosomal loci are primarily responsible for B transmission, with a male dominant high-transmission allele that tends to increase the number of B’s over Mendelian expectations and a female dominant low-transmission allele that tends to decrease it. In this connection, the estimation of the allelic frequencies of the genes controlling B transmission in the populations of the cline would provide further insights to determine whether B chromosomes are being positively selected (e.g., a higher frequency of high-transmission alleles at higher elevations) or simply tolerated at higher altitudes. In conclusion, the altitudinal cline described here and the selective forces acting on its maintenance constitute a new level of complexity in the host–parasite relationship between the A and B chromosomes of maize. Future work is still needed to clarify whether B chromosomes are a direct target of selection or if they are genetically correlated with another trait under direct selection. We thank the late C. Naranjo, J. Ca´mara Herna´ndez, and A. M. Miante Alzogaray for providing us the plant material and for carrying out the taxonomic classification of the landraces included in this study. We are also indebted to the anonymous reviewers who have greatly improved this manuscript. Several grants from the Consejo Nacional de Investigaciones Cientı´ficas y Te´cnicas (PIP 02296), the University of Buenos Aires (EX-317), and the Agencia Nacional de Promocio´n Cientı´fica y Tecnolo´gica (BID 1201 OC-AR PICT 04443) are gratefully acknowledged.

LITERATURE CITED Bennett, M. D., 1987 Variation in genomic form in plants and its ecological implications. New Phytol. 106: 177–200. Beukeboom, L. W., 1994 Bewildering Bs: an impression of the 1st Bchromosome conference. Heredity 73: 328–336. Bianchi, A., M. V. Ghatnekar and A. Ghidoni, 1963 Knobs in italian maize. Chromosoma 14: 601–617. Blackwood, M., 1956 The inheritance of B chromosomes in Zea mays. Heredity 10: 353–366. Bretting, P. K., and M. M. Goodman, 1989 Karyotipic variation in Mesoamerican races of maize and its systematic signficance. Econ. Bot. 43: 107–124. Buckler, IV, E. S., T. L. Phelps-Durr, C. S. K. Buckler, R. K. Dawe, J. F. Doebley et al., 1999 Meiotic drive of chromosomal knobs reshaped the maize genome. Genetics 153: 415–426. Camacho, J. P. M., M. W. Shaw, M. D. Lo´pez–Leo´n, M. C. Pardo and J. Cabrero, 1997 Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am. Nat. 149: 1030–1050. Camacho, J. P. M., T. F. Sharbel and L. W. Beukeboom, 2000 Bchromosome evolution. Philos. Trans. R. Soc. Lond. 355: 163– 178. Carlson, W. R., 1986 The B chromosome of maize. Crit. Rev. Plant Sci. 3: 201–226. Carlson, W. R., and T. S. Chou, 1981 B chromosome nondisjunction in corn: control by factors near the centromere. Genetics 97: 379–389. Carlson, W. R., and R. Roseman, 1992 A new property of the maize B chromosome. Genetics 131: 211–223.

Cytogenetic and Genetic Variation in Maize Landraces Cavalli-Sforza, L. L., 1966 Population structure and human evolution. Proc. R. Soc. Lond. B 164: 362–379. Cheng, Y. M., and B. Y. Lin, 2003 Cloning and characterization of maize B chromosome sequences derived from microdissection. Genetics 164: 299–310. Cheng, Y. M., and B. Y. Lin, 2004 Molecular organization of large fragments in the maize B chromosome: indication of a novel repeat. Genetics 166: 1947–1961. Chiavarino, A. M., M. Rosato, C. A. Naranjo, J. Camara Hernandez and L. Poggio, 1995 B chromosome polymorphism in N. Argentine populations of maize. Maize Genet. Coop. News Lett. 69: 94. Chiavarino, A. M., M. Rosato, P. Rosi, L. Poggio and C. A. Naranjo, 1998 Localization of the genes controlling B chromosome transmission rate in maize (Zea mays ssp. mays, Poaceae). Am. J. Bot. 85: 1581–1585. Chiavarino, A. M., M. Rosato, S. Manzanero, G. Jime´nez, M. Gonza´lez-Sa´nchez et al., 2000 Chromosome nondisjunction and instabilities in tapetal cells are affected by B chromosomes in maize. Genetics 155: 889–897. Chiavarino, A. M., M. Gonza´lez Sa´nchez, L. Poggio, J. Puertas, M. Rosato et al., 2001 Is maize B chromosome preferential fertilization controlled by a single gene? Heredity 86: 743–748. Colombo, P., and V. A. Confalonieri, 2004 Cytogeography and the evolutionary significance of B-chromosomes in relation to inverted rearrangements in a grasshopper species. Cytogenet. Genome Res. 106: 351–358. Confalonieri, V., A. Sequeira, L. Todaro and J. C. Vilardi, 1998 Mitochondrial DNA and phylogeography of the grasshopper Trimerotropis pallidipennis in relation with clinal distribution of chromosome polymorphisms. Heredity 81: 444–452. Dellaporta, I. K., J. Wood and J. B. Hicks, 1983 A plant DNA minipreparation: version II. Plant Mol. Biol. Rep. 1: 19–21. Dherawattana, A., and K. Sadanaga, 1973 Cytogenetics of a crown, rust-resistant hexaploid oat with 42 1 2 fragment chromosomes. Crop Sci. 13: 591–594. Frank, S. A., 2000 Polymorphism of attack and defense. Trends Ecol. Evol. (Amst.) 15: 167–171. Gaggiotti, O. E., O. Lange, K. Rassmann and C. Gliddon, 1999 A comparison of two indirect methods for estimating average levels of gene flow using microsatellite data. Mol. Ecol. 8: 1513–1520. Gockel, J., W. J. Kennington, A. Hoffmann, D. B. Goldstein and L. Partridge, 2001 Nonclinality of molecular variation implicates selection in maintaining a morphological cline of Drosophila melanogaster. Genetics 158: 319–323. Gonza´lez-Sa´nchez, M., E. Gonza´lez-Gonza´lez, F. Molina, A. M. Chiavarino, M. Rosato et al., 2003 One gene determines maize B chromosome accumulation by preferential fertilization; another gene(s) determines their meiotic loss. Heredity 90: 122– 129. Gonza´lez-Sa´nchez, M., M. Rosato, M. Chiavarino and M. J. Puertas, 2004 Chromosome instabilities and programmed cell death in tapetal cells of maize with B chromosomes and effects on pollen viability. Genetics 166: 999–1009. Goudet, J., 2001 FSTAT, a program to estimate and test gene diversities and fixation indices,version 2.9.3. (http://www.unil.ch/ popgen/softwares/fstat.htm) Gubitz, T., R. S. Thorpe and A. Malhotra, 2000 Phylogeography and natural selection in the Tenerife gecko Tarentola delalandii: testing historical and adaptive hypotheses. Mol. Ecol. 9: 1213– 1221. Hanson, G. P., 1969 B-chromosome-stimulated crossing over in maize. Genetics 63: 601–609. Hardy, O. J., and X. Vekemans, 2002 SPAGeDi: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes 2: 618–620. Hardy, O. J., N. Charbonnel, H. Fre´ville and M. Heuertz, 2003 Microsatellite allele sizes: a simple test to assess their significance on genetic differentiation. Genetics 163: 1467–1482. Hutchinson, D. W., and A. R. Templeton, 1999 Correlation of pairwise genetic and geographic distance measures: Inferring the relative influences of gene flow and drift on the distribution of genetic variability. Evolution 53: 1898–1914. Jenkins, G., and R. N. Jones, 2004 B chromosomes in hybrids of temperate cereals and grasses. Cytogenet. Genome Res. 106: 314–319.

903

Jones, R. N., 1985 Are B chromosomes selfish?, pp. 397–425 in The Evolution of Genome Size, edited by T. Cavalier-Smith. John Wiley & Sons, New York. Jones, R. N., 1995 Tansley Review No. 85. B chromosome in plants. New Phytol. 131: 411–434. Jones, R.N., and A. Houben, 2003 B chromosomes in plants: escapees from the A chromosome genome? Trends Plant Sci. 8: 417–423. Jones, R. N., and H. Rees, 1982 B Chromosomes. Academic Press, New York. Kimura, M., and J. F. Crow, 1964 The number of alleles that can be maintained in a finite population. Genetics 49: 725–738. Kimura, M., and T. Ohta, 1978 Stepwise mutation model and distribution of allelic frequencies in finite populations. Proc. Natl. Acad. Sci. USA 75: 2868–2872. Lamb, J. C., N. C. Riddle, Y. M. Cheng, J. Theuri and J. A. Birchler, 2007 Localization and transcription of a retrotransposonderived element on the maize B chromosome. Chromosome Res. 15: 383–398. Lewontin, R. C., and J. Krakauer, 1973 Distribution of gene frequency as a test of the theory of the selective neutrality of polymorphisms. Genetics 74: 175–195. Lia, V. V., M. Bracco, A. M. Gottlieb, L. Poggio and V. A. Confalonieri, 2007 Complex mutational patterns and size homoplasy at maize microsatellite loci. Theor. Appl. Genet. (in press). Longley, A. E., 1938 Chromosomes of maize from North American Indians. J. Agric. Res. 56: 177–195. Mantel, N., 1967 The detection of disease clustering and a generalized regression approach. Cancer Res. 27: 209–220. McClintock, B., T. A. Kato and A. Blumenschein, 1981 Chromosome Constitution of the Races of Maize. Colegio de Postgraduados, Chapingo, Me´xico. Miao, V. P., S. F. Convert and H. D. VanEtten, 1991 A fungal gene for antibiotic resistance on a dispensable (B) chromosome. Science 254: 1773–1776. Naranjo, C. A., A. M. Chiavarino, M. Rosato, E. Quintela Ferna´ndez and L. Poggio, 1995 Taman ˜ o del genoma y polimorfismo para cromosomas B en razas nativas argentinas y bolivianas de maiz., pp. 969–980. Abstracts of the III Latin American and XVI Andean Zone of Maize Researchers Meeting, Bolivia. Peacock, W. J., E. S. Dennis, M. M. Rhoades and A. J. Pryor, 1981 Highly repeated DNA sequence limited to knob heterochromatin in maize. Proc. Natl. Acad. Sci. USA 78: 4490–4494. Perfectti, F., M. P. Ita, C. G. de la Vega, J. Gosalvez and J. P. M. Camacho, 2004 Spatio-temporal dynamics of a neutralized B chromosome in the grasshopper Eyprepocnemis plorans. Cytogenet. Genome Res. 106: 376–385. Poggio, L., M. Rosato, A. M. Chiavarino and C. A. Naranjo, 1998 Genome size and environmental correlations in maize (Zea mays ssp. mays, Poaceae). Ann. Bot. 82: 107–115. Porter, H. L., and A. L. Rayburn, 1990 B-chromosome and C-band heterochromatin variation in Arizona maize populations adapted to different altitudes. Genome 33: 659–662. Pryor, A., K. Faulkner, M. M. Rhoades and W. J. Peacock, 1980 Asynchronous replication of heterochromatin of maize. Proc. Natl. Acad. Sci. USA 77: 6705–6709. Raymond, M., and F. Rousset, 1995 GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86: 248–249. Reeves, G., D. Francis, M. S. Davies, H. J. Rogers and T. R. Hodkinson, 1998 Genome size is negatively correlated with altitude natural populations of Dactylis glomerata. Ann. Bot. 82: 99–105. Rhoades, M. M., and E. Dempsey, 1972 On the mechanism of chromatin loss induced by the B chromosome of maize. Genetics 71: 73–96. Rhoades, M. M., and E. Dempsey, 1973 Chromatin elimination induced by the B chromosome of maize. J. Hered. 64: 13–18. Rice, W., 1989 Analysing tables of statistical tests. Evolution 43: 223– 225. Riera, L., E. Petitpierre, C. Juan, J. Cabrero and J. P. M. Camacho, 2004 Evolutionary dynamics of a B chromosome invasion in island populations of the grasshopper Eyprepocnemis plorans. J. Evol. Biol. 17: 716–719. Roman, H., 1947 Mitotic nondisjunction in the case of interchanges involving the B type chromosome in maize. Genetics 32: 391–409. Roman, H., 1948 Directed fertilization in maize. Proc. Natl. Acad. Sci. USA 34: 36–42.

904

V. V. Lia, V. A. Confalonieri and L. Poggio

Rosato, M., A. M. Chiavarino, M. J. Puertas, C. A. Naranjo and L. Poggio, 1996 Genetic control of the B chromosome transmission rate in Zea mays (Poaceae). Am. J. Bot. 83: 1107–1112. Rosato, M., A. M. Chiavarino, C. A. Naranjo, J. Ca´mara Herna´ndez and L. Poggio, 1998 Genome size and numerical polymorphism for the B chromosome in races of maize (Zea mays ssp. mays, Poaceae). Am. J. Bot. 85: 168–174. Schlo¨tterer, C., and T. Wiehe, 1999 Microsatellites a neutral marker to infer selective sweeps, pp. 238–248 in Microsatellites Evolution and Applications, edited by D. Goldstein and C. Schlo¨tterer. Oxford University Press, London. Slatkin, M., 1995 A measure of population subdivision based on microsatellite allele frequencies. Genetics 139: 457–462. Storz, J. F., 2002 Contrasting patterns of divergence in quantitative traits and neutral DNA markers: analysis of clinal variation. Mol. Ecol. 11: 2537–2551.

Storz, J. F., and J. M. Dubach, 2004 Natural selection drives altitudinal divergence at the albumin locus in deer mice, Peromyscus maniculatus. Evolution 58: 1342–1352. Vigouroux, Y., J. S. Jaqueth, Y. Matsuoka, O. S. Smith, W. D. Beavis et al., 2002 Rate and pattern of mutation at microsatellite loci in maize. Mol. Biol. Evol. 19: 1251–1260. Weir, B., and C. C. Cockerham, 1984 Estimating F-statistics for the analysis of population structure. Evolution 38: 1358–1370. White, M. J. D., 1973 Animal Cytology and Evolution. Oxford University Press, London. Wright, S., 1978 Evolution and the Genetics of Populations, Volume 4: Variability Within and Among Natural Populations. University of Chicago Press, Chicago. Communicating editor: J. A. Birchler