The small (768 bp) bacterial insertion sequence, IS], exhibits an array of eight open ..... specified by equivalent ISJ-sequences under control of the. T7 promoter ...
The EMBO Journal vol.10 no.3 pp.705-712, 1991
Translational control of transposition activity of the bacterial insertion sequence IS1
J.M.Escoubas, M.F.Prere, O.Fayet, I.Salvignol, D.Galas1, D.Zerbib and M.Chandler Centre de Recherche de Biochimie et Gendtique Cellulaire du CNRS, 118 route de Narbonne, 31062 Toulouse Cedex, France and 'Molecular Biology, University of Southern California, Los Angeles, CA 90089-1481, USA Communicated by L.Caro
The experiments reported here provide strong evidence indicating that the transposition frequency of the bacterial insertion sequence IS] is determined principally by two ISJ-specified proteins. The first, InsA, was previously shown to bind to the ends of the element and to act as a repressor. We present both physical and genetic evidence which reveals that the second, the InsAB' transposase, is a fusion of InsA with the product of a downstream reading frame, InsB'. Synthesis of this protein occurs by a -1 frameshift between the insA and insB' frames. It requires the presence of an intact retroviral-like frameshift signal composed of an A6C motif and a downstream region able to form several alternative secondary structures. In vivo studies show that IS1 transposition activity depends on the relative rather than on the absolute levels of InsA and InsAB'. The ratio is determined primarily at the translational level by frameshifting and appears to be relatively insensitive to large variations in levels of transcription. This novel homeostatic control could therefore protect IS] from activation as a consequence of insertion into active transcription units.
Key words: frameshift/homeostatic control/ISI/transposition
the product of the insA reading frame has been detected using the P1 promoter of phage X placed upstream of the left end of IS1 (Zerbib et al., 1987). The deduced amino acid
1
IRL I
P1RL
I IRR
jnsB
ins,4
,nsB' nisAB'
i)-S-
A
AU~ sC C
1)
Cc
.AkAAAAAA.A.tUjiA C _1I.G
--m A
UA 2)
A
c u
C
c
c
CCCUUUAAAACUACCCCACCCCUA -CC
U
U
C A CC OCOCCO AC C
A
uc cCt UCACO 3)
U M-l- C-,I C GC
cCCC C GCCA-UUUAAAAmCUCAGGCC
Introduction The small (768 bp) bacterial insertion sequence, IS], exhibits an array of eight open reading frames (ORFs) which could specify proteins of > 50 amino acids in length. The integrity of two of these, insA and insB, is essential for wild-type transposition levels of an IS1 element carried by a high copy number plasmid (Machida et al., 1984a; Jackowec et al., 1988). Both are encoded on the same strand of IS]. The downstream, insB-containing frame exhibits two potential initiation codons: one (IS] coordinate 376) defines the insB frame, and a second (IS] coordinate 250), which extends InsB by 42 amino acids at its amino-terminal end, defines the insB' frame (Ohtsubo and Ohtsubo, 1978). The insB (insB ) frame is in phase -1 with respect to insA. Translation of both frames presumably occurs from a mRNA transcribed from a promoter located partially within the left terminal inverted repeat (PmL; Figure 1; Chan and Lebowitz, 1982; Machida et al., 1984b; Gamas et al., 1987). An ISI-encoded protein exhibiting the size expected for © Oxford University Press
-
--m__ _
Fig. 1. The organization of IS]. Left (IRL) and right (IRR) terminal inverted repeats are indicated as filled boxes on the element. The frameshift window is shown as an open box. The RNA sequence of this region together with potential secondary structures is included at the bottom of the figure. The insA reading phase together with its UAA termination codon and the insB and the insB' phases are indicated below the sequence. The insA (co-ordinates 56-329; filled box) and insB (co-ordinates 376-751; open box) and insB' (coordinates 250-751; open box) reading frames are indicated under the element. PIRL represents the promoter which drives insA and insAB' transcription. The 'reading frame' used in the synthesis of the fusion protein is represented as insAB'. 1: Potential secondary structure within the minimal cloned window (Figure 2B) 2, 3 and 4: Potential secondary structures contained within the extended window (Figure 2C). The structure shown in 4 indicates the possibility of formation of a weak pseudoknot (Brierly et al., 1989; Schimmel, 1989).
705
J.M.Escoubas et al.
sequence of InsA predicts that it has a strong oahelix-turn-a-helix motif near the carboxy-terminus, a characteristic of several regulatory DNA binding proteins (Pabo and Sauer, 1984; Dodd and Egan, 1990) and indeed, it was demonstrated that InsA binds specifically to both ends of IS] (Zerbib et al., 1987). Further studies (Zerbib, 1987; Zerbib et al., 1990a) have shown that InsA recognizes a region within IRL which overlaps the putative -35 sequence of the insA promoter and negatively regulates its own expression, and presumably that of other protein(s) encoded downstream (Machida and Machida, 1989; Zerbib et al., 1990b). Additional results using a synthetic ISI-based transposon (Q-on) suggest that InsA repression might also operate directly by inhibition of transposition activity at the ends of ISJ (Zerbib et al., 1990b). We have been consistently unable to detect a translation product exhibiting the size predicted for InsB. A suggestion that insB or insB' may not be expressed independently but that the IS] transposase may be produced by a -1 translational frameshift between insA and insB' to generate an InsA-InsB' fusion protein (InsAB'; Galas and Chandler, 1989; Sekine and Ohtsubo, 1989, Luthi et al., 1990) stemmed from the observation that IS1 carries a region located in the 3' end of the gene which resembles that found to provoke the -1 gag-pro frameshift in many retroviruses (Jacks et al., 1988). It has been proposed that frameshifting occurs between insA and insB' prior to the AAC codon within an A6C motif located in the 3' end of insA (Sekine and Ohtsubo, 1989). This would generate a fusion in which A i7 'T !f;e^K 0T
'
the potential DNA binding motif of InsA (Zerbib et al., 1987) is conserved. Indeed, a mutant IS] carrying an insertion of an A residue within this motif to generate a -1 change in reading frame has been shown to transpose at a 102-fold higher frequency than a wild-type IS] and it was suggested that this is the result of constitutive synthesis of the putative fusion protein (Sekine and Ohtsubo, 1989). In the results reported here, we demonstrate using a specially designed plasmid vector (Weiss et al., 1990), that the A6C motif provokes a low level -1 translational frameshift. We show, moreover, that InsAB' is produced from IS] 'in vivo' and, that constitutive expression of the protein induces transposition of an ISI-based trasposon at a frequency of >0.2% ( - 3 x 103 fold higher than obtained with a wild-type plasmid). Furthermore, the results of measurements of transposition in vivo suggest that IS] transposition activity is not determined by the absolute amount of the InsAB' transposase but rather by the ratio of InsA and InsAB', itself determined by the frameshift frequency. This suggests a novel mechanism for assuring homeostatic control of IS] transposition.
Results The IS1 frameshifting window The general organization of IS1 together with the position of the potential frameshifting region and its nucleotide sequence are shown in Figure 1. In order to determine A -l->(.1t
A -kAI( _T"
Fig. 2. Cloned frameshift window. The relevant restriction sites within the cloned lacZ gene of the vector plasmid together with the reading phase are shown at the top of the figure. The oligonucleotides used in the construction of the plasmids are indicated on the left of the figure by vertical bars. The A6C motif is underlined. The TAA termination codon in the insA phase is indicated by asterisks. Mutations introduced within the A6C motif are boxed. The levels of 3-galactosidase specified by these plasmids in Miller units is indicated at the right of the figure together with the standard error. Five independent measurements were obtained in each case.
706
Translational control of IS 1 transposition
whether the region carrying the A6C and stem -loop motif is able to provoke a -1 frameshift, we have cloned a series of overlapping complementary oligonucleotides (Figure 2B), representing IS] co-ordinates 300-352, into a plasmid carrying a lacZ reporter gene (Figure 2; Weiss et al., 1990; Materials and methods). Translation enters the cloned frameshift 'window' in the InsA (0) phase. The distal portion of the f-galactosidase gene is in the InsB (-1) phase. The occurrence of a -1 frameshift in this plasmid would therefore result in 3-galactosidase synthesis. Constitutive galactosidase levels were determined using the plasmid shown in Figure 2A which carries a small in-phase insertion including the A6C motif. Under standard assay conditions (Materials and methods) the level of induced ,B-galactosidase specified by this plasmid was determined to be 28 900 units whereas that specified by the plasmid carrying the frameshift window was 220 units. This indicates a frameshift frequency of 0.76%. Mutagenesis of the A6C motif within the mouse mammary tumor virus (MMTV) frameshift window has shown that this motif is important in determining the level of frameshifting. Mutation to A6G results in an increase while mutation to ACA4C results in a decrease in frequency (Weiss et al., 1990). We have analyzed the behaviour of two similar derivatives of IS]. As expected from the frameshifting properties of MMTV, a derivative carrying the A6G mutation exhibits an increase (3-fold, Figure 2D) whereas that carrying ACA4C exhibits a decrease (4.5-fold, Figure 2F) in 3-galactosidase synthesis. Assuming that the activity and stability of 3-galactosidase (or the stability of the mRNAs) is not significantly affected by the small 5' insertions carried by the hybrid genes (e.g. Fowler and Zabin, 1983), these results demonstrate that IS] sequences direct frameshifting between the InsA (0) and InsB (-1) frames. It has been shown that the sequence context of this 'window' is also important in determining frameshift frequencies. Secondary structures in the downstream region can stimulate frameshifting presumably by increasing ribosome pausing (Brierly et al., 1989; Weiss et al., 1990). Although the cloned window of IS] (Figure 2B) carries a potential stem-loop structure (structure 1 in Figure 1), additional structures are possible in the presence of 3' sequences (structures 2,3 and 4, Figure 1; Hubner et al., 1987). To determine whether sequences downstream stimulate frameshifting in IS], a plasmid carrying the region 300-373 (which includes the entire insAlinsB intergenic region) was constructed (Figure 2C). It specifies 315 units of ,Bgalactosidase, a 1.43-fold increase compared with the 'minimal' region. Moreover, inclusion of this region in the plasmid carrying the A6G mutation (Figure 2D) results in a similar (1.67-fold) increase (Figure 2E). f-
Detection of the InsAB' fusion protein synthesized from IS1 To analyze IS]-specified proteins, we have constructed a series of plasmids carrying various derivatives of IS] in which the endogenous insA promoter, ribosome binding site and initiation codon have been substituted by the phage T7 10 promoter and translation initiation signals (Dunn and Studier, 1983). To determine whether a fusion protein, InsAB', is specified by a wild-type IS] and can be detected 'in vivo', we have used two plasmids. One of these, pZBT29
(Figure 3; Zerbib et al., 1987), carries the major part of
IS] including wild-type insA and insB' frames. The second,
pMET1 1
(Figure 3), is identical to pZBT29 but carries an A insertion within the A6C motif (A7C; Figure 3A; Materials and methods). Translation in the insA frame should result in a protein with a predicted molecular weight of 26.5 kd. Since the induced reading frame change occurs before the InsA termination codon, no InsA should be produced. The proteins directed by these plasmids following induction and labelling in the presence of rifampicin are shown in the autoradiograph of Figure 3A. The vector plasmid, pAR3039 (lane 1), specifies trace amounts of flactamase (apparent mol. wt 27.6 kd) whose gene is located downstream of a T7 transcription terminator. As expected, pMET1 1 (lane 2) does not produce InsA (9.8 kd) but specifies a prominent protein species with an apparent mol. wt of 27.6 kd. The plasmid carrying the wild-type IS] sequence, pZBT29 (lane 3), produces the InsA protein in large amounts together with a protein of apparent mol. wt 27.6 kd. To determine whether this band includes a natural frameshift product or solely the vector-associated ,Blactamase (predicted mol. wt: 28.9 kd), the insB' orf carried by pZBT29 and pMET1 1 was truncated at its 3' end by introduction of a 2 bp insertion at the unique MluI site (IS] coordinate 431). The insertion introduces a change in reading phase at codon 19 of InsB and places a termination codon (TGA) 25 codons downstream in this new phase. This should generate a fusion protein of predicted molecular weight 16.9 kd. The proteins produced by the resulting plasmids (pMET15 and pMET 14) are shown in Figure 3A. Like pZBT29, pMET15 produces InsA (9.8 kd, lane 5). The larger protein observed from both pMET1 1 and pZBT29 is, however, absent in both pMET14 (lane 4) and pMET15 (lane 5) and is replaced with a species of apparent molecular weight 17.6 kd, close to the predicted size for the truncated product. This result demonstrates that IS] produces a fusion protein composed of an InsA amino-terminal portion and an InsB' carboxy-terminal domain. To confirm that this protein is produced by frameshifting at the A6C motif, we have investigated the effect of the A6G mutation on the level of production of the 27.6 kd protein. The results obtained in the T7 system with a plasmid carrying this mutation (pMET18, Figure 3B, lane 3) show that the level of the 27.6 kd protein is increased by a factor of 2.5 compared with the wild-type plasmid (pZBT29, lane 4). This value is similar to that obtained from measurements of,3-galactosidase activities. Transposition in vivo To investigate the effect of the various IS]-specified proteins, provided in cis, on IS] transposition we have used two
transposition systems.
The first uses an IS]-based transposon (Q-on; Prentki et al., 1987), composed of two 29 bp synthetic IS] left ends flanking a gene which specifies resistance to streptomycin and spectinomycin (Prentki and Krisch, 1984). The use of such a transposon, which does not specify its own transposition proteins, rather than IS] itself, eliminates possible effects due to endogenous expression. Wild-type and mutated IS] sequences carried by the T7 expression plasmids were transferred together with the T7 translation initiation signals,
placed under the control of the phage X P1 promoter (Materials and methods) and introduced into the Ql-oncarrying plasmid pMET8. Transposition activity of these 707
J.M.Escoubas et al.
A ;*
.
