Bacterial lipopolysaccharide induces rainbow trout myotube atrophy ...

Download PDF
3 downloads 142 Views 362KB Size Report
Comment
Sep 3, 2015 - 1Facultad de Ciencias Biológicas, Universidad Andrés Bello, Santiago 8370146, Chile, and 2Interdisciplinary Center for Aquaculture Research ...
Acta Biochim Biophys Sin, 2015, 47(11), 932–937 doi: 10.1093/abbs/gmv087 Advance Access Publication Date: 3 September 2015 Original Article

Original Article

Bacterial lipopolysaccharide induces rainbow trout myotube atrophy via Akt/FoxO1/Atrogin-1 signaling pathway J.E. Aedo1, A.E. Reyes1,2, R. Avendaño-Herrera1,2, A. Molina1,2, and J.A. Valdés1,2,* 1

Facultad de Ciencias Biológicas, Universidad Andrés Bello, Santiago 8370146, Chile, and 2Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción, Chile

*Correspondence address. Tel: +56-2661-8363; Fax: +56-2661-8415; E-mail: [email protected] Received 28 April 2015; Accepted 28 June 2015

Abstract Lipopolysaccharide (LPS) is considered as a powerful inducer of muscle atrophy in higher vertebrates due to skeletal muscle cell recognition of the endotoxin and a consequent activation of catabolic signaling pathways. In contrast, there is no evidence of LPS directly inducing skeletal muscle atrophy in lower vertebrates, such as fish. For years it has been assumed that fish are resistant to LPS, mainly due to differences in the key features of toll-like receptor (TLR) signaling pathways when compared with mammals. In this study, we report that the stimulation of cultured rainbow trout (Oncorhynchus mykiss) myotubes with LPS (100 ng/ml) resulted in a transient decrease in the pAkt/Akt ratio, a subsequent reduction in the pFoxO1/FoxO1 ratio, and a significant increase in atrogin-1 transcript expression. Preincubation with polymyxin B, an LPS-neutralizing agent, and 740 Y-P, an agonist of p85-PI3K, blocked the effects of LPS. Additionally, LPS treatment induced an increase in protein ubiquitination and a reduction in myotube diameter, both of which are associated with muscular atrophy that is not observed under polymyxin B and 740 Y-P pretreatments. Finally, rainbow trout myotubes expressed the genes tlr1, tlr3, tlr5m, tlr8a1, tlr8a2, tlr9, and tlr22, with significantly increased expressions of tlr5m and tlr9 under LPS stimulation. These results indicate that LPS is an inducer of fish skeletal muscle atrophy and suggest that TLR5M and TLR9 may play important roles in detecting LPS, which supports for the first time the hypothesis that LPS is a direct inducer of skeletal muscle atrophy in teleost species. Key words: LPS, teleost, skeletal muscle atrophy

Introduction Lipopolysaccharide (LPS), also known as endotoxin, is the most important virulence factor associated with endotoxic shock in higher animals [1]. Although LPS is present in endotoxic shock-resistant lower vertebrates, such as fish [2], it exerts several symptoms and clinical signs associated with diminished growth rates [3]. In vivo and in vitro experiments in fish have shown that LPS administration stimulates B lymphocyte proliferation and macrophage activation [4,5]. Fish macrophages stimulated with LPS show enhanced phagocytosis, lysozyme and respiratory burst activities, and nitric oxide and

prostaglandin E2 synthesis [6,7]. Macrophages also respond to LPS by generating proinflammatory cytokines such as interleukin-1β and tumor necrosis factor (TNF) α [8,9]. These cytokines are associated with detrimental changes in skeletal muscle [10,11]. In fish, very little is known about the effects of LPS in skeletal muscle, with only two studies suggesting that LPS induces skeletal muscle atrophy [12,13]. In the first study, chronic LPS administration decreased the skeletal muscle ratio in rainbow trout (Oncorhynchus mykiss), and changes in gene expression were mostly related to lipid metabolism and the immune response [12]. In the second study,

© The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. 932

LPS induces skeletal muscle atrophy in fish intraperitoneal LPS administration in gilthead seabream (Sparus aurata) induced an up-regulation of genes involved in carbohydrate metabolism and protein synthesis at 24 h, but this pattern was reversed at 72 h through the down-regulation of genes involved in carbohydrate/ protein metabolism and the immune response [13]. These data demonstrate that LPS is an inducer of fish muscle atrophy; however, it is not clear if the atrophic process is directly mediated by the interaction of LPS with skeletal muscle and/or indirectly through the activity of proinflammatory cytokines. The role of LPS as a direct modulator of muscle atrophy has been studied in mammalian models. In these models, LPS induces C2C12 myotube atrophy by up-regulating autophagosome formation and the expression of ubiquitin ligase Atrogin-1 and MuRF1, which is mediated by the p38/MAPK signaling pathway [14]. Additionally, Tarabees et al. [15] demonstrated that LPS prevents protein synthesis by inhibiting the Akt/mTOR/P70S6K signaling pathway. These previous studies also revealed that the catabolic effects of LPS in C2C12 myotubes are mediated by the toll-like receptor 4 (TLR4), the most characteristic pathogen pattern recognition receptor of LPS in mammals [16]. Genomic and transcriptomic studies have shown that many teleost species lack TLR4 orthologs; however, several species express fish-specific TLRs as well as downstream factors of TLR signaling [17]. At present, there are no published studies describing TLR expression in fish skeletal muscle. The aim of this work was to demonstrate the role of LPS as a direct inducer of fish skeletal muscle atrophy through modulation of the Akt/FoxO1/Atrogin-1 signaling pathway. Furthermore, the first evidence of TLR mRNA expression in rainbow trout myotubes was provided.

Materials and Methods Reagents Bacterial LPS (cat. No. L3012) and polymyxin B (cat. No. P1004) were purchased from Sigma-Aldrich (St Louis, USA), while 740 Y-P (cat. No. 1983) was purchased from Tocris Bioscience (Ellisville, USA). Antibodies against phospho-Akt (cat. No. 9271), Akt (cat. No. 9272), phospho-FoxO1/3 (cat. No. 9464), Forkhead box protein O1 (FoxO1, cat. No. 2880), ubiquitin (cat. No. 2880), β-actin (cat. No. 4967), and horseradish peroxidase (HRP)-conjugated anti-rabbit and anti-mouse secondary antibodies were obtained from Cell Signaling Technology (Beverly, USA).

Cell cultures Skeletal myotubes were prepared from 5 g of O. mykiss muscle as previously reported [18]. Briefly, fish were reared and used according to protocols preapproved by the Bioethical Committee of the Universidad Andrés Bello. Dorsal white muscle was obtained under sterile conditions and collected in Dulbecco’s modified Eagle’s medium (DMEM) containing 9 mM NaHCO3, 20 mM HEPES, 15% horse serum, 100 U/ml penicillin, and 100 µg/ml streptomycin at pH 7.4. After mechanical dissociation of the muscle, the tissue was digested with a 0.2% collagenase solution in DMEM for 1 h at 18°C. The suspension was centrifuged at 300 g for 5 min at 15°C, and the resulting pellet was subject to two rounds of enzymatic digestion with a 0.1% trypsin solution in DMEM for 20 min at 18°C. The cellular suspension was filtered through 100 and 40 µm nylon filters. Cells were seeded at a density of 2 × 106 cells per well in plates previously treated with poly-L-lysine and laminin. Cells were incubated at 18°C for 7 days under an air atmosphere and in a proliferating medium

933 containing F10, 9 mM NaHCO3, 20 mM HEPES, 10% fetal bovine serum, 100 U/l penicillin, and 100 µg/ml streptomycin. Then, cells were cultured for an additional 7 days in a differentiating medium composed of F10, 9 mM NaHCO3, 20 mM HEPES, 100 U/ml penicillin, and 100 µg/ml streptomycin to obtain differentiated myotubes.

Western blot analysis After treatment, cells were solubilized at 4°C in 30 µl of lysis buffer containing 50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 5 mM Na3VO4, 20 mM NaF, 10 mM sodium pyrophosphate, and a protease inhibitor cocktail (Calbiochem, San Diego, USA). Protein extracts were resolved by 10% SDS–PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Bedford, USA), and blocked for 1 h at room temperature in Tris-buffered saline, 0.1% Tween 20, and 5% fat-free milk. Incubations with primary antibodies (1:2000) were performed at 4°C overnight. After incubation for 1 h with HRP-conjugated secondary antibodies (1:2000), membranes were developed by using an enhanced chemiluminescence kit (Amersham Biosciences, Amersham, UK). The films were scanned, and the ImageJ program was employed for densitometric analysis of the bands [19].

Real-time qPCR Total RNA was extracted from myotubes with the TRIzol Reagent (Invitrogen, Carlsbad, USA), and cDNA was synthesized using M-MLV reverse transcriptase and random primers (Invitrogen). cDNA was amplified using atrogin-1 and tlr primers, and the DNA concentration was normalized against β-actin. The primers used are listed in Table 1. qPCR analysis was performed using the Stratagene MX3000P qPCR system (Stratagene, Cedar Creek, USA). Each qPCR reaction mixture contained 7.5 µl of 2× Brilliant® II SYBR® Master Mix (Stratagene), 6 µl of cDNA (40-fold dilution), and 250 nM of each primer. The QGene program was used for analyzing gene expression [20].

Myotube diameter measurements Myotubes were loaded with 5.4 mM calcein AM (Invitrogen) for 30 min at 18°C in an F10 medium. Importantly, cleavage by intracellular esterases leaves the active form of calcein trapped inside the cell. Myotubes were transferred to the recording chamber and mounted on an inverted fluorescence microscope. Fluorescence was detected using excitation at 488 nm and emission at 540 nm, and images were collected. Diameters were measured in a total of 50 myotubes from random fields using the ImageJ program [19]. Myotubes were measured at three points along their length, and results were expressed as the percentage of the diameter relative to the control group.

Statistical analysis Data are expressed as the mean ± SE. The differences in means between groups were determined using one-way ANOVA followed by Bonferroni’s posttest.

Results LPS inhibits Akt and FoxO1 phosphorylation and induces atrogin-1 mRNA expression Incubation of rainbow trout myotubes with LPS (100 ng/ml) resulted in a transient 32% decrease in Akt phosphorylation (Fig. 1A,B). The lowest Akt phosphorylation rate was observed at 30 min postincubation with

LPS induces skeletal muscle atrophy in fish

934

Table 1. Primers used in qRT–PCR Gene

GenBank accession No.

Primer

Sequence (5′ → 3′)

atrogin-1

NM_001193326.1

tlr1

NM_001166101.1

tlr3

NM_001124578.1

tlr5m

NM_001124744.1

tlr5s

NM_001124208.1

tlr7

GQ422119.1

tlr8a1

GQ422121.1

tlr8a2

GQ422120.1

tlr9

NM_001129991.1

tlr22

NM_001124412.1

β-actin

KC888023.1

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

TGCGATCAAATGGATTCAAA GATTGCATCATTTCCCCACT AGCCAGTTACGTGGTGGAAC CGAACACAGCGTTTATGGTG CTGATTGCTTGAAGCCCATT GCCTTTGAAGGTGGTGTTGT GACCCAGACAGGCAAACATT ACCTCTCTCAGCGGACTGAA CATCGCCCTGCAGATTTTAT CAGAGAGACGAGGCCTTTGA CCCCAGAGGTCAGATTGTGT CTTCCAGCAAAGAGGAGCAC TGGCATCATTGTTCCTGTGT CTTTCTCAGTCGACGCTCCT GGAGGCATCCCAATAAAACA AAATGAGAGGCCAACCAATG GGACAACCTGGCGTACCTTA CCCATGCCTCTCATTAGGAA ACGGTTGGCTTTAGAGAGCA CTCGTGAGCACCACTTTCAA GCCGGCCGCGACCTCACAGACTAC CGGCCGTGGTGGTGAAGCTGTAAC

LPS when compared with the control, but basal levels were recovered at 60 min postincubation. During the testing period, no variations were observed in the total Akt protein levels. The transcription factor FoxO1 is a target for Akt and is associated with muscular atrophy, and the phosphorylation of FoxO1 is related to decreased transcription activity [21]. Myotubes treated with LPS showed a 28% decrease in FoxO1 phosphorylation at 90 min postincubation (Fig. 1C,D). No changes in the total levels of FoxO1 were observed. atrogin-1 gene expression is transcriptionally controlled by the FoxO1 transcription factor [22]. RT–qPCR results revealed that myotubes incubated with LPS had a 3.6-fold increase in atrogin-1 mRNA expression at 6 h posttreatment (Fig. 1E).

treatment triggered a significant decrease in myotube diameter, which is associated with the muscular atrophy process, but this decrease did not occur under preincubation with polymyxin B and 740 Y-P (Fig. 3B). While the rainbow trout does not have TLR4 orthologs [17], rainbow trout myotubes expressed the genes tlr1, tlr3, tlr5m, tlr8a1, tlr8a2, tlr9, and tlr22 (Fig. 3C). No gene expression was observed for tlr5s and tlr7 (data not shown). Stimulating rainbow trout myotubes with LPS resulted in significantly increased expression of tlr5m and tlr9 at 9 h posttreatment. Altogether, these results strongly suggest the involvement of the TLR and PI3K signaling pathways in LPS-induced myotube atrophy.

LPS induces atrogin-1 mRNA expression by the PI3K signaling pathway

Discussion

To distinguish the signaling pathways involved in LPS-induced atrogin-1 expression, pharmacological agents were used because fish skeletal myoblasts have poor transfection efficiencies. Preincubation with 5 µg/ml polymyxin B, an LPS-neutralizing agent [23], reversed the inhibitory effects of LPS on Akt (Fig. 2A,B) and FoxO1 phosphorylation (Fig. 2C,D). Complementary to this, preincubation with 10 μg/ml 740 Y-P, an agonist of p85-PI3K [24] and known upstream activator of Akt, blocked the effect of LPS on Akt (Fig. 2A,B) and FoxO1 phosphorylation (Fig. 2C,D). Likewise, atrogin-1 mRNA expression was significantly reduced in the presence of these inhibitors (Fig. 2E). Taken together, these results indicate that LPS induces atrogin-1 mRNA expression through the PI3K/Akt/FoxO1 signaling pathway.

LPS induces myotube atrophy To determine whether treatment with LPS effectively induces atrophy in fish myotubes, protein ubiquitination levels were measured at 12 h posttreatment with LPS. Increased ubiquitination occurred with LPS treatment, but this effect was inhibited by pretreatment with polymyxin B and 740 Y-P (Fig. 3A). Over the testing period, no variations were observed in the protein levels of β-actin. Additionally, LPS

The present work indicates for the first time the role of LPS as a direct inducer of skeletal muscle atrophy in fish and provides evidence on the signaling pathway that mediates this process. Stimulating rainbow trout myotubes with LPS resulted in a significant increase in atrogin-1 gene expression which is one of the most characterized regulators of skeletal muscle atrophy in vertebrates [25]. Additionally, LPS-induced protein ubiquitination and decreased the diameter of myotubes, which are also associated with skeletal muscle atrophy. Although there are no previous reports of a direct effect of LPS on teleost skeletal muscle atrophy, systemic administration of LPS triggers changes in gene expression of gilthead seabream [13] and rainbow trout [12], which is related to skeletal muscle atrophy. Similarly, LPS can induce skeletal muscle atrophy in mammals. In vivo intravenous administration of nonlethal doses of LPS to rats decreases Akt/FoxO1/3 phosphorylation in the extensor digitorum longus muscle and increases the mRNA levels of atrogin-1, murf-1, il-6, and tnf-α [26], which is similar to the present findings. Moreover, direct administration of LPS into rat gastrocnemius muscle strongly promotes the early induction of il-6 mRNA in the injected muscle but not in contralateral muscles [27]. However, these results do not rule out the possibility that the observed reaction to LPS might be the product of resident macrophages in skeletal

LPS induces skeletal muscle atrophy in fish

Figure 1. LPS inhibits Akt/FoxO1 phosphorylation and induces atrogin-1 expression in rainbow trout myotubes (A) Representative western blots of phosphorylated Akt and total Akt. Trout myotubes were stimulated with LPS (100 ng/ml) for each indicated times. (B) Densitometric analysis of the western blot showing pAkt/Akt ratio. (C) Representative western blot of phosphorylated FoxO1/3 and total FoxO1. Trout myotubes were stimulated with LPS (100 ng/ml) for each indicated times. (D) Densitometric analysis of western blot showing pFoxO1/FoxO1 ratio. (E) atrogin-1 expression in trout myotubes stimulated with 100 ng/ml LPS for each indicated times. atrogin-1 mRNA levels were analyzed by RT–qPCR and expressed as a relative expression normalized with respect to β-actin. Data are represented as the mean ± SEM of duplicates from three independent experiments and are expressed as fold change relative to values in control cells. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. control group.

935

Figure 2. LPS induces atrogin-1 mRNA expression mediated by the PI3K signaling pathway (A) Representative western blots showing phosphorylated Akt and total Akt. Myotubes were incubated for 60 min with polymyxin B (5 μg/ml) or 740 Y-P (10 μg/ml) and then stimulated with or without 100 ng/ml LPS, and protein extracts were obtained 30 min after LPS stimulation. (B) Densitometric analysis of western blots showing pAkt/Akt ratio. (C) Representative western blots showing phosphorylated FoxO1 and total FoxO1. Myotubes were incubated for 60 min with polymyxin B (5 μg/ml) or 740 Y-P (10 μg/ml) and then stimulated with or without 100 ng/ml LPS, and protein extracts were obtained 90 min after LPS stimulation. (D) Densitometric analysis of western blots showing pFoxO1/ FoxO1 ratio. (E) atrogin-1 expression in trout myotubes preincubated with polymyxin B and 740 Y-P and stimulated with 100 ng/ml LPS for each indicated time. atrogin-1 mRNA levels were analyzed by RT–qPCR and expressed as a relative expression normalized with respect to β-actin. Data are represented as the mean ± SEM of duplicates from three independent experiments and are expressed as fold change relative to values in control cells. ***P < 0.001 vs. control group, &&P < 0.01, and &&&P < 0.001 vs. LPS group.

LPS induces skeletal muscle atrophy in fish

936

Figure 3. LPS induces myotubes atrophy mediated by the PI3K signaling pathway (A) Representative western blots showing protein ubiquitination, total ubiquitin, and β-actin. Trout myotubes were incubated for 60 min with polymyxin B (5 μg/ml) or 740 Y-P (10 μg/ml) and then stimulated with or without 100 ng/ml LPS, and protein extracts were obtained 12 h after LPS stimulation. (B) Myotube diameters were expressed as a percentage of the diameter relative to the control group. Trout myotubes were preincubated for 60 min with polymyxin B (5 μg/ml) or 740 Y-P (10 μg/ml) and then stimulated with or without 100 ng/ml LPS. Analysis was performed 36 h after stimulation. (C) The expressions of tlr1, tlr3, tlr5m, tlr8a1, tlr8a2, tlr9, and tlr22 in trout myotubes stimulated with LPS (100 ng/ml) for each indicated time. mRNA levels of TLRs were analyzed by RT–qPCR and expressed as a relative expression normalized with respect to β-actin. Data are represented as the mean ± SEM of duplicates from three independent experiments and are expressed as fold change relative to values in control cells. *P < 0.05 vs. control group; &P < 0.05 vs. LPS group.

muscle [28]. Therefore, using a skeletal muscle cell culture is extremely useful because of its reduced complexity when compared with the in vivo models, as well as of the avoidance of the indirect effect of LPS in muscle atrophy through the immune response.

Concerning the signaling pathways that mediate atrogin-1 expression, the current study revealed the direct participation of Akt and FoxO1, which had not been observed in other vertebrate models. Specifically in C2C12 myotubes, previous studies have reported that LPS produces a dose- and time-dependent increase in tnf-α and il-6 mRNA levels [29,30], as well as a decrease in igf-1 [31] and igfbp-5 [32] mRNA levels. The signaling pathways associated with cytokine mRNA expressions are the Jun N-terminal kinase [29] and NF-κB [30]. Additionally, LPS increases nos2 mRNA expression in muscle via a TLR4-dependent mechanism [33]. Regarding the signaling pathways that mediate muscle atrophy, there are conflicting results. Frost et al. [34] showed that LPS alone has no effect on protein synthesis in C2C12 myotubes, but the combination of LPS and interferon-γ significantly decreases protein synthesis by down-regulating the autophosphorylation of mTOR and its substrates S6K1 and 4EBP-1. In contrast, Russell et al. [35] and Tarabees et al. [15] demonstrated that LPS alone induces a significant decrease in protein synthesis in the same C2C12 myotubes, which is mediated through the ubiquitin/ proteasome and Akt/mTOR pathways, respectively. The present findings are the first to report a direct effect of LPS on fish skeletal muscle atrophy through regulation of the FoxO1/Atrogin-1 signaling pathway. The mechanism of FoxO1/Atrogin-1 signaling in vertebrate muscle atrophy has been described [36], showing the involvement of FoxO1/ Atrogin-1 in teleost muscle atrophy in fine flounder (Paralichthys adspersus) during fasting [37]. Interestingly, in trout myotubes, IGF-I induces the phosphorylation of FoxO1 and FoxO4 in association with decreased transcriptional activities [38]. Additionally, treatment of trout myotubes with myostatin, an inhibitor of skeletal muscle growth, inhibits the activation of the growth-promoting TORC1 signaling pathway, but activates the ubiquitin/proteasome and autophagy pathways [39]. It is unclear which receptor mediates the response to LPS in fish. TLR4 is the canonical LPS receptor described in mammals; however, a large percentage of teleost species lack TLR4 orthologs [17]. While the TLR1, TLR3, TLR5M, TLR5S, TLR7, TLR8a1, TLR8a2, TLR9, and TLR22 have been identified in rainbow trout [17], there are no previous reports of TLR expression in fish skeletal muscle. In this work, rainbow trout myotubes were found, similar to C2C12 myotubes, to express a large number of TLRs, including tlr1, tlr3, tlr5m, tlr8a1, tlr8a2, tlr9, and tlr22 [40]. Stimulating rainbow trout myotubes with LPS resulted in a significant increase in the expression of tlr5m and tlr9, suggesting that TLR5M and TLR9 may play important roles in LPS sensing. All these results suggest that LPS may induce myotube atrophy through the up-regulation of atrogin-1 mRNA expression which is mediated by the TLR and PI3K/Akt/FoxO1 signaling pathways.

Funding This study was supported by the grants from the Universidad Andrés Bello (No. Núcleo DI-447-13/N) and the National Commission for Scientific and Technological Research (CONICYT/FONDAP) (No. 15110027).

References 1. Tan Y, Kagan JC. A cross-disciplinary perspective on the innate immune responses to bacterial lipopolysaccharide. Mol Cell 2014, 54: 212–223. 2. Berczi I, Bertók L, Bereznai T. Comparative studies on the toxicity of Escherichia coli lipopolysaccharide endotoxin in various animal species. Can J Microbiol 1966, 12: 1070–1071.

LPS induces skeletal muscle atrophy in fish 3. Swain P, Nayak S, Nanda P, Dash S. Biological effects of bacterial lipopolysaccharide (endotoxin) in fish: a review. Fish Shellfish Immunol 2008, 25: 191–201. 4. Dalmo RA, Seljelid R. The immunomodulatory effect of LPS, laminaran and sulphated laminaran [beta(l,3)-D-glucan] on Atlantic salmon, Salmo salar L., macrophages in vitro. J Fish Dis 1995, 18: 175–185. 5. Uchiyama T. Modulation of immune response by bacterial lipopolysaccharide (LPS): roles of macrophages and T cells in vitro adjuvant effect of LPS on antibody response to T cell-dependent and T cell-independent antigens. Microbiol Immunol 1982, 26: 213–225. 6. Qin QW, Ototake M, Noguchi K, Soma G, Yokomizo Y, Nakanishi T. Tumor necrosis factor alpha (TNFalpha)-like factor produced by macrophages in rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol 2001, 11: 245–256. 7. Paulsen SM, Lunde H, Engstad RE, Robertsen B. In vivo effects of betaglucan and LPS on regulation of lysozyme activity and mRNA expression in Atlantic salmon (Salmo salar L.). Fish Shellfish Immunol 2003, 14: 39–54. 8. Zou J, Wang T, Hirono I, Aoki T, Inagawa H, Honda T, Soma GI, et al. Differential expression of two tumor necrosis factor genes in rainbow trout, Oncorhynchus mykiss. Dev Comp Immunol 2002, 26: 161–172. 9. Goetz FW, Iliev DB, McCauley LAR, Liarte CQ, Tort LB, Planas JV, Mackenzie S. Analysis of genes isolated from lipopolysaccharide-stimulated rainbow trout (Oncorhynchus mykiss) macrophages. Mol Immunol 2004, 41: 1199–1210. 10. Pooley NJ, Tacchi L, Secombes CJ, Martin SA. Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar). BMC Genomics 2013, 14: 747. 11. Vraskou Y, Roher N, Diaz M, Antonescu CN, MacKenzie SA, Planas JV. Direct involvement of tumor necrosis factor- in the regulation of glucose uptake in rainbow trout muscle cells. Am J Physiol Regul Integr Comp Physiol 2011, 300: R716–R723. 12. Johansen KA, Sealey WM, Overturf K. The effects of chronic immune stimulation on muscle growth in rainbow trout. Comp Biochem Physiol B Biochem Mol Biol 2006, 144: 520–531. 13. Kaitetzidou E, Crespo D, Vraskou Y, Antonopoulou E, Planas JV. Transcriptomic response of skeletal muscle to lipopolysaccharide in the gilthead seabream (Sparus aurata). Mar Biotechnol 2012, 14: 605–619. 14. Doyle A, Zhang G, Abdel Fattah EA, Eissa NT, Li Y-P. Toll-like receptor 4 mediates lipopolysaccharide-induced muscle catabolism via coordinate activation of ubiquitin-proteasome and autophagy-lysosome pathways. FASEB J 2011, 25: 99–110. 15. Tarabees R, Hill D, Rauch C, Barrow PA, Loughna PT. Endotoxin transiently inhibits protein synthesis through Akt and MAPK mediating pathways in C2C12 myotubes. Am J Physiol Cell Physiol 2011, 301: C895–C902. 16. Lu Y-C, Yeh W-C, Ohashi PS. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42: 145–151. 17. Palti Y. Toll-like receptors in bony fish: from genomics to function. Dev Comp Immunol 2011, 35: 1263–1272. 18. Gabillard JC, Sabin N, Paboeuf G. In vitro characterization of proliferation and differentiation of trout satellite cells. Cell Tissue Res 2010, 342: 471–477. 19. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 2012, 9: 671–675. 20. Simon P. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics 2003, 19: 1439–1440. 21. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, et al. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 2004, 14: 395–403. 22. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, et al. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117: 399–412.

937 23. Cavaillon JM, Haeffner-Cavaillon N. Polymyxin-B inhibition of LPS-induced interleukin-1 secretion by human monocytes is dependent upon the LPS origin. Mol Immunol 1986, 23: 965–969. 24. Derossi D, Williams EJ, Green PJ, Dunican DJ, Doherty P. Stimulation of mitogenesis by a cell-permeable PI 3-kinase binding peptide. Biochem Biophys Res Commun 1998, 251: 148–152. 25. Moresi V, Williams AH, Meadows E, Flynn JM, Potthoff MJ, McAnally J, Shelton JM, et al. Myogenin and class II HDACs control neurogenic muscle atrophy by inducing E3 ubiquitin ligases. Cell 2010, 143: 35–45. 26. Crossland H, Constantin-Teodosiu D, Gardiner SM, Constantin D, Greenhaff PL. A potential role for Akt/FOXO signalling in both protein loss and the impairment of muscle carbohydrate oxidation during sepsis in rodent skeletal muscle. J Physiol 2008, 586: 5589–5600. 27. Lang CH, Silvis C, Deshpande N, Nystrom G, Frost RA. Endotoxin stimulates in vivo expression of inflammatory cytokines tumor necrosis factor alpha, interleukin-1beta, -6, and high-mobility-group protein-1 in skeletal muscle. Shock 2003, 19: 538–546. 28. Pillon NJ, Bilan PJ, Fink LN, Klip A. Cross-talk between skeletal muscle and immune cells: muscle-derived mediators and metabolic implications. Am J Physiol Endocrinol Metab 2013, 304: E453–E465. 29. Frost RA, Nystrom GJ, Lang CH. Lipopolysaccharide and proinflammatory cytokines stimulate interleukin-6 expression in C2C12 myoblasts: role of the Jun NH2-terminal kinase. Am J Physiol Regul Integr Comp Physiol 2003, 285: R1153–R1164. 30. Frost RA, Nystrom GJ, Lang CH. Lipopolysaccharide regulates proinflammatory cytokine expression in mouse myoblasts and skeletal muscle. Am J Physiol Regul Integr Comp Physiol 2002, 283: R698–R709. 31. Frost RA, Nystrom GJ, Lang CH. Tumor necrosis factor-alpha decreases insulin-like growth factor-I messenger ribonucleic acid expression in C2C12 myoblasts via a Jun N-terminal kinase pathway. Endocrinology 2003, 144: 1770–1779. 32. Lang CH, Krawiec BJ, Huber D, McCoy JM, Frost RA. Sepsis and inflammatory insults downregulate IGFBP-5, but not IGFBP-4, in skeletal muscle via a TNF-dependent mechanism. Am J Physiol Regul Integr Comp Physiol 2006, 290: R963–R972. 33. Frost RA, Nystrom GJ, Lang CH. Lipopolysaccharide stimulates nitric oxide synthase-2 expression in murine skeletal muscle and C(2)C(12) myoblasts via Toll-like receptor-4 and c-Jun NH(2)-terminal kinase pathways. Am J Physiol Cell Physiol 2004, 287: C1605–C1615. 34. Frost RA, Nystrom GJ, Lang CH. Endotoxin and interferon-gamma inhibit translation in skeletal muscle cells by stimulating nitric oxide synthase activity. Shock 2009, 32: 416–426. 35. Russell ST, Siren PMA, Siren MJ, Tisdale MJ. Mechanism of attenuation of protein loss in murine C2C12 myotubes by d-myo-inositol 1,2,6-triphosphate. Exp Cell Res 2010, 316: 286–295. 36. Tang H, Inoki K, Lee M, Wright E, Khuong A, Khuong A, Sugiarto S, et al. mTORC1 promotes denervation-induced muscle atrophy through a mechanism involving the activation of FoxO and E3 ubiquitin ligases. Sci Signal 2014, 7: ra18. 37. Fuentes EN, Ruiz P, Valdes JA, Molina A. Catabolic signaling pathways, atrogenes, and ubiquitinated proteins are regulated by the nutritional status in the muscle of the fine flounder. PLoS ONE 2012, 7: e44256. 38. Seiliez I, Sabin N, Gabillard JC. FoxO1 is not a key transcription factor in the regulation of myostatin (mstn-1a and mstn-1b) gene expression in trout myotubes. Am J Physiol Regul Integr Comp Physiol 2011, 301: R97–R104. 39. Seiliez I, Taty GC, Bugeon J, Dias K, Sabin N, Gabillard JC. Myostatin induces atrophy of trout myotubes through inhibiting the TORC1 signaling and promoting Ubiquitin–Proteasome and Autophagy-Lysosome degradative pathways. Gen Comp Endocrinol 2013, 186: 9–15. 40. Frost RA. Multiple Toll-like receptor ligands induce an IL-6 transcriptional response in skeletal myocytes. Am J Physiol Regul Integr Comp Physiol 2005, 290: R773–R784.