Basic CMYK - The FASEB Journal

The FASEB Journal • Research Communication

Fam65b is important for formation of the HDAC6-dysferlin protein complex during myogenic cell differentiation Anuradha Balasubramanian,*,†,1 Genri Kawahara,*,†,1 Vandana A. Gupta,*,†,1 Anete Rozkalne,*,†,1 Ariane Beauvais,§ Louis M. Kunkel,*,†,‡,储,1 and Emanuela Gussoni*,†,储,1,2 *Program in Genomics, †Division of Genetics and ‡Manton Center for Orphan Disease Research, Boston Children’s Hospital, Boston, Massachusetts, USA; §Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, Ontario, Canada; and 储Harvard Medical School, Boston, Massachusetts, USA Previously, we identified family with sequence similarity 65, member B (Fam65b), as a protein transiently up-regulated during differentiation and fusion of human myogenic cells. Silencing of Fam65b expression results in severe reduction of myogenin expression and consequent lack of myoblast fusion. The molecular function of Fam65b and whether misregulation of its expression could be causative of muscle diseases are unknown. Protein pulldowns were used to identify Fam65b-interacting proteins in differentiating human muscle cells and regenerating muscle tissue. In vitro, human muscle cells were treated with histone-deacetylase (HDAC) inhibitors, and expression of Fam65b and interacting proteins was studied. Nontreated cells were used as controls. In vivo, expression of Fam65b was downregulated in developing zebrafish to determine the effects on muscle development. Fam65b binds to HDAC6 and dysferlin, the protein mutated in limb girdle muscular dystrophy 2B. The tricomplex Fam65b-HDAC6-dysferlin is transient, and Fam65b expression is necessary for the complex to form. Treatment of myogenic cells with pan-HDAC or HDAC6-specific inhibitors alters Fam65b expression, while dysferlin expression does not change. Inhibition of Fam65b expression in developing zebrafish results in abnormal muscle, with low birefringence, tears at the myosepta, and increased embryo lethality. Fam65b is an essential component of the HDAC6dysferlin complex. Down-regulation of Fam65b in developing muscle causes changes consistent with muscle disease.—Balasubramanian, A., Kawahara, G., Gupta, V. A., Rozkalne, A., Beauvais, A., Kunkel, L. M., Gussoni, E. Fam65b is important for for-

mation of the HDAC6-dysferlin protein complex during myogenic cell differentiation. FASEB J. 28, 2955–2969 (2014). www.fasebj.org

Abbreviations: C6ORF32, chromosome 6 open reading frame 32; CTX, cardiotoxin; Fam65b, family with sequence similarity 65, member B; HDAC6, histone de-acetylase 6; MCAM, melanoma cell adhesion molecule; MO, morpholino oligonucleotide; SAHA, suberoylanilide hydroxamic acid; TA, tibialis anterior; TSA, trichostatin A

1 Current address: Division of Genetics and Genomics, Boston Children’s Hospital, Boston, MA, USA. 2 Correspondence: Division of Genetics and Genomics, Boston Children’s Hospital, 3 Blackfan Circle, Boston, MA 02115, USA. E-mail: [email protected] doi: 10.1096/fj.13-246470

ABSTRACT

0892-6638/14/0028-2955 © FASEB

Key Words: myoblast 䡠 acetylation 䡠 zebrafish 䡠 muscular dystrophy Myogenesis is a progression of well-orchestrated steps leading to the formation of a mature muscle fiber. Recapitulation of these steps can be studied in vitro following propagation and differentiation of mononuclear myogenic cells. Committed skeletal muscle precursor cells proliferate as mononucleated myoblasts, then exit the cell cycle and fuse into multinucleated myotubes (1–3). These steps are regulated by time-dependent activation and repression of specific genes (4–6) and are also observed during muscle regeneration in vivo (7, 8). Given the complex nature of myofiber formation, an understanding of the mechanisms that regulate gene expression and post-translational modification of proteins is essential; however, many of these key steps are still poorly understood. Among posttranslational modifications, protein acetylation has emerged as a prominent mechanism to regulate major cellular functions, including enzymatic activity, protein-protein interaction, protein stability, and protein localization (9). Evidence that acetylation of specific proteins is an important regulatory mechanism for myogenic differentiation has also been mounting. For example, acetylation of retinoblastoma protein is required for permanent cell cycle withdrawal of myoblasts and subsequent expression of myogenic differentiation markers (10, 11). In addition, Myc-nick, a cytoplasmic cleavage product of

2955

Myc, induces ␣-tubulin acetylation in the microtubules, followed by an increase in myogenin expression and muscle differentiation (12). Acetylation of ␣-tubulin is a critical step for stabilization of microtubules, which in turn regulate cellular migration and motility, as well as protein motility within cells. Histone deacetylase 6 (HDAC6) is a cytoplasmic HDAC that is well known for its role in regulating microtubule dynamics via deacetylation of various proteins, including ␣-tubulin (13, 14). Through this action, HDAC6 controls cellular motility either by deacetylating specific proteins involved in cell migration (15) or by binding to proteins that inhibit its activity (16). In differentiating muscle cells, dysferlin has been reported to bind HDAC6, thus preventing tubulin deacetylation (17, 18). Mutations in the dysferlin gene are responsible for limb-girdle muscular dystrophy type 2B and Miyoshi myopathy (19, 20), with a primary role for dysferlin in membrane resealing through vesicle recruitment in a calcium-dependent manner (21, 22). Absence of dysferlin has been also associated with decreased expression of myogenin and subsequently delayed myogenic differentiation (23). In a previous study, we reported that family with sequence similarity 65, member B [Fam65b; which was previously named chromosome 6 open reading frame 32 (C6ORF32)] is a cytoplasmic protein transiently up-regulated during early myoblast differentiation (24). Notably, inhibition of Fam65b expression in myoblasts by siRNA causes a severe decrease in myogenin expression and consequently severely decreased myoblast fusion (24). Overexpression of Fam65b in myogenic and nonmyogenic cells induces formations of cellular protrusions (24). Overall, these previous findings suggested a possible role for Fam65b in myoblast migration or cytoskeletal protein rearrangements that accompany myogenic differentiation; however, its exact role is still largely unknown. In the present study, we show that Fam65b binds HDAC6 and dysferlin during early differentiation of human myogenic cells. Fam65b expression is necessary for the binding between HDAC6 and dysferlin to occur. When Fam65b expression is transiently elevated, HDAC6 activity decreases while the levels of acetylated tubulin and myogenin increase. Sustained treatment of human myogenic cells with HDAC6-specific inhibitors induces tubulin hyperacetylation. Hyperacetylation of tubulin negatively regulates the expression of Fam65b, resulting in decreased myogenic differentiation. Unlike Fam65b, dysferlin expression is not affected by treatment of human cells with either pan-HDAC6 or HDAC6specific inhibitors, suggesting Fam65b is the main target of HDAC6 activity. Last, inhibition of Fam65b expression in developing zebrafish results in defective myosepta and increased embryo mortality, suggesting Fam65b could be screened as a new candidate gene for muscle disease in humans. 2956

Vol. 28

July 2014

MATERIALS AND METHODS Primary human muscle cell isolation and fluorescenceactivated melanoma cell adhesion molecule-positive (MCAMⴙ) cell sorting Mononuclear cells were isolated from deidentified, discarded human fetal muscle samples of gestational age 15–18 wk. Collection was approved by the Committee of Clinical Investigation at Boston Children’s Hospital and Brigham and Women’s Hospital (Boston, MA, USA). Skeletal muscle was minced and enzymatically dissociated with 0.5 mg/ml collagenase D and 0.6 U/ml dispase II (Roche Applied Science, Indianapolis, IN, USA) for 45–75 min at 37°C as described previously (25, 26). Cells were filtered through 100 and 40 ␮m cell strainers before being frozen and stored at ⫺150°C for later use. Human fetal muscle cells were cultured on sterile tissue culture-treated plates (Corning, Corning, NY, USA) 24 h prior to analysis/cell sorting. Cells were washed once with 1⫻ HBSS and lifted using cell dissociation buffer (Invitrogen Gibco, Grand Island, NY, USA). Samples were filtered and resuspended in warm 0.5% BSA/HBSS followed by incubation with anti-MCAM antibody conjugated with Alexa Fluor 488 (catalog no. MAB 16985X; Millipore, Billerica, MA, USA) at a dilution of 1:100 for 55 min on ice. Samples were washed, resuspended in 1 ␮g/ml propidium iodide/0.5% BSA/HBSS, and filtered through a 40 ␮m filter prior to FACS analysis and sorting. Cell culture of myogenic cells MCAM⫹ myogenic cells were cultured in growth medium consisting of DMEM-high glucose, 20% fetal bovine serum, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. At 65– 70% confluence, myogenic cells were induced to differentiate in DMEM-low glucose, 2% horse serum, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. Differentiation medium was changed daily, and cells were monitored for myotube formation. Proliferating cells in growth medium with high glucose and serum were harvested as “d 0” samples, whereas the differentiating cells were harvested daily and labeled as d 1, d 2, d 4, d 6, and d 8 samples. Immunoprecipitation and Western blotting Cell lysates were made with M-PER mammalian protein extraction reagent (Thermo Scientific, Pittsburgh, PA, USA) containing protease and phosphatase inhibitor cocktail tablets (Roche Applied Sciences). For immunoprecipitation, lysates containing of equal amount of proteins (250 –500 ␮g) were equilibrated with gentle Ag/Ab binding buffer (Thermo Scientific) and precleared with protein A sepharose beads. Specific proteins were precipitated with 1–2 ␮g of their respective polyclonal primary antibody and protein A sepharose beads overnight at 4°C. The Ag-Ab-coupled beads were washed once with 1⫻ TBS and 1⫻ TBST. The Ag-Ab complex was eluted with gentle elution buffer (pH 6.6; Thermo Scientific). Elutes were desalted with Zeba desalting columns (Thermo Scientific). The desalted samples along with the antibody control and lysate control were resuspended in sample loading buffer, heated for 10 min at 95°C, and separated using Precast NuPage 4 –12% Bis/Tris acrylamide gel (Invitrogen) SDS-PAGE. For Western blot analyses, 25 ␮g of total protein treated with sample loading buffer was heated for 10 min at 95°C and separated using Precast NuPage 4 –12% Bis/Tris acrylamide gel (Invitrogen) SDS-PAGE. The proteins were wet-trans-

The FASEB Journal 䡠 www.fasebj.org

BALASUBRAMANIAN ET AL.

ferred to nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). Membranes were blocked with 5% BSA and 1% nonfat dry milk in TBST and incubated with the primary antibody diluted in blocking solution overnight at 4°C. Blots were washed with 1⫻ TBST and incubated with HRP-conjugated secondary antibody diluted in TBST supplemented with 5% nonfat dry milk and then washed again in 1⫻ TBST and developed using ECL solution (Perkin Elmer, Waltham, MA, USA). The primary antibodies used were hC6ORF32-M01 (1:1000; Novus Biologicals, Littleton, CO, USA), hFam65b (polyclonal antibody 1:1000; ProteinTech, Chicago, IL, USA), hHDAC6 (1:1000; Santa Cruz Biotechnology, Dallas, TX, USA), acetylated lysine (1:1000; Cell Signaling, Danvers, MA, USA), acetylated tubulin (1:1000; Cell Signaling), ␣/␤-tubulin (1:1000; Cell Signaling), phospho 14.3.3 binding motif (1:1000; Cell Signaling), myogenin (clone 5FD 1:500; Dako, Carpinteria, CA, USA), dysferlin (1:800; polyclonal antibody Novus Biologicals, Littleton, CO, USA), dysferlin (Hamlet clone Ham1/7B6 1:800; Vector Laboratories, Burlingame, CA, USA), dysferlin (Romeo, JAI-1– 49-3 rabbit monoclonal antibody 1:1000; Abcam, Cambridge, MA, USA), myoferlin (1:1000; Abcam), and ␤-actin (1:5000; Sigma-Aldrich, St Louis, MO, USA). RNA isolation and quantitative RT-PCR analysis Total RNA was isolated from cultured human fetal muscle cells and mouse tibialis anterior (TA) muscle tissues using the RNeasy mini kit and RNeasy fibrous tissue mini kit (Qiagen, Valencia, CA, USA), respectively. Reverse transcription was performed using 1 ␮g of RNA and the TaqMan Reverse Transcription Reagents kit, according to the manufacturer’s instructions (Applied Biosystems Life Technologies, Grand Island, NY, USA). Quantitative real-time PCR was performed with equal volume of cDNA, 0.2 ␮g each of forward and reverse primer, and 1 ⫻ SYBR Green PCR master mix (Applied Biosystems Life Technologies) using an ABI7900HT PCR machine under default conditions: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of amplification at 94°C for 15 s and 60°C for 1 min. Relative mRNA expression was calculated using the ⌬⌬Ct method (27). All primers were optimized to run at the same efficiency as the human (ribosomal protein large, P0 (RPLP0) control. Primer sequences are listed in Table 1. Immunofluorescence For immunofluorescence, cells were fixed in 4% paraformaldehyde for 10 min, permeabilized with 0.1% Triton X-100 in TABLE 1. Sequence of primers used in real-time quantitative RT-PCR studies Gene

Human Fam65b, ex-11-12 Human Fam65b ⫹ Fam65b⌬12 Human Fam65b-2 Human myogenin Human RPLP0

Primer sequence

F: cccaccttcaaagaccactc R: cagcttggcaaagaaagtgtc F: gcccagcaggaagtactcag R: gattttcagagccaggcaag F: tgggcttttacttgcattagaac R: ggatttctctgaaaaggtactcttact F: cagtgccatccagtacatcg R: aggttgtgggcatctgtagg F: tgtttcattgtgggagcaga R: gtgaggtcctccttggtgaa

F, forward; R, reverse.

FAM65B COMPLEXES WITH HDAC6 AND DYSFERLIN

PBS for 10 min, and blocked with 1% BSA and 5% donkey serum in PBS for 1 h. Cells were incubated with the primary antibodies overnight at 4°C, diluted as follows: mouse antihC6ORF32-M01 (1:100; Novus Biologicals), rabbit anti-hHDAC6 (1:100; Santa Cruz Biotechnology), rabbit anti-acetylated tubulin (1:100; Cell Signaling), mouse anti-myogenin (1:100; Dako). Cells were washed in 1⫻ PBS 3 times for 10 min each and incubated with the appropriate secondary antibodies for 1 h at room temperature. Slides were washed again with PBS as above and mounted in Vectashield (Vector Laboratories) supplemented with 100 ng/ml DAPI to visualize nuclei. Epifluorescent images were captured using a Nikon Eclipse E-1000 microscope (Nikon, Tokyo, Japan) equipped with a Hamamatsu digital camera (Hamamatsu, Middlesex, NJ, USA). Images were acquired using Openlab 3.1.5 software (Improvision; Perkin Elmer). Fluorimetric HDAC6 activity assay Immunoprecipitation was performed as described above with 500 ␮g total proteins and polyclonal hHDAC6 antibody (Santa Cruz Biotechnology). The precipitated and desalted HDAC6-Ab complex was used as the enzyme source in the activity assay. The assay was performed using Fluor de lysGreen HDAC assay kit (Enzo Life Sciences, Farmingdale, NY, USA) in a 2-step reaction according to the manufacturer’s protocol. Briefly, in the first deacetylation step, the enriched HDAC6-Ab complex was incubated in assay buffer and Fluor de lys-Green substrate at 37°C for 60 min. Deacetylation of the substrate sensitizes it to produce a fluorophore in the next step, when Fluor de lys-Green developer was added, and the reaction incubated at 25°C for 15 min. The fluorescence was read at excitation wavelength 485 nm and emission wavelength 535 nm. The fluorescence values were corrected against blank values [change in arbitrary fluorescence units (⌬AFU)]. Fluorescence increase due to deacetylation was determined using a second-order polynomial curve obtained with the deacetylated standard of concentration range 0 –20 ␮M. Specific activity of HDAC6 was calculated as change in arbitrary fluorescence units due to deacetylation by HDAC6 per milligram of total protein. siRNA oligo transfection and analysis siGenome SmartPool siRNA oligos for human Fam65b (GAAAGGCGAUCCAGGUGUA, GAGAAUAUGUGCACCAUUG, CUAUGAAGCUUAUUGUAUC, UAAGUAAGGUAGAUGAACU) and human HDAC6 (GCACCGAGCUGAUCCAAAC, GAUGAGCAGUUAAAUGAAU, GCAGUUAAAUGAAUUCCAU, GGUGUUGGAUGAGCAGUUA) were purchased (Thermo Scientific). As control, siGENOME pool nontarget siRNA oligos and siGenome human GAPDH siRNA duplex (Thermo Scientific) were reconstituted in siRNA buffer at a concentration of 20 ␮M. siRNA oligos were electroporated in primary MCAM⫹ myogenic cells with T-012 program using the Amaxa NHDF Nucleofector kit (Lonza, Hopkinton, MA, USA), as per the manufacture’s protocol. Optimization of transfection efficiency was determined using the pmax GFP and pmax GFP siRNA (Lonza). After 48 h, the transfected cells were harvested as d 0 sample for RNA and protein analyses, while the remaining samples were differentiated and collected on consecutive subsequent days. HDAC inhibitor treatments For sustained HDAC-inhibitor treatment, human fetal MCAM⫹ myogenic cells plated at 65–70% confluency were stimulated with the respective inhibitor in growth medium 2957

(DMEM-high glucose supplemented with 20% FBS). The final concentration of each HDAC inhibitor was as follows: 100 nM of trichostatin A (TSA); 100 nM suberoylanilide hydroxamic acid (SAHA/Vorinostat); 5 ␮M tubacin, and 200 nM of BML-281. After 18 –20 h, the d 0 sample was collected, while cells for the other time points were differentiated in low-serum medium supplemented with the respective inhibitors at the same concentration. Samples were collected at d 1, 2, and 4 following differentiation for RNA and protein analyses. Cardiotoxin (CTX)-injured muscle homogenate preparation Wild-type C57Bl/6 mice, age 6 –7 mo, were used for CTX injury. Animals were housed and handled in accordance with the guidelines of the Boston Children’s Hospital subcommittee for animal research. All experimental procedures were performed as described in a protocol approved by the Boston Children’s Hospital Institutional Animal Care and Use Committee. Muscle injury was induced by injection of CTX (15 ␮l of 0.5 ␮g/␮l stock) from Naja mossambica (Sigma-Aldrich) into the TA muscle of adult wild-type mice. TA muscles were harvested at 2, 4, and 8 d after CTX injection for RNA and protein analyses. Contralateral, uninjected TA muscles were used as noninjured controls. RNA was extracted from 30 mg of tissue using RNeasy fibrous tissue Mini Kit (Qiagen). cDNA was synthesized and analyzed using the protocol described above. Tissue homogenates were prepared using T-PER tissue protein extraction reagent (Thermo Scientific) containing protease and phosphatase inhibitor cocktail tablets (Roche Applied Sciences). Tissue samples were weighed, minced, treated with 3⫻ their weight per volume of T-PER lysis buffer, and homogenized for 10 min. The homogenate was centrifuged at 13,000 rpm for 30 min, and supernatant was stored at ⫺80°C. Statistical analyses Each experimental datum is representative of ⱖ3 independent experiments performed. All values are presented as means ⫾ sd from ⱖ3 repeats, unless otherwise stated. A 2-tailed Student’s t test was employed for statistical analyses. Values of P ⬍ 0.05 were considered to represent statistically significant differences. Fish and fish culture AB wild-type fish strain was used for in situ hybridization and injection of morpholinos. Ten pairs of AB fish were mated, and the fertilized eggs were cultured at 28.5°C. Zebrafish embryos were collected and raised at 28.5°C according to standard procedures and standard criteria under the guidelines of the Boston Children’s Hospital Institutional Animal Care and Use Committee. For whole-mount in situ hybridization, isoform-specific riboprobes were constructed from the 5=-UTRs of fam65b using zebrafish total RNA. To clone the 5=-UTR of zf-Fam65b, the forward primer 5=-ctagctcgagcagtccgaacgttgatttga-3= and the reverse primer 5=-ctagggatccagggaagtgagtttatccag-3= were used. Total RNA was extracted from adult zebrafish muscle tissue using Trizol (Invitrogen). cDNAs were synthesized and amplified employing single-step Superscript One-Step RT-PCR with platinum Taq kit (Invitrogen) using genespecific primers. Amplified DNA fragments were cloned in pCS2⫹ vector using XhoI and BamHI sites. Sense or antisense digoxigenin-labeled riboprobes were synthesized by in vitro transcription using dig-labeling kits (Roche Applied 2958

Vol. 28

July 2014

Sciences). Whole-mount in situ hybridization was performed as described previously (28). Imaging was performed using a Nikon SMZ1500 microscope with a Spot camera system. For zebrafish RT-touchdown PCR analysis, total tissue RNA was isolated from 100 count developing zebrafish embryos at d 1 and 4. For adult zebrafish, 100 ␮g of muscle tissue was used for RNA extraction using an RNeasy fibrous tissue Mini Kit (Qiagen). Reverse transcription was performed using 1 ␮g of total RNA and the TaqMan reversetranscription reagents, according to the manufacturer’s instructions (Applied Biosystems Life Technologies). Modified touchdown PCR was performed using equal volume of cDNA, 0.3 ␮M each of forward and reverse primer, and KOD Hot-start master mix at a concentration of 0.02 U/␮l (Novagen-EMD Millipore, Billerica, MA, USA) using optimized Touchdown reaction conditions in 2 phases. In phase I, polymerase was activated for 2 min at 95°C, followed by denaturation at 95°C for 20 s, a successively lower annealing temperatures (Tm) between 65.9°C and 51.9°C (i.e., decreasing the Tm of the reaction 1°C/cycle) for 10 s, followed by extension at 72°C for 15 s over the course of 15 cycles. In phase II, denaturation was at 95°C for 20 s, annealing at 56.6°C for 10 s, followed by extension at 72°C for 15 s for 20 cycles. A final elongation step was performed at 72°C for 5 min. The primer sequences are as follows: fam65b-001 ⫹ 201, forward 5=-gcgctctggaaagttttgac3=, reverse 5=-caggagagtgaggcagaacc-3=; fam65b-001-exon 4, forward 5=-gtgcagaagaagcccatctc-3=, reverse 5=tctcacgtgtgcctttggt-3=; ␤-actin, forward 5=-atcagcatggcttctgctct3=, reverse 5=-caccctggcttacattttcaa-3=. For silencing of fam65b expression in developing zebrafish, antisense morpholino oligonucleotides (MOs) were designed and synthesized by GeneTools (Philomath, OR, USA): fam65b splice MO 1 (for exon 2 skipping; 5=-CACTCCTGCATGAGGCAGAAAAGGA-3=), fam65b splice MO 2 (for exon 8 skipping; 5=-TGCTCATGTTCTGAGAGAAACACAT-3=) and control MO (standard control oligo; 5=-CCTCTTACCTCAGTTACAATTTAT-3=). Each morpholino (1.5, 3, 6, 12 ng) was injected into the yolk of 1- to 2-cell-stage embryos as described previously(29). To confirm exon-skipping with morpholino injections, RT-PCR using total RNA from morphant fish was used to detect exon-skipped PCR products with ExTaq DNA Polymerase (Takara Bio/Clontech, Mountain View, CA, USA) at 95°C for 30 s, 53°C for 30 s, and 72°C for 1 min (35 cycles) with the following primer sets: fam65b for exon 2, forward 5=-CAGTCCGAACGTTGATTTGA-3=, reverse 5=TCGCATGTATCGCTCTATGG-3=; fam65b for exon 8, forward 5=-TATCTGGAGGTGCACCAAAC-3=, reverse 5=GACAAAGTCTGGCAAAACC-3=; and ␤-actin, forward 5=atcagcatggcttctgctct-3=, reverse 5=-caccctggcttacattttcaa-3=. Birefringence assay of morpholino-injected fish was performed with 2 polarizing filters under a dissection scope as described previously (29). Immunofluorescence staining of whole MO-injected fish bodies was performed as described previously (29). Embryos were incubated separately with anti-laminin (1:50; Sigma-Aldrich) or anti-myosin heavy chain (1:25, F59; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) at 4°C overnight. After washing 3 times, samples were incubated with secondary antibodies and DAPI and examined as described previously (29). They were observed with a confocal microscope, Zeiss LSM510 META 2 (Carl Zeiss, Oberkochen Germany; Intellectual and Developmental Disabilities Research Center Cellular Imaging Core, Boston Children’s Hospital, Boston, MA, USA).



B

Ex12 (150bp)

ATG 1

1,227

1,377

ATG 1

Fam65b

3,144 Fam65bΔ12

ATG 1

1,755 Fam65b-2

**

Fam65b + Fam65bΔ12

6

3,207 Fam65b

2^-delta delta CT

A

**

*

Fam65b-2 4

2

0

d0

C

d0

d1

d2

d4

d6

D CTX

d8

d1

d0

d2

d2

d4

d4

d3

d8

Fam65b 115 kD

Fam65b 115 kD

Myogenin 34 kD

Myogenin 34 kD

β-actin 42 kD

β-actin 42 kD

E MO1 Ab epitope aa1

79

149

aa1

79

149

1018

Polyclonal Ab epitope

Fam65bΔ12 597 = putative HDAC interacting domain

Fam65b-2

F

Abc

d0

d1

d2

d4

TCL

G

Abc

d0

d1

d2

d4

TCL

IP: Ac-Lysine; WB: Fam65b

IP: p14.3.3 binding motif; WB: Fam65b (M01)

IP:Fam65b; WB: Ac-Lysine

IP: p14.3.3 binding motif; WB: Fam65b (poly)

Figure 1. Fam65b is transiently expressed and acetylated during human myogenic cell differentiation. A) Schematic diagram of Fam65b mRNA isoforms. Nucleotide 1 corresponds to the first ATG of the coding mRNA sequence. The 5= and 3= untranslated mRNA sequences are not included, and they differ in length for each isoform. Fam65b⌬12 (muscle-specific isoform) is expressed in differentiating human fetal myogenic cells and mouse regenerating muscle. The triangles schematize the primer pairs used to amplify each transcript; their sequences are listed in Table 1. B) mRNA expression of Fam65b isoforms during the early days of differentiation. *P ⱕ 0.01; **P ⱕ 0.0001. C) Protein expression of Fam65b and myogenin in differentiating human fetal myogenic cells. D) Protein expression of mouse Fam65b and myogenin in CTX-injured regenerating TA mouse muscle lysates; ␤-actin is used as a loading control. E) Schematic diagram of the putative HDAC-binding domain identified using SMART (http://smart.embl-heidelberg.de/). This domain is highly conserved in various species and includes several lysine residues that could be targeted for acetylation. F) Fam65b protein is acetylated during myogenic differentiation. Immunoprecipitations were performed with anti-acetylated lysine, followed by Western blot for Fam65b. G) Fam65b can bind to phosphorylated 14.3.3 proteins during myogenic differentiation. Immunoprecipitations were performed with anti-phospho-14.3.3 binding motif, followed by Western blot of Fam65b. Abc: antibody control, TCL: total cell lysate. MO1: mouse monoclonal antibody to Fam65b, poly: rabbit polyclonal antibody to Fam65b. IP: Ac-Lysine; WB: human IgG


2959

RESULTS

Fam65b binds to HDAC6 during early myogenic differentiation

Fam65b is transiently expressed and acetylated during human myogenic cell differentiation

The formation of myofibers via myoblast fusion requires major cytoskeletal rearrangements that are associated with microtubule stability and increased levels of acetylated ␣-tubulin (12, 35, 36). Given the established cytoplasmic location of Fam65b in differentiating myogenic cells (24) and the fact that class II HDACs are known to regulate muscle differentiation and specification of myofiber types (37– 41), we screened class II HDAC4, HDAC5, and HDAC7 to determine whether they could bind to Fam65b, but these studies revealed no interactions (data not shown). HDAC6 is a cytoplasmic HDAC known for its role in cell migration, chemotaxis, and regulation of tubulin acetylation (14, 42, 43). Expression of HDAC6 protein was detected in differentiating human myogenic cells at all time points examined, although a slight decrease was noted 1 d following induction of differentiation, when Fam65b expression rose (Fig. 2A). By immunofluorescence, HDAC6 localized to the cytoplasm of both nonfused and fused cells, partially overlapping with Fam65b (Fig. 2B, arrowheads). HDAC6 protein was also detected in mature myotubes (Fig. 2B, arrows). To determine whether HDAC6 and Fam65b interact in differentiating human myogenic cells, coimmunoprecipitation studies were performed. Coprecipitation of Fam65b was found following anti-HDAC6 pulldown and vice versa (Fig. 2C), suggesting either direct or indirect binding between HDAC6 and Fam65b. Given that HDACs are deacetylases and exert enzymatic activity, HDAC6 catalytic activity was assayed during myogenic differentiation (Fig. 2D). A significant reduction in activity was observed at d 1 following differentiation, followed by an increase in activity to baseline levels at d 2, 4, 6, and 8 following differentiation (P⬍0.0005; Fig. 2D). Given that tubulin is a well-known substrate of HDAC6 (14, 42, 43), the levels of acetylated tubulin were monitored during myogenic differentiation as an indication of HDAC6 deacetylase activity. A transient increase in acetylated tubulin levels occurred at d 2– 4 following differentiation (Fig. 2E), which immediately followed the previously observed decrease in enzymatic activity of HDAC6 at d 1 (Fig. 2D). Collectively these results suggest that Fam65b binds directly or indirectly to HDAC6 during early myogenic differentiation. This binding prevents HDAC6 to deacetylate tubulin, leading to an increase in the levels of acetylated tubulin. Thus, Fam65b together with other proteins, such as Myc-nick, could play a role in increasing the levels of acetylated tubulin, which leads to an increase in myogenin expression and promotes myogenic differentiation (12, 36).

Primary human fetal myogenic cells were purified based on expression of MCAM, as described previously (30, 25, 26). MCAM⫹ cells robustly differentiated into myotubes, and the expression of 3 known Fam65b isoforms (24) was evaluated via quantitative real-time RT-PCR, using primers designed to recognize unique regions within each isoform (Fig. 1A). The Fam65b⌬12 isoform, which lacks a 150 bp sequence corresponding to exon 12 in Fam65b, was robustly up-regulated on myogenic differentiation, whereas Fam65b and Fam65b-2 showed no significant change (Fig. 1B). Expression of Fam65b⌬12 protein was detected within the first day in differentiation medium and remained elevated for ⬃4 d before declining between d 4 and 8 (Fig. 1C). Concomitantly, expression of myogenin peaked at d 2 following differentiation. Fam65b protein expression also transiently peaked in regenerating mouse muscle at 2– 4 d following CTX injury, at the same time that up-regulation of myogenin occurred (Fig. 1D). Thus, Fam65b is transiently and rapidly up-regulated in both differentiating myoblasts and regenerating muscle tissue. Previously, we determined that expression of Fam65b is sufficient to induce formation of cellular protrusion and aa 54 –113 in the N terminus contain the domain important for this function (24). Computational analysis using SMART (http://smart.embl-heidelberg.de/) revealed the presence of a putative HDAC-binding domain within aa 79 –149 of Fam65b that is extremely conserved among species (Fig. 1E). It contains multiple conserved lysines (Fig. 1E, black arrows) that could be potential targets for acetylation/deacetylation. To determine whether Fam65b is acetylated, immunoprecipitations were performed on lysates of differentiating human muscle cells using an antibody that recognizes acetylated lysine. Following immunoprecipitation, Western blot analysis with anti-Fam65b revealed that during myogenic differentiation, Fam65b contains acetylated lysines (Fig. 1F). The reverse immunoprecipitation using anti-Fam65b for pulldown followed by Western blot for acetylated lysine also confirmed that acetylated lysines are present in immunoprecipitated Fam65b (Fig. 1F). Additional immunoprecipitations revealed that Fam65b protein contains the binding motifs for activated phospho-14.3.3 proteins, which are known to regulate shuttling of HDACs between the nucleus and the cytoplasm (31–34). Indeed, pulldown of proteins containing phospho-14.3.3 binding motifs followed by Western blot with anti-Fam65b demonstrated that Fam65b was among the proteins that contain such motifs (Fig. 1G). Altogether, these findings suggested that Fam65b might be a cytoplasmic HDAC-binding protein. 2960

Vol. 28

July 2014

Fam65b expression allows binding between dysferlin and HDAC6 Dysferlin is a protein involved in myofiber membrane repair (21, 22, 44), and mutations in its gene cause



A

0

2h

4h

6h

1d

2d

4d

6d

B

8d

HDAC6

Fam65b

DAPI/Mege

HDAC6

Fam65b

DAPI/Merge

HDAC6

Myogenin

DAPI/Merge

HDAC6 160 kD Fam65b 115 kD

50µm

Day 2

Myogenin 34 kD -actin 42 kD

C

Abc d0

d1

d2

d4

d6

d8

50 m

Day 2

TCL

IP: HDAC6; WB: Fam65b (M01)

Day 4

D

50µm

6000

E d0

d1

d2

d4

d6

d8 Ac-tubulin 52 kD β-actin 42 kD

DAFU/mg protein

IP: Fam65b (poly); WB: HDAC6 5000 4000 3000 2000

*

1000 0

Abc

d0

d1

d2

d4

d6

d8 HDAC6 (Control)

Figure 2. Fam65b interacts with HDAC6 in differentiating human myogenic cells. A) Western blot analysis on lysates from human fetal myogenic cells undergoing differentiation. HDAC6 expression is detected at all time points analyzed, while Fam65b expression is transient. B) Partial cytoplasmic colocalization of Fam65b (green) and HDAC6 (red) in human myogenic cells at d 2 of differentiation (arrowheads). At differentiation d 4, HDAC6 expression (red) is detected in mature myotubes at the periphery of the myotube cytoplasm (arrow), lateral to the clusters of myonuclei that are positive for myogenin (green). C) Immunoprecipitation of HDAC6 or Fam65b in differentiating human myogenic cell lysates, followed by Western blot for Fam65b or HDAC6, respectively. HDAC6 coprecipitated with Fam65b protein and vice versa. D) HDAC6 activity transiently decreases at d 1 of differentiation, at the same time expression of Fam65b is peaking (shown in A). Specific activity of HDAC6 was calculated as the difference in arbitrary fluorescence units (DAFU) between the test sample and the nonenzyme blank per miligram of total protein used for the assay. HDAC6 control represents 0.5 ␮g protein, and it is included as a positive control. *P ⬍ 0.0005. E) Levels of acetylated tubulin increased during myogenic differentiation following the decrease in HDAC6 activity observed at d 1.

limb girdle muscular dystrophy type 2B and Miyoshi myopathy (19, 20, 45). Studies have also indicated that dysferlin interacts with HDAC6 and prevents deacetylation of ␣-tubulin during myotube formation (17, 18). Given our findings that Fam65b coimmunoprecipitates with HDAC6, we sought to ask whether Fam65b, HDAC6, and dysferlin might be part of the same protein complex and whether expression of Fam65b is essential for the formation of this complex. Prior to induction of myogenic differentiation (time 0 h), dysferlin, and HDAC6 are robustly expressed, whereas Fam65b expression increases as early as 6 h following induction of differentiation (Fig. 3A). To determine whether HDAC6 and dysferlin bind irrespectively of Fam65b expression, coimmunoprecipitation of HDAC6 was performed on lysates of differentiating human muscle cells. Binding between HDAC6 and dysferlin was seen only following induction of differentiation, when Fam65b expression is known to increase, but not at d 0 (Fig. 3B). The reverse coimmunoprecipitation confirmed that following dysferlin pulldown, HDAC6 binding is FAM65B COMPLEXES WITH HDAC6 AND DYSFERLIN

detected starting at d 1 (Fig. 3B). To confirm that Fam65b is part of the dysferlin-HDAC6 complex, coimmunoprecipitation of Fam65b followed by Western blotting for dysferlin was performed. The coimmunoprecipitation revealed that Fam65b and dysferlin interact (Fig. 3C). This result was confirmed by the reverse coimmunoprecipitation, where Fam65b was detected by Western blot following immunoprecipitation of dysferlin (Fig. 3C). To confirm that binding between dysferlin and Fam65b occurs in vivo, coimmunoprecipitations were performed on tissue lysates from regenerating mouse muscle following CTX injury (Fig. 3D). Indeed, binding between Fam65b and dysferlin was confirmed with forward and reverse pulldown (Fig. 3D). Thus, Fam65b interacts with both dysferlin and HDAC6, and expression of Fam65b is necessary to maintain this protein complex. Myoferlin is another member of the ferlin family of proteins that has high homology to dysferlin and a molecular weight nearly identical to dysferlin (46). Myoferlin is expressed in differentiating myoblasts, 2961

B

A 0

1/2

1

Time (hr) 2 4

C

Abc 6

12

d0

CTX d4

d1

d2

d4

TCL

IP: Fam65b; WB: Dysferlin

Dysferlin (Romeo) 230 kD

IP: HDAC6; WB: Fam65b

IP: Fam65b; WB: Fam65b

IP: HDAC6; WB: HDAC6

IP: Dysferlin; WB: Fam65b

IP: Dysferlin; WB: HDAC6

IP: Dysferlin; WB: Dysferlin

F

Time (hr) 0

1/2

1

2

4

Abc 6

12

d0

d1

d2

d4

d6

d8

TCL

24 Myoferlin 230 kD

IP: Fam65b; WB: Dysferlin


d0

IP: HDAC6; WB: Dysferlin

E TTL

Abc

Fam65b 115 kD

-actin 42 kD

Abc

d4 TCL

24

HDAC6 160 kD

D

d0 d1 d2

IP: Fam65b; WB: Myoferlin 0

1

Time (day) 2 4 6

8 Myoferlin 230 kD


IP: Dysferlin; WB: Fam65b IP: HDAC6; WB: Myoferlin IP: Ac -Lysine; WB: Fam65b IP: HDAC6; WB: HDAC6

Figure 3. Fam65b expression allows binding between dysferlin and HDAC6. A) Time-dependent expression of Fam65b, dysferlin, and HDAC6 before (0 h) and after induction of differentiation with low serum medium. ␤-Actin expression is used as a loading control. Note that both dysferlin and HDAC6 are expressed at time 0 – 4 h following differentiation, while Fam65b is not detected. B) Immunoprecipitation of HDAC6 coprecipitated dysferlin starting at d 1, when Fam65b is expressed. No coimmunoprecipitation was seen between dysferlin and HDAC6 at d 0, even though both proteins are expressed. C) Immunoprecipitation of Fam65b coprecipitated dysferlin and vice versa. D) Coimmunoprecipitation of Fam65b and dysferlin in regenerating mouse muscle 4 d after CTX injury. Fam65b is also acetylated in regenerating muscle. Ab, antibody control; TCL, total cell lysate; TTL, total tissue lysate. E) Expression of myoferlin detected by Western blot in differentiating human fetal myogenic cells. Myoferlin expression is detected at all time points analyzed. F) Coimmunoprecipitation of myoferlin and Fam65b during myogenic differentiation is detected at multiple time points. In contrast, HDAC6 and myoferlin show a transient interaction at d 4, suggesting that binding between Fam65b, HDAC6, and dysferlin is more likely than Fam65b, HDAC, and myoferlin in differentiating muscle cells.

and its expression has been linked to myoblast fusion (47) and muscle growth in vivo (48). Given the high homology between myoferlin and dysferlin, we sought to ask whether Fam65b, myoferlin, and HDAC could also coimmunoprecipitate. Western blot analyses confirmed that myoferlin is always expressed in human fetal muscle cells undergoing differentiation (Fig. 3E). Immunoprecipitation of Fam65b followed by Western blot for myferlin revealed that Fam65b and myoferlin coimmunoprecipitate (Fig. 3F). However, pulldowns using an anti-HDAC6 antibody followed by Western blot for myoferlin revealed weak or no interaction between HDAC6 and myoferlin (Fig. 3F). Thus, while Fam65b can bind to both dysferlin and myoferlin, HDAC6 preferentially binds to dysferlin, suggesting that Fam65b, HDAC6, and dysferlin form the tricomplex in differentiating myogenic cells. Silencing of HDAC6 by siRNA was conducted on human primary myogenic cells to determine whether the expression of Fam65b and dysferlin were affected under these conditions. When HDAC6 silencing was effective (Fig. 4A), the levels of acetylated tubulin increased, as expected. Fam65b expression was 2962

Vol. 28

July 2014

slightly decreased at d 1 in HDAC6-silenced cells compared to untreated- or nontarget-siRNA cells. In contrast, expression of dysferlin was unaffected (Fig. 4A). When Fam65b expression was effectively silenced (Fig. 4B, d 1) both expression of HDAC6 and acetylated tubulin appeared decreased, while dysferlin expression remained unaffected. Coimmunoprecipitation of Fam65b in HDAC6-silenced human cells followed by Western blot for HDAC6 revealed decreased binding between HDAC6 and Fam65b, while binding between Fam65b and dysferlin was unaffected (Fig. 4C). HDAC6-specific inhibition leads to tubulin hyperacetylation and decreases Fam65b expression Previous studies demonstrated that tubulin acetylation is necessary for progression of myogenic differentiation, as it induces the expression of myogenin (12, 36). Given that expression of Fam65b is transient during myogenic differentiation and it declines following the increase in acetylated tubulin, we hy-



A

siRNA HDAC6 Non-target Untreated + HDAC6

d0

d1 +

+

+

+

B

d2 +

+

+

+

siRNA Fam65b Non-target Untreated

d0

d1

+

+

+ +

d2 +

+ +

+ +

Fam65b

Ac-tubulin

HDAC6

Fam65b

Ac-tubulin

Dysferlin

Dysferlin

Myogenin Myogenin -actin -actin

C

siRNA HDAC6 Non-target Untreated Abc +

d1

d2 +

+

+

+ +

TCL

IP: Fam65b; WB: HDAC6 IP: Fam65b; WB: dysferlin

Figure 4. RNA silencing of HDAC6 or Fam65b does not affect dysferlin expression A) Silencing of HDAC6 in human primary myogenic cells leads to an increase in acetylated tubulin, while Fam65b expression is decreased. Dysferlin expression is unaffected by HDAC6 silencing. B) Silencing of Fam65b in differentiating human primary myogenic cells. HDAC6 expression is decreased when Fam65b expression is effectively silenced (d 1). Dysferlin expression is not affected. C) Immunoprecipitation of Fam65b following HDAC6 silencing shows decreased pulldown levels of HDAC6, while dysferlin is unaffected.


pothesized that increased levels of acetylated tubulin (hyperacetylation) negatively regulate Fam65b expression. To test this hypothesis, human fetal muscle cells were treated with the HDAC6-specific inhibitors tubacin and BML-281 (49, 50) starting 18 –20 h prior to differentiation and maintained throughout the differentiation period over the course of 4 d. mRNA and protein analyses were performed to determine any variation in expression of Fam65b, myogenin, acetylated tubulin, and dysferlin under these conditions. In the presence of HDAC6-specific inhibitors, Fam65b and myogenin mRNA expression levels were significantly decreased compared to nontreated cells (Fig. 5A). Western blot analyses confirmed increased levels of acetylated tubulin in treated cells compared to nontreated cells (Fig. 5B). Expression of Fam65b was decreased in inhibitor-treated cells at d 2 and 4 following differentiation, while the expression of dysferlin did not vary (Fig. 5B). These studies demonstrate that sustained inhibition of HDAC6 activity leads to tubulin hyperacetylation and negatively regulates the expression of Fam65b and myogenin, while dysferlin expression is unaffected. Pan-histone deacetylase inhibitors are known to increase muscle size by promoting the recruitment of myoblasts toward differentiated myotubes, thus enhancing fusion (51). Since many of the target proteins that mediate this process are unknown, we sought to determine whether Fam65b might be a putative target. The pan-HDAC inhibitors TSA and SAHA were added at low concentration to human fetal muscle cells starting at 20 h prior to and continuing through the differentiation phase. Sustained treatment with TSA or SAHA resulted in FAM65B COMPLEXES WITH HDAC6 AND DYSFERLIN

a significant increase in mRNA expression of Fam65b and myogenin compared to nontreated cells (Fig. 5C), and these findings were also confirmed at the protein level (Fig. 5D). In contrast, dysferlin expression appeared unaffected by panHDAC inhibitor treatment (Fig. 5D). Thus, expression of Fam65b is likely regulated by the activity of nuclear HDACs, while dysferlin expression is again unaffected. Knockdown of zebrafish fam65b results in severe muscle abnormalities and early lethality To study the in vivo temporal and spatial expression of Fam65b, we performed whole-mount in situ hybridization during zebrafish embryonic and larval development. Zebrafish fam65b (ZFIN ID: ZDB-GENE-060503342) is 54% identical and 68% similar to human Fam65b by BLASTp analysis. Expression of zebrafish fam65b was detected in the developing eye, nervous system, and muscles using the antisense probe, whereas no staining was observed with the sense probe (Fig. 6A). To confirm mRNA expression of the zebrafish isoforms fam65b 001 and fam65b 201 during d 1 and 4 of larval development, as well as in adult muscle, RT-PCR assays were performed using primers common to both isoforms or specific to isoform Fam65b 001. Isoform fam65b 001 was amplified from both developing embryonic and larval fish, as well as from skeletal muscle of adult zebrafish (Fig. 6B). To determine whether fam65b is required for normal muscle development, 2 antisense morpholinos were designed to induce skipping of exon 2 (MO1) or exon 8 (MO2) and injected into developing zebrafish em2963

2^-delta delta CT

8

6

DMSO BML-281 Tubacin

6

Fam65b

4

** *

2

2^-delta delta CT

A

2

*

Myogenin

*

0

0 d0

B

d1

d0

Tubacin

4

DMSO BML-281 Tubacin

-

d2

d1

+

-

d4

d2

+

-

d0

d4

+

-

d1

d0

+

-

d2

d1

+

-

d4

d2

+

-

d4

+

-

+

BML 281

Fam65b 115 kD Ac-tubulin 52 kD HDAC6 160 kD Myogenin 34 kD Dysferlin 230 kD -actin 42 kD

**

DMS0 TSA SAHA

40 30 20

Fam65b

* *

10

DMS0 TSA SAHA

16 12 8

d0

D

d1

d0

-

+

d2

d1

-

-

-

d0

d1

d0

+

Fam65b 115 kD

d2

d4

*

d4

+

Myogenin

4

d4

d2

+

**

*

0

0

TSA

2^-delta delta CT

2^-delta delta CT

C

-

d1

+

-

d2

+

-

d4

+

-

+

SAHA

Dysferlin 230 kD Myogenin 34 kD -actin 42 kD

Figure 5. HDAC6-specific and pan-HDACs inhibitors affect Fam65b expression during myogenic differentiation. A) Human myogenic cells were treated with either 5 ␮M of tubacin or 0.25 ␮M of BML-281, starting 18 –20 h prior to and maintained during differentiation. mRNA expression of Fam65b and myogenin significantly decreased following tubacin or BML-281 treatment. *P ⱕ 0.01, **P ⱕ 0.0005. B) Protein expression of Fam65b, dysferlin (Hamlet), acetylated tubulin, myogenin, and HDAC6 following treatment with tubacin and BML281. When levels of acetylated tubulin are high during differentiation (hyperacetylation), Fam65b and myogenin expression are decreased. In contrast, dysferlin expression does not seem affected. C) Human primary myogenic cells treated with pan-HDAC inhibitors, either 0.1 ␮M TSA or SAHA for 18 –20 h prior to and throughout differentiation. mRNA expression of Fam65b and myogenin significantly increased, compared to control DMSOtreated cells. *P ⱕ 0.01, **P ⱕ 0.001. D) Western blots of human myogenic cells treated with TSA or SAHA. Expression of Fam65b and myogenin increased, while dysferlin expression did not significantly vary in control vs. inhibitor-treated cultures.

2964

Vol. 28

July 2014



B

A

Zf-Fam65b (001+201)

Day 1

D1 D4 AM

Sense

Antisense

Sense

Antisense

Zf-Fam65b-001 (exon4) D1 D4 AM

Zf-β-actin D1 D4 AM

Day 1

C

Figure 6. Expression of fam65b in developing zebrafish. A) mRNA expression of zebrafish Fam65b detected during embryonic develop565bp 395bp ment using whole mount in situ hybridization 331bp 444bp (skipped fam65b exon8) (d 1) and an isoform-specific 5=-UTR probe. B) (skipped fam65b exon2) mRNA expression of zebrafish Fam65b isoforms (Fam65b 001 and Fam65b 201) at d 1 and 4 of Zf-β-actin Zf-β-actin larval development (D1, D4) and in adult muscle (AM). Lanes 1, 5, and 9 are molecular weight markers. Lanes 2– 4 show an amplicon common to both fam65b isoforms (001⫹201); lanes 6 – 8 show the amplicon unique to exon 4 in the isoform Fam65b 001 transcript; lanes 10 –12 show amplification of the housekeeping gene ␤-actin. C) Skipping of fam65b exon 2 and exon 8 in zebrafish injected with Fam65b MO1 and Fam65b MO2 (arrows), respectively. WT

MO1

WT

MO2

bryos (Fig. 6C). Morphant fish showed severely reduced birefringence (Fig. 7A), a finding common to many genetic zebrafish models of muscle disease (52, 53). On staining with laminin, control fish displayed the normal V-shaped chevron myosepta (Fig. 7A, top right panel). In contrast, both Fam65b morpholino-injected fish displayed myosepta that were U-shaped and with disrupted membrane integrity (Fig. 7A, arrows), suggesting abnormal myofiber attachment (54 –56). Analysis of ⬃100 fam65b-morpholino-injected fish revealed that ⬎40 – 60% of developing fish were affected at d 4, compared to 0% affected fish when a control morpholino was injected (Fig. 7B). Between 40 and 60% of fish were affected using 1.5–3 ng of Fam65b MO1. Similarly, when 1.5 ng of Fam65b MO2 was injected, 30 –50% of developing fish were affected. Costaining of laminin (red) and myosin heavy chain (green) revealed severe disruption in the muscle myosepta and myofibers of fam65b morpholino-injected fish (Fig. 7D) compared to control (Fig. 7C). Collectively these results demonstrate that Fam65b plays a role in skeletal muscle development and down-regulation of its expression might be causative of muscle disease.

DISCUSSION The current study highlights new steps into the function of Fam65b during differentiation of human myogenic cells, particularly its indirect role in regulating tubulin acetylation by binding to HDAC6 and FAM65B COMPLEXES WITH HDAC6 AND DYSFERLIN

dysferlin. Fam65b is transiently expressed during myogenic differentiation prior to myogenin. Our previous studies demonstrated that Fam65b silencing results in lack of myogenic cell fusion due to severe decrease in myogenin expression, while overexpression induces formation of cellular protrusions (24). The present study finds additional insight into the molecular pathway where Fam65b exerts its function in human myogenic cells and in regenerating muscle. Fam65b post-translational regulation involves acetylation, as demonstrated by pulldowns using antiacetylated lysine, suggesting that Fam65b may be a target for HDAC regulation. Among cytoplasmic HDACs, HDAC6, a known regulator of cellular motility (13, 42) was found to bind Fam65b. Tubulin is a known substrate of HDAC6, and a decrease in tubulin acetylation reduces microtubule stability, thus resulting in increased cell motility (57). During myogenic differentiation, the levels of acetylated tubulin increase and induce up-regulation of myogenin (12, 36). Our studies demonstrate that HDAC6 deacetylase activity is decreased when myogenic differentiation begins; it coincides with the time when Fam65b expression is highest and binding between HDAC6 and Fam65b occurs. Taken together, these findings support the conclusion that Fam65b binds to and regulates the activity of HDAC6 during early myogenic differentiation, preventing HDAC6 from deacetylating tubulin. Consequently, the levels of acetylated tubulin increase and so does myogenin 2965

A

Day 4

C

Day 1

D

Day 1

Control

fam65bMO1

fam65bMO2

B Percentage fish

100 90 80 70 60 50 40 30 20 10 0 1.5

3

6

12

fam65b MO1

1.5

3

6

12

1.5

fam65b MO2 Affected fish

Normal

3

6

Control MO

12

WT

Dead

Figure 7. Down-regulation of fam65b expression in developing zebrafish embryos causes muscle abnormalities and high mortality. A) Day 4 developing zebrafish embryos injected with control or fam65b morpholinos (MO1, MO2). Fam65b inhibition leads to low birefringence and U-shaped myosepta, as seen by laminin staining (red, arrows). B) Percentage of normal, affected, or dead fish following injection of fam65b MO1, fam65bMO2, or control MO. Inhibition of fam65b expression during development leads to a severely increased number of affected or dead embryos. C) High magnification of myosepta (red, laminin staining) and myofibers (green, MHC) in developing zebrafish embryos at d 1 following injection of control morpholino. D) High magnification of myosepta (red, laminin staining) and myofibers (green, MHC) in developing zebrafish embryos at d 1 following injection of fam65b MO1. The myosepta appear disrupted (arrows), and some myofiber disorganization is also observed.

expression. These findings can also explain why overexpression of Fam65b induces formation of cellular protrusions: binding between HDAC6 and Fam65b results in increased microtubule stability, due to decreased HDAC6 activity. Conversely, when high levels of acetylated tubulin are sensed, Fam65b expression decreases. This was seen using HDAC6specific inhibitors, which lead to hyperacetylation of tubulin and decreased Fam65b expression compared to control cultures. Although our current studies highlight functional interactions between Fam65b and HDAC6, it is likely that Fam65b transcription is also regulated by nuclear HDACs. In support of this, treatment of human myogenic cells with the pan-HDAC inhibitor TSA increases significantly Fam65b expression. It has been reported that low doses of TSA enhance myogenic differentiation by up-regulating the levels of follistatin, a natural inhibitor of myostatin (51). Interestingly, gene expression profiles of muscles from mice treated with a myostatin inhibitor show an increase in Fam65b expression (58, 59), suggesting that the level of Fam65b in 2966

Vol. 28

July 2014

muscle can be positively regulated via multiple mechanisms. A potential extension of these studies is the detection of tubulin acetylation level as an output measurement for screening the effectiveness of HDAC inhibitors on muscle cells. Experimental evidence indicates that HDAC inhibitors can be effective epigenetic drugs for muscular dystrophies (60). However, their beneficial effect on skeletal muscle can vary with dosage and type of inhibitor used (61). In our studies, sustained tubacin or BML281 treatment resulted in tubulin hyperacetylation and inhibition of myogenic differentiation, supporting the findings that Class II HDAC-specific inhibitors have a detrimental effect, inhibiting rather than promoting skeletal myogenesis (62). Thus, monitoring the levels of Fam65b, myogenin, and acetylated tubulin might be useful when optimizing a high-throughput drug screening of HDAC inhibitors to predict their effectiveness on skeletal muscle cells. Previous studies reported binding between dysferlin and HDAC6 in differentiating myogenic cells



(18). Given that HDAC6 and Fam65b also bind in differentiating muscle cells, we asked whether Fam65b, HDAC6, and dysferlin were part of the same protein complex. Our data implicate Fam65b as a critical partner that mediates binding between dysferlin and HDAC6. In human fetal myoblasts HDAC6 and dysferlin are expressed in both proliferating and differentiating cells. However, HDAC6 and dysferlin were found to interact only when Fam65b is expressed, suggesting that the interaction is dependent on the presence of Fam65b. In agreement with this hypothesis, HDAC6 inhibition did not alter the expression of dysferlin, while Fam65b expression was significantly modulated. Our previous studies found that Fam65b silencing leads to decreased myogenin expression and severe inhibition of fusion (24), while studies by others reported a decrease in myogenin expression when dysferlin is silenced (23). Our current studies demonstrating binding between HDAC6, Fam65b, and dysferlin unveil the possibility that the decrease in myogenin expression following dysferlin silencing could be due to a secondary decrease of Fam65b expression. In support of this conclusion, Fam65b expression is decreased in mRNA expression profiles of dysferlin null mice, particularly in the distal muscles (63). Similar results are also seen in expression profile studies from human samples (64). Mutations of Fam65b in animal models have not yet been reported, but decreased Fam65b expression in developing zebrafish leads to lethality and abnormalities within muscle tissue. Dysferlin zebrafish mopholinos also result in muscle abnormalities; however, the overall phenotype is less severe than what we have observed for Fam65b silencing (65). Thus, these initial studies suggest the possibility that loss of function of Fam65b in vertebrate skeletal muscle could also lead to disease. In addition, overexpression of dysferlin in mice also results in toxicity and muscle disease (66). While the expression of Fam65b in dysferlin transgenic mice is currently unknown, it will be an important point to investigate. Prior to considering induction of Fam65b as a potential approach to ameliorate diseased muscle, it will be important to ensure that sustained expression of Fam65b does not trigger long-term negative effects, as seen for dysferlin overexpression (66). In summary, these studies demonstrate a function for Fam65b in promoting muscle cell differentiation through an increase in tubulin acetylation and myogenin, which occur following binding of Fam65b with dysferlin and HDAC6. In addition, the studies in developing zebrafish suggest the possibility that Fam65b gene mutations can severely affect skeletal muscle development, supporting screening for DNA mutations in unknown human muscle diseases. The authors are grateful to Dr. Matthew Alexander, Dr. Natassia Vieira, and Dr. Angela Lek for helpful discussions. The authors thank Suzan Lazo-Kallanian (Hematologic NeoFAM65B COMPLEXES WITH HDAC6 AND DYSFERLIN

plasia Core facility, Dana Farber Cancer Institute, Boston, MA, USA) for assistance with the FACS isolation of primary myoblasts. The F59 antibody developed by F. E. Stockdale was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the U.S. National Institute of Child Health and Human Development and maintained by the University of Iowa (Iowa City, IA, USA). The authors thank Dr. Stuart L. Schreiber and Dr. Ralph Mazitschek (Harvard University, Cambridge, MA, USA) for their generous gift of tubacin and niltubacin inhibitors. This work was supported by the U.S. National Institutes of Health (1R01AR060317-01 to E.G.). The authors declare no conflicts of interest.

REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9.

10.

11.

12.

13.

14.

15.

16. 17.

Yaffe, D., and Feldman, M. (1965) The formation of hybrid multinucleated muscle fibers from myoblasts of different genetic origin. Dev. Biol. 11, 300 –317 Bischoff, R., and Holtzer, H. (1969) Mitosis and the processes of differentiation of myogenic cells in vitro. J. Cell Biol. 41, 188 –200 Konigsberg, I. R. (1971) Diffusion-mediated control of myoblast fusion. Dev. Biol. 26, 133–152 Rochlin, K., Yu, S., Roy, S., and Baylies, M. K. (2010) Myoblast fusion: when it takes more to make one. Dev. Biol. 341, 66 –83 Schejter, E. D., and Baylies, M. K. (2010) Born to run: creating the muscle fiber. Curr. Opin. Cell Biol. 22, 566 –574 Abmayr, S. M., and Pavlath, G. K. (2012) Myoblast fusion: lessons from flies and mice. Development 139, 641–656 Buckingham, M. (2006) Myogenic progenitor cells and skeletal myogenesis in vertebrates. Curr. Opin. Genet. Dev. 16, 525–532 Bentzinger, C. F., Wang, Y. X., and Rudnicki, M. A. (2012) Building muscle: molecular regulation of myogenesis. Cold Spring Harb. Perspect. Biol. 4 Choudhary, C., Kumar, C., Gnad, F., Nielsen, M. L., Rehman, M., Walther, T. C., Olsen, J. V., and Mann, M. (2009) Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science 325, 834 –840 Nguyen, D. X., Baglia, L. A., Huang, S. M., Baker, C. M., and McCance, D. J. (2004) Acetylation regulates the differentiationspecific functions of the retinoblastoma protein. EMBO J. 23, 1609 –1618 Di Bari, M. G., Ciuffini, L., Mingardi, M., Testi, R., Soddu, S., and Barila, D. (2006) c-Abl acetylation by histone acetyltransferases regulates its nuclear-cytoplasmic localization. EMBO Rep. 7, 727–733 Conacci-Sorrell, M., Ngouenet, C., and Eisenman, R. N. (2010) Myc-nick: a cytoplasmic cleavage product of Myc that promotes alpha-tubulin acetylation and cell differentiation. Cell 142, 480 – 493 Tran, A. D., Marmo, T. P., Salam, A. A., Che, S., Finkelstein, E., Kabarriti, R., Xenias, H. S., Mazitschek, R., Hubbert, C., Kawaguchi, Y., Sheetz, M. P., Yao, T. P., and Bulinski, J. C. (2007) HDAC6 deacetylation of tubulin modulates dynamics of cellular adhesions. J. Cell Sci. 120, 1469 –1479 Zilberman, Y., Ballestrem, C., Carramusa, L., Mazitschek, R., Khochbin, S., and Bershadsky, A. (2009) Regulation of microtubule dynamics by inhibition of the tubulin deacetylase HDAC6. J. Cell Sci. 122, 3531–3541 Zhang, X., Yuan, Z., Zhang, Y., Yong, S., Salas-Burgos, A., Koomen, J., Olashaw, N., Parsons, J. T., Yang, X. J., Dent, S. R., Yao, T. P., Lane, W. S., and Seto, E. (2007) HDAC6 modulates cell motility by altering the acetylation level of cortactin. Mol. Cell 27, 197–213 Wu, Y., Song, S. W., Sun, J., Bruner, J. M., Fuller, G. N., and Zhang, W. (2010) IIp45 inhibits cell migration through inhibition of HDAC6. J. Biol. Chem. 285, 3554 –3560 Azakir, B. A., Di Fulvio, S., Therrien, C., and Sinnreich, M. (2010) Dysferlin interacts with tubulin and microtubules in mouse skeletal muscle. PLoS ONE 5, e10122

2967

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

2968

Di Fulvio, S., Azakir, B. A., Therrien, C., and Sinnreich, M. (2011) Dysferlin interacts with histone deacetylase 6 and increases alpha-tubulin acetylation. PLoS ONE 6, e28563 Bashir, R., Britton, S., Strachan, T., Keers, S., Vafiadaki, E., Lako, M., Richard, I., Marchand, S., Bourg, N., Argov, Z., Sadeh, M., Mahjneh, I., Marconi, G., Passos-Bueno, M. R., Moreira Ede, S., Zatz, M., Beckmann, J. S., and Bushby, K. (1998) A gene related to Caenorhabditis elegans spermatogenesis factor fer-1 is mutated in limb-girdle muscular dystrophy type 2B. Nat. Genet. 20, 37–42 Liu, J., Aoki, M., Illa, I., Wu, C., Fardeau, M., Angelini, C., Serrano, C., Urtizberea, J. A., Hentati, F., Hamida, M. B., Bohlega, S., Culper, E. J., Amato, A. A., Bossie, K., Oeltjen, J., Bejaoui, K., McKenna-Yasek, D., Hosler, B. A., Schurr, E., Arahata, K., de Jong, P. J., and Brown, R. H., Jr. (1998) Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb girdle muscular dystrophy. Nat. Genet. 20, 31–36 Bansal, D., Miyake, K., Vogel, S. S., Groh, S., Chen, C. C., Williamson, R., McNeil, P. L., and Campbell, K. P. (2003) Defective membrane repair in dysferlin-deficient muscular dystrophy. Nature 423, 168 –172 Lennon, N. J., Kho, A., Bacskai, B. J., Perlmutter, S. L., Hyman, B. T., and Brown, R. H., Jr. (2003) Dysferlin interacts with annexins A1 and A2 and mediates sarcolemmal wound-healing. J. Biol. Chem. 278, 50466 –50473 de Luna, N., Gallardo, E., Soriano, M., Dominguez-Perles, R., de la Torre, C., Rojas-Garcia, R., Garcia-Verdugo, J. M., and Illa, I. (2006) Absence of dysferlin alters myogenin expression and delays human muscle differentiation “in vitro.” J. Biol. Chem. 281, 17092–17098 Yoon, S., Molloy, M. J., Wu, M. P., Cowan, D. B., and Gussoni, E. (2007) C6ORF32 is upregulated during muscle cell differentiation and induces the formation of cellular filopodia. Dev. Biol. 301, 70 –81 Lapan, A. D., and Gussoni, E. (2012) Isolation and characterization of human fetal myoblasts. Methods Mol. Biol. 798, 3–19 Lapan, A. D., Rozkalne, A., and Gussoni, E. (2012) Human fetal skeletal muscle contains a myogenic side population that expresses the melanoma cell-adhesion molecule. Hum. Mol. Genet. 21, 3668 –3680 Schmittgen, T. D., and Livak, K. J. (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108 Thisse, C., and Thisse, B. (2008) High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59 –69 Kawahara, G., Guyon, J. R., Nakamura, Y., and Kunkel, L. M. (2010) Zebrafish models for human FKRP muscular dystrophies. Hum. Mol. Genet. 19, 623–633 Cerletti, M., Molloy, M. J., Tomczak, K. K., Yoon, S., Ramoni, M. F., Kho, A. T., Beggs, A. H., and Gussoni, E. (2006) Melanoma cell adhesion molecule is a novel marker for human fetal myogenic cells and affects myoblast fusion. J. Cell Sci. 119, 3117–3127 McKinsey, T. A., Zhang, C. L., and Olson, E. N. (2001) Identification of a signal-responsive nuclear export sequence in class II histone deacetylases. Mol. Cell. Biol. 21, 6312–6321 Chang, S., Bezprozvannaya, S., Li, S., and Olson, E. N. (2005) An expression screen reveals modulators of class II histone deacetylase phosphorylation. Proc. Natl. Acad. Sci. U.S.A. 102, 8120 –8125 Backs, J., Song, K., Bezprozvannaya, S., Chang, S., and Olson, E. N. (2006) CaM kinase II selectively signals to histone deacetylase 4 during cardiomyocyte hypertrophy. J. Clin. Invest. 116, 1853–1864 Nishino, T. G., Miyazaki, M., Hoshino, H., Miwa, Y., Horinouchi, S., and Yoshida, M. (2008) 14-3-3 regulates the nuclear import of class IIa histone deacetylases. Biochem. Biophys. Res. Commun. 377, 852–856 Gundersen, G. G., Khawaja, S., and Bulinski, J. C. (1989) Generation of a stable, posttranslationally modified microtubule array is an early event in myogenic differentiation. J. Cell Biol. 109, 2275–2288

Vol. 28

July 2014

36. 37.

38.

39. 40.

41. 42. 43.

44.

45.

46. 47.

48.

49.

50.

51.

52. 53. 54.

Conacci-Sorrell, M., and Eisenman, R. N. (2011) Post-translational control of Myc function during differentiation. Cell Cycle 10, 604 –610 Lu, J., McKinsey, T. A., Nicol, R. L., and Olson, E. N. (2000) Signal-dependent activation of the MEF2 transcription factor by dissociation from histone deacetylases. Proc. Natl. Acad. Sci. U.S.A. 97, 4070 –4075 Lu, J., McKinsey, T. A., Zhang, C. L., and Olson, E. N. (2000) Regulation of skeletal myogenesis by association of the MEF2 transcription factor with class II histone deacetylases. Mol. Cell 6, 233–244 McKinsey, T. A., Zhang, C. L., Lu, J., and Olson, E. N. (2000) Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature 408, 106 –111 McKinsey, T. A., Zhang, C. L., and Olson, E. N. (2000) Activation of the myocyte enhancer factor-2 transcription factor by calcium/calmodulin-dependent protein kinase-stimulated binding of 14-3-3 to histone deacetylase 5. Proc. Natl. Acad. Sci. U.S.A. 97, 14400 –14405 McKinsey, T. A., Zhang, C. L., and Olson, E. N. (2001) Control of muscle development by dueling HATs and HDACs. Curr. Opin. Genet. Dev. 11, 497–504 Boyault, C., Sadoul, K., Pabion, M., and Khochbin, S. (2007) HDAC6, at the crossroads between cytoskeleton and cell signaling by acetylation and ubiquitination. Oncogene 26, 5468 –5476 Valenzuela-Fernandez, A., Cabrero, J. R., Serrador, J. M., and Sanchez-Madrid, F. (2008) HDAC6: a key regulator of cytoskeleton, cell migration and cell-cell interactions. Trends Cell Biol. 18, 291–297 Lek, A., Evesson, F. J., Lemckert, F. A., Redpath, G. M., Lueders, A. K., Turnbull, L., Whitchurch, C. B., North, K. N., and Cooper, S. T. (2013) Calpains, cleaved mini-dysferlinC72, and L-type channels underpin calcium-dependent muscle membrane repair. J. Neurosci. 33, 5085–5094 Lo, H. P., Cooper, S. T., Evesson, F. J., Seto, J. T., Chiotis, M., Tay, V., Compton, A. G., Cairns, A. G., Corbett, A., MacArthur, D. G., Yang, N., Reardon, K., and North, K. N. (2008) Limb-girdle muscular dystrophy: diagnostic evaluation, frequency and clues to pathogenesis. Neuromuscul. Disord. 18, 34 –44 Davis, D. B., Delmonte, A. J., Ly, C. T., and McNally, E. M. (2000) Myoferlin, a candidate gene and potential modifier of muscular dystrophy. Hum. Mol. Genet. 9, 217–226 Doherty, K. R., Cave, A., Davis, D. B., Delmonte, A. J., Posey, A., Earley, J. U., Hadhazy, M., and McNally, E. M. (2005) Normal myoblast fusion requires myoferlin. Development 132, 5565–5575 Demonbreun, A. R., Posey, A. D., Heretis, K., Swaggart, K. A., Earley, J. U., Pytel, P., and McNally, E. M. (2010) Myoferlin is required for insulin-like growth factor response and muscle growth. FASEB J. 24, 1284 –1295 Haggarty, S. J., Koeller, K. M., Wong, J. C., Grozinger, C. M., and Schreiber, S. L. (2003) Domain-selective small-molecule inhibitor of histone deacetylase 6 (HDAC6)-mediated tubulin deacetylation. Proc. Natl. Acad. Sci. U.S.A. 100, 4389 –4394 Kozikowski, A. P., Tapadar, S., Luchini, D. N., Kim, K. H., and Billadeau, D. D. (2008) Use of the nitrile oxide cycloaddition (NOC) reaction for molecular probe generation: a new class of enzyme selective histone deacetylase inhibitors (HDACIs) showing picomolar activity at HDAC6. J. Med. Chem. 51, 4370 –4373 Iezzi, S., Di Padova, M., Serra, C., Caretti, G., Simone, C., Maklan, E., Minetti, G., Zhao, P., Hoffman, E. P., Puri, P. L., and Sartorelli, V. (2004) Deacetylase inhibitors increase muscle cell size by promoting myoblast recruitment and fusion through induction of follistatin. Dev. Cell. 6, 673–684 Bassett, D. I., and Currie, P. D. (2003) The zebrafish as a model for muscular dystrophy and congenital myopathy. Hum. Mol. Genet. 12(Spec. No. 2), R265–R270 Guyon, J. R., Steffen, L. S., Howell, M. H., Pusack, T. J., Lawrence, C., and Kunkel, L. M. (2007) Modeling human muscle disease in zebrafish. Biochim. Biophys. Acta 1772, 205–215 Bassett, D. I., Bryson-Richardson, R. J., Daggett, D. F., Gautier, P., Keenan, D. G., and Currie, P. D. (2003) Dystrophin is required for the formation of stable muscle attachments in the zebrafish embryo. Development 130, 5851–5860



55.

56.

57.

58.

59.

60.

61.

Guyon, J. R., Mosley, A. N., Jun, S. J., Montanaro, F., Steffen, L. S., Zhou, Y., Nigro, V., Zon, L. I., and Kunkel, L. M. (2005) Delta-sarcoglycan is required for early zebrafish muscle organization. Exp. Cell Res. 304, 105–115 Etard, C., Roostalu, U., and Strahle, U. (2010) Lack of Apobec2related proteins causes a dystrophic muscle phenotype in zebrafish embryos. J. Cell Biol. 189, 527–539 Rey, M., Irondelle, M., Waharte, F., Lizarraga, F., and Chavrier, P. (2011) HDAC6 is required for invadopodia activity and invasion by breast tumor cells. Eur. J. Cell Biol. 90, 128 –135 Welle, S., Burgess, K., and Mehta, S. (2009) Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in mature mice. Am. J. Physiol. Endocrinol. Metab. 296, E567–E572 Rahimov, F., King, O. D., Warsing, L. C., Powell, R. E., Emerson, C. P., Jr., Kunkel, L. M., and Wagner, K. R. (2011) Gene expression profiling of skeletal muscles treated with a soluble activin type IIB receptor. Physiol. Genomics 43, 398 –407 Consalvi, S., Saccone, V., Giordani, L., Minetti, G., Mozzetta, C., and Puri, P. L. (2011) Histone deacetylase inhibitors in the treatment of muscular dystrophies: epigenetic drugs for genetic diseases. Mol. Med. 17, 457–465 Colussi, C., Banfi, C., Brioschi, M., Tremoli, E., Straino, S., Spallotta, F., Mai, A., Rotili, D., Capogrossi, M. C., and Gaetano, C. (2010) Proteomic profile of differentially expressed plasma proteins from dystrophic mice and following suberoylanilide hydroxamic acid treatment. Proteomics Clin. Appl. 4, 71–83


62.

63.

64.

65.

66.

Nebbioso, A., Manzo, F., Miceli, M., Conte, M., Manente, L., Baldi, A., De Luca, A., Rotili, D., Valente, S., Mai, A., Usiello, A., Gronemeyer, H., and Altucci, L. (2009) Selective class II HDAC inhibitors impair myogenesis by modulating the stability and activity of HDAC-MEF2 complexes. EMBO Rep. 10, 776 –782 Von der Hagen, M., Laval, S. H., Cree, L. M., Haldane, F., Pocock, M., Wappler, I., Peters, H., Reitsamer, H. A., Hoger, H., Wiedner, M., Oberndorfer, F., Anderson, L. V., Straub, V., Bittner, R. E., and Bushby, K. M. (2005) The differential gene expression profiles of proximal and distal muscle groups are altered in pre-pathological dysferlin-deficient mice. Neuromuscul. Disord. 15, 863–877 Bakay, M., Wang, Z., Melcon, G., Schiltz, L., Xuan, J., Zhao, P., Sartorelli, V., Seo, J., Pegoraro, E., Angelini, C., Shneiderman, B., Escolar, D., Chen, Y. W., Winokur, S. T., Pachman, L. M., Fan, C., Mandler, R., Nevo, Y., Gordon, E., Zhu, Y., Dong, Y., Wang, Y., and Hoffman, E. P. (2006) Nuclear envelope dystrophies show a transcriptional fingerprint suggesting disruption of Rb-MyoD pathways in muscle regeneration. Brain 129, 996 –1013 Kawahara, G., Serafini, P. R., Myers, J. A., Alexander, M. S., and Kunkel, L. M. (2011) Characterization of zebrafish dysferlin by morpholino knockdown. Biochem. Biophys. Res. Commun. 413, 358 –363 Glover, L. E., Newton, K., Krishnan, G., Bronson, R., Boyle, A., Krivickas, L. S., and Brown, R. H., Jr. (2010) Dysferlin overexpression in skeletal muscle produces a progressive myopathy. Ann. Neurol. 67, 384 –393 Received for publication November 19, 2013. Accepted for publication March 17, 2014.

2969