American Journal of Botany 92(4): 625–633. 2005.
MOLECULAR PHYLOGENY OF INCARVILLEA (BIGNONIACEAE) BASED ON ITS AND TRNL-F SEQUENCES1 SHAOTIAN CHEN,2 KAIYUN GUAN,2 ZHEKUN ZHOU,2,3 RICHARD OLMSTEAD,4 AND QUENTIN CRONK5 Kunming Institute of Botany, Chinese Academy of Sciences, Heilongtan, Kunming, Yunnan, 650204, P. R. China; 4Department of Biology, University of Washington, Hitchcock Hall Rm 423, Seattle, Washington 98195 USA; 5UBC Botanical Garden & Centre for Plant Research, Faculty of Agricultural Sciences, University of British Columbia, 6804 Southwest Marine Drive, Vancouver, British Columbia V6T 1Z4 Canada 2
Incarvillea is a herbaceous and temperate member of Bignoniaceae, previously divided into four subgenera, Niedzwedzkia, Amphicome, Incarvillea, and Pteroscleris. Niedzwedzkia and Amphicome have in the past been treated as independent genera. Different relationships have been proposed for the four subgenera. Here, maximum parsimony analysis using ITS and trnL-F sequences resulted in similar trees and showed that the genus is monophyletic. Analysis of the combined data resulted in a single tree with five major clades highly supported and well resolved. The relationships of the five major clades are (subgenus Niedzwedzkia (Incarvillea olgae (subgenus Amphicome (subgenus Incarvillea, subgenus Pteroscleris)))). All four subgenera are well supported for monophyly, with the exception of subgenus Incarvillea, represented here by I. sinensis and I. olgae. Incarvillea olgae is not closely related to I. sinensis, a conclusion supported by morphology. The two basal monotypic subgenera are found in Central Asia. The most species-rich subgenus, Pteroscleris, has 10 species in the Himalaya-Hengduan Mountains and may have dispersed early from central Asia to eastern Asia. Short branch lengths on the molecular trees within Pteroscleris suggest a recent and rapid radiation of this rosette-forming subgenus, perhaps connected with the uplift of the Himalaya-Hengduan massif. Key words:
Bignoniaceae; classification; Himalaya-Hengduan Mountains; Incarvillea; ITS; phylogenetics; radiation; trnL-F.
Incarvillea Juss. is notable for being a temperate and herbaceous genus of the primarily tropical and woody family Bignoniaceae (Fig. 1). It is composed of 16 species (Grierson, 1961; Zhao, 1988; Wang et al., 1991; Grey-Wilson, 1998), and the modern classification of Incarvillea was established by Grierson (1961) who divided the genus into four subgenera, Amphicome (Royle) R. Br. apud Royle, Incarvillea, Pteroscleris Baillon, and Niedzwedzkia (B. Fedtsch.) Grierson. Although the subgenera differ considerably in many characters (including habit, calyx, stamens, capsule texture, and seeds), morphological classification is complicated due to extensive apparent character convergence. Therefore, Grierson (1961) drew only tentative conclusions about evolutionary relationships within Incarvillea (Fig. 2A). Three subgenera, Incarvillea, Amphicome, and Pteroscleris are found in China, and in Flora Reipublicae Sinicae (Wang et al., 1990), a different relationship between them (Fig. 2B) was postulated from that of Grierson. Furthermore, subgenus Amphicome was once placed variously in Gesneriaceae or Bignoniaceae as a genus (Don, 1837; Bureau, 1864; Burtt and Grierson, 1953). Based on the karyomorphology and morphology, Chen et al. (2004) suggested that the three subgenera, Amphicome, Incarvillea, and Pteroscleris, should all be treated as genera. The subgenus Niedzwedzkia was originally described in Pedaliaceae and then
was put into Bignoniaceae as an independent genus (Vassilczenko, 1957, 1958). The geographical distribution of the genus is interesting. Most of the species occur in the Himalayas and S. W. China, where the diversity of the mainly herbaceous species appears to be related to the uplift of the Himalaya-Hengduan Mountains (Chen et al., 2003). However, a number of species (all with basal woodiness) are distributed through Central Asia and into Mongolia (Fig. 3). Subgenera Amphicome and Incarvillea are found in eastern and central Asia, whereas subgenus Pteroscleris is endemic to the Himalaya-Hengduan region (E. Asia). Subgenus Niedzwedzkia and the distinctive I. olgae Regel are endemic to central Asia. In this paper, we used ITS and trnL-F sequences to produce a phylogenetic framework on which to assess previous work on the classification of Incarvillea, particularly the number and relationships of natural groups in the genus. MATERIALS AND METHODS Samples and DNA extraction—We sampled 13 species of Incarvillea representing all four subgenera (Grierson, 1961). The three species not sampled are two that may be extinct (I. altissima G. Forrest and I. forrestii Fletcher, both in subgenus Pteroscleris) and I. potaninii Batalin from Mongolia, which was not obtainable for this study. Considering the historically unstable positions of subgenera Amphicome and Niedzwedzkia in Bignoniaceae, Gesneriaceae, and Pedaliaceae in the history of the genus, we selected one species from each of these families in order to be certain of the placement of Incarvillea. Tecomaria capensis (Thunb.) Spach, Sesamum indicum L., and Nematanthus strigillosus (Mart.) H. E. Moore were thus added into the analysis as outgroups, and the tree was rooted on Scrophularia ningpoensis Hemsl. In addition, we selected six further outgroups in Bignoniaceae for the trnLF analyses to test the monophyly of the genus. These are Campsidium valdiviana (Phil.) Bull, Campsis radicans Seem., Pandorea jasminoides Schum., Podranea ricasoliana Sprague, Tecoma stans Juss. and Tecomanthe volubilis
1 Manuscript received 21 January 2004; revision accepted 16 December 2004. The authors thank Dr. Mark Chase (Royal Botanic Gardens, Kew) for gifting the DNA sample of Incarvillea emodi. We are grateful to the National Key Basic Research Program (973) (2003CB415102), National Natural Science Foundation (40332021), and the Chinese Academy of Science Innovation Project (KSCX2–1–09) for support. 3 Author for correspondence (e-mail:
[email protected]) phone: 86– 871–5219932, fax: 86–871–5150227
625
626
AMERICAN JOURNAL
OF
BOTANY
[Vol. 92
Fig. 1. Growth habits of Incarvillea arguta, I. zhongdianensis, and I. mairei var. mairei. Incarvillea arguta has the much branched habit characteristic of subgenus Amphicome and contrasts with I. zhongdianensis and I. mairei var. mairei with the herbaceous habit characteristic of subgenus Pteroscleris. (A, B) I. arguta. (C) I. zhongdianensis. (D) I. mairei var. mairei.
L.S. Gibbs subsp. volubilis, all related Incarvillea, following the results of a study of the family based on three genes by Olmstead et al. (2002). The Incarvillea semiretschenskia Grierson sample was collected from a herbarium specimen (E), and DNA of I. emodi (Lindl.) Chatterjee was provided by Dr. Mark Chase. Sequences of Sesamum indicum and Nematanthus strigillosus were obtained from GenBank (Beardsley and Olmstead, 2002; Bremer et al., 2002; Zimmer, 2002). Other materials were collected from the field and Kunming Botanic Garden (Appendix, see Supplemental Data accompanying the online version of this article). DNA was extracted from silica-
gel-dried leaves using a DNA extraction kit (Watson Biotechnologies, Shanghai, P.R. China). Amplification, sequencing and sequence alignment—The whole internal transcribed spacer region was amplified using primers ITS4 and ITS5 (White et al., 1990) for all materials except I. semiretschenskia, for which four primers (ITS2, ITS3, ITS4, and ITS5) were used. The universal primers trnc and trnf of Taberlet et al. (1991) were used for the trnL-F amplification, according to the following protocol: 948C for 3 min; 35 cycles of 948C for 30 s, 538C
Fig. 2. Comparison between three kinds of phylogenetic arrangements of groups in Incarvillea. (A) based on the revision of Grierson. (B) based on Flora Reipublicae Sinicae. (C) based on combined analysis of ITS and trnL-F sequences.
April 2005]
CHEN
ET AL.—MOLECULAR PHYLOGENY OF INCARVILLEA
627
Fig. 3. Distribution of the genus Incarvillea, showing the E Asian distribution of subgenus Pteroscleris (solid line) and Incarvillea sinensis (dotted line). Other species are scattered through Central Asia and Mongolia with the exception of I. arguta (subgenus Amphicome) in E Asia.
for 30 s, 728C for 1 min; 728C for 7 min. PCR products were subsequently visualized on a 1% low-melting temperature agarose gel, then were cut from the gel and purified using a gel extraction kit (Watson Biotechnologies). Purified products were sequenced in both directions, using the same conditions as the PCR. ITS sequences of all species were obtained using primer ITS4 and ITS5, except for I. semiretschenskia for which ITS2 and ITS3 were used. Four primers, trnc, trnd, trne and trnf were used for trnL-F sequencing of all material. Sequencing was carried out on an ABI 3100 automated sequencer (Applied Biosystems, Foster City, California, USA) at Kunming Institute of Zoology. Sequences were aligned using Clustal W (Higgins, 1994) with minor manual adjustments. The trnL-F sequences of six further outgroups were obtained using the following procedures. The protocol for PCR and sequencing was 35 cycles of 948C for 1 min, 508C for 1 min, and 728C for 1 min. PCR products were purified using Qiaquick spin-columns (Qiagen Inc., California, USA) according to the manufacturer’s protocol. Sequences of both strands of the PCR product were generated on an ABI 377 (Applied Biosystems). The resulting sequences were compiled and compared using the program Sequencher version 3.0 (Gene Codes Corp., Ann Arbor, Michigan, USA). Sequences of all primers used for PCR amplification and sequencing are listed in Table 1. Phylogenetic analysis—Phylogenetic analyses were performed using PAUP*: phylogenetic analysis using parsimony (* and other methods), version 4.0 Beta10 (Swofford, 2001) on a Macintosh (eMac) computer using a max-
TABLE 1. Sequences of all primers used for PCR amplification and sequencing. Primer names
Sequences (59 to 39)
ITS2 ITS3 ITS4 ITS5 trnc trnd trne trnf
GCTCGTTCTTCATCGATGC GCATCGATGAAGAACGTAGC TCCTCCGCTTATTGATATGC GGAAGTAAAAGTCGTAACAAGG CGAAATCGGTAGACGCTACG GGGGATAGAGGGACTTGAAC GGTTCAAGTCCCTCTA ATTTGAACTGGTGACACGAG
imum parsimony (MP) approach. Characters were weighted equally and were unordered. Gaps were treated as missing data rather than as a fifth character. A heuristic research was conducted using 1000 random taxon addition replicates, and 10 trees were held in each step during stepwise addition. Other tree search options included tree-bisection-reconnection (TBR) branch swapping, steepest descent off, MulTrees on. To estimate the support for individual clades, heuristic bootstrapping (1000 resampling replicates) was performed. Decay indices (Bremer, 1988) were calculated manually. The ITS sequences of six other outgroups in trnL-F data set were not obtained in this study, so we combined ITS and trnL-F sequences of all taxa except these six relatives as a combined data set. We assessed the degree of phylogenetic incongruence between ITS and trnL-F partitions using the incongruence-length difference (ILD) test (Mickevich and Farris, 1981; Farris et al., 1995) in PAUP* 4.0b10, with 1000 replications using a heuristic tree search with 10 addition sequence replicates. To ensure the accuracy of the P value in the ILD test, only parsimony informative positions were used.
RESULTS Sequence characteristics—ITS—The length of ITS (ITS1, ITS2, including 5.8S) sequences in Incarvillea ranged from 622 to 628 bp, giving an aligned matrix of 667 characters, 152 (22.79%) of which were phylogenetically informative. ITS1 varied from 236 to 240 bp in length with an aligned length of 258. Of these, 67 sites were informative. ITS2 ranged from 227 to 231 bp, with an aligned length of 251 characters, 81 of which were informative. The length of 5.8S varied from 150 to 152 bp (aligned 152 with three informative sites). The remaining six sites in the aligned matrix are from 26S. trnL-F—A poly-G region of about 18 guanines at approximately 120 bp from the 39 end in Incarvillea proved difficult to sequence accurately, so the sequences were excluded at this point. The trnL-F sequences of Incarvillea used in this study varied in length from 715 to 753 bp. The length of the trnL intron region varied from 434 to 446 bp. The trnL 39 exon was 50 bp. The sequenced part of the trnL-F spacer region varied from 236 to 257 bp in length. The alignment resulted
628 TABLE 2.
AMERICAN JOURNAL
OF
BOTANY
[Vol. 92
Sequence characteristics of species studied. Parameter
ITS
trnL-F
Length range (bp) Length range (ingroup) (bp) Length range (outgroup) (bp) Aligned length (bp) G 1 C content range (%) G 1 C content mean (%) Sequence divergence (ingroup) (%) Sequence divergence (in/outgroup) (%) Size of indels (ingroup) Size of indels (total) Number of indels (ingroup) Number of indels (total) Number of variable sites (%) Number of constant sites (%) Number of informative sites (%) Number of autapomorphic sites (%) Transitions Transversions Transitions/transversions
588–628 622–628 588–628 667 55.15–66.78 58.59 0–8.85 13.63–22.38 1–2 1–21 13 42 254 (38.08) 413 (61.92) 152 (22.79) 102 (15.29) 200 111 1.8
715–778 715–753 751–778 826 33.59–37.40 35.88 0–8.45 3.79–14.87 1–11 1–11 20 44 195 (23.61) 631 (76.39) 115 (13.92) 80 (9.69) 37 57 0.65
in a data set with 826 characters, including 115 phylogenetic informative sites (13.92%) and 69 variable but uninformative sites. Sequence characteristics are given in Table 2. Phylogenetic analysis—Individual analyses—Parsimony analysis of the ITS data matrix resulted in only one most parsimonious tree of 482 steps (Fig. 4, CI 5 0.720, RI 5 0.667). The genus Incarvillea is a monophyletic group with 100% bootstrap support and is sister to Tecomaria (bootstrap value 5 90%). There are five major clades in the genus and in all eight clades have bootstrap support of 50% or higher. Four of the five major clades are equivalent to the four subgenera in the system of Grierson except that I. olgae, which was put into subgenus Incarvillea by Grierson, does not group with I. sinensis Lam. The relationship between the five major clades is fully resolved but without good bootstrap support. Two subgenera, Amphicome and Pteroscleris have bootstrap support of greater than 50% (53% and 100%, respectively). MP analysis of the trnL-F data set generated 16 equally parsimonious trees of 260 steps with consistency index (CI) 5 0.892 and retention index (RI) 5 0.948. In the strict consensus tree (Fig. 5), seven clades in the genus Incarvillea have bootstrap support of 50% or higher. The genus Incarvillea is monophyletic with strong support (100%), and nested in Bignoniaceae (bootstrap value 5 100%), but the relationship with other Bignoniaceae taxa is not resolved. Five major clades (identical to those suggested by ITS) were recovered but the relationships between them were poorly resolved with the exception of I. sinensis being sister to the subgenus Pteroscleris clade (bootstrap value 5 73%). Combined analyses—In the homogeneity test, the combined data provided a P value of 0.597: the null hypothesis of congruence is not rejected; therefore, we combined the ITS and trnL-F data sets into a single matrix for phylogenetic analyses. Phylogenetic analysis of the combined data set yielded one most parsimonious tree of 733 steps with CI 5 0.795 and RI 5 0.803 (Fig. 6). This tree has the same topology in the genus Incarvillea as the ITS tree, differing only in the relative arrangement of Sesamum indicum and Nematanthus strigillosus.
The combined analysis had higher bootstrap values on the ingroup nodes than in the separate analyses of the two sequences. The genus Incarvillea is strongly supported as monophyletic with a bootstrap value of 100%, and the same five major clades are generated within the genus as in the separate analyses. The relationships between the five major clades all have bootstrap support, and a further five clades are also supported. DISCUSSION The genus Incarvillea is a natural group—A persistent question in Incarvillea taxonomy concerns the rank and position of Amphicome and Niedzwedzkia (Don, 1837; Bureau, 1864; Burtt and Grierson, 1953; Vassilczenko, 1957, 1958; Grierson, 1961). In this study, Incarvillea as delimited by Grierson (including the genera Amphicome and Niedzwedzkia) is monophyletic with respect to Tecomaria with very strong support (100% bootstrap) in analysis of ITS and combined data sets. Monophyly is also confirmed by the analysis of the trnL-F data set with more Bignoniaceae taxa (100% bootstrap). None of the three data sets (ITS, trnL-F, and combined) conflict with the placement of the genera Amphicome and Niedzwedzkia in the genus Incarvillea sensu lato (s.l.), although the sister group relationship of Niedzwedzkia with the rest of Incarvillea does not rule out separate generic treatment for this taxon. The sole species of Niedzwedzkia, now called I. semiretschenskia, has several unique characteristics within the genus, such as a winged capsule, septifragal dehiscence, and calyx tubular only at base (Table 3). The similarity of the species in karyomorphology and pollen characters supports the genus as a natural group. The chromosome number of all species reported is 2n 5 22 (Sugiura, 1936; Bowden, 1940; Fedorov, 1969; Xiao et al., 2002; Chen et al., 2003), and their interphase nuclei and prophase chromosomes are of the simple chromocenter and interstitial type, respectively, although there is some variation in karyotype features (Xiao et al., 2002; Chen et al., 2003). The species also have very similar pollen morphology (Wang et al., 1997; Wei et al., 2001; Chen et al., 2003).
April 2005]
CHEN
ET AL.—MOLECULAR PHYLOGENY OF INCARVILLEA
629
Fig. 4. The single most parsimonious tree based on ITS sequences. Length 5 482, CI 5 0.720, RI 5 0.667, RC 5 0.481. Numbers below branches indicate bootstrap values (%), and branch length and decay value (in parentheses) are above branches. Names of subgenera are shown on right. O 5 Incarvillea olgae. N 5 Subgenus Niedzwedzkia.
Subdivision of the genus—The separate and combined analyses all support the existence of five major clades: these are (1) subgenus Niedzwedzkia (I. semiretschenskia), (2) I. olgae, (3) subgenus Amphicome, (4) Incarvillea, and (5) subgenus Pteroscleris (Fig. 2C). Two subgenera in the system of Grierson (besides the monotypic subgenus Niedzwedzkia), Amphicome and Pteroscleris, are monophyletic groups. In all analyses, the Amphicome clade has bootstrap support of more than 50%, and the Pteroscleris clade is very strongly supported (bootstrap value 5 100%). In the system of Grierson, subgenus Incarvillea is composed of three species, Incarvillea olgae, I. sinensis, and the Mongolian I. potaninii. Material of I. potaninii was not available to us, but I. olgae was not related to I. sinensis in any of the
analyses. This reflects morphology, as I. olgae is different from other species of subgenus Incarvillea in morphological characters such as the paniculate inflorescence, opposite leaves, calyx teeth base not swollen, and no calyx tube groove between calyx teeth (Table 3). These characters are peculiar to I. olgae. We therefore suggest that I. olgae should be separated from subgenus Incarvillea as a new monotypic subgenus. I. potaninii, on the other hand, closely resembles I. sinensis in all morphological features. All groups suggested here are clearly distinctive on the basis of morphology (Table 3), allowing the genus to be readily divided into five formal taxonomic units. Relationship between clades in the genus—Grierson (1961) drew tentative conclusions about the evolutionary re-
630
AMERICAN JOURNAL
OF
BOTANY
[Vol. 92
Fig. 5. The strict consensus tree of four equally parsimonious trees based on trnL-F. Length 5 260, CI 5 0.892, RI 5 0.948, RC 5 0.846. Numbers below branches indicate bootstrap values (%), and branch length and decay value (in parentheses) are above branches. Names of subgenera are shown on right. N 5 Subgenus Niedzwedzkia. O 5 Incarvillea olgae.
lationships between his four subgenera based on the distribution of characters in the Bignoniaceae generally: he considered subgenus Amphicome and subgenus Incarvillea relatively primitive, although he regarded the Incarvillea as more advanced in view of the presence of an annual species. Subgenus Pteroscleris he regarded as advanced and more closely related to subgenus Incarvillea (Fig. 2A). There are three subgenera in China, and Fig. 2B shows the classification used in Flora Reipublicae Sinicae (Wang et al., 1991). The difference be-
tween this treatment and Grierson’s is in the phylogenetic arrangement of subgenus Amphicome and subgenus Incarvillea. Our study suggests relationships between subgenera as follow: (subgenus Niedzwedzkia (Incarvillea olgae (subgenus Amphicome (subgenus Incarvillea, subgenus Pteroscleris)))). This supports Grierson’s treatment, with subgenus Niedzwedzkia basal, but with a separate position for I. olgae (Fig. 2). In this context, taking the subgeneric rank of the other four clades into account, we think I. olgae should be accommodated in a
April 2005]
CHEN
ET AL.—MOLECULAR PHYLOGENY OF INCARVILLEA
631
Fig. 6. The single most parsimonious tree based on the combined data set of ITS and trnL-F sequences. Length 5 733, CI 5 0.795, RI 5 0.803, RC 5 0.639. Numbers below branches indicate bootstrap values (%). Branch length and decay value (in parentheses) are above branches. Names of subgenera are shown near the tree. Five major branches and their distributions are shown on the right. O 5 Incarvillea olgae. N 5 Subgenus Niedzwedzkia. C 5 Central Asia. CA 5 Central Asia and Afghanistan. AH 5 Afghanistan and Himalaya-Hengduan Mountains. H 5 Himalaya-Hengduan Mountains. HM 5 Area from Himalaya-Hengduan Mountains to Mongolia.
new monotypic subgenus, which will be described in a future paper. Gentry (1980) maintained that it is very difficult to understand the phylogeny within Bignoniaceae because of ‘‘rampant parallelisms and convergence in nearly every taxonomically important characteristics.’’ The same applies to the genus Incarvillea. On the basis of the molecular data, however, it is evident that some morphological characters are useful for defining the subgenera (Table 3). Incarvillea semiretschenskia is the only species with septifragal capsules. In the family, the phylogenetic arrangement of Gentry (1980) implied that dehiscent fruits with the septum perpendicular to the valves gave rise to indehiscent fruits and
to dehiscent fruits with the septum parallel to the valves. Fruits dehiscing perpendicular to valves may be a plesiomorphy (Spangler and Olmstead, 1999). Incarvillea semiretschenskia maintains this possibly ancestral state and occupies the basal position in the genus. Subgenus Pteroscleris is herbaceous and other groups are suffruticose, supporting the notion of Pteroscleris as a group with several advanced characters. Some populations of I. sinensis (subgenus Incarvillea) are annual, which is also probably a derived condition. As regards pollen morphology, in features such pollen grain size and the number and shape of colpi, subgenus Pteroscleris has also been considered to possess advanced characters and Amphicome primitive ones, while subgenus Incarvillea is transitional between
632 TABLE 3.
AMERICAN JOURNAL
OF
BOTANY
[Vol. 92
Comparison of morphology between five major clades. Subgen. Niedzwedzkia
Habit Leaf Calyx teeth Calyx Calyx teeth base Inflorescence Anther Capsule shape
Suffruticose Alternate 5 Tube at base Not swollen Racemose Glabrous Ovate
Capsule texture Capsule dehiscence Capsule wing Seed
Subligneous Septifragal Six wings, longitudinal Opaque wing
Subgen. Incarvillea
Subgen. Amphicome
Suffruticose Alternate 5 Tube Not swollen Racemose Pilose Elongate, linear cylindrical Fibrous Loculicidal No Coma at ends
the two (Chen et al., 2003). In karyomorphology too, features such as the size of chromosomes and the asymmetry of the karyotype, suggest that subgenus Amphicome has primitive characters and subgenus Pteroscleris advanced ones, while subgenus Incarvillea is intermediate between the two subgenera (Chen et al., 2004). These characteristics are all consistent with Grierson’s views of the evolution of these three subgenera (1961) (Fig. 2A), with the exception of I. olgae. In subgenus Pteroscleris, two sections have been proposed, caulescent and acaulous (Zhao, 1985), but this division is not supported by our studies. Of the species sampled from subgenus Pteroscleris, two species, I. beresowskii Batalin and I. lutea Bur. et Fanch., are caulescent. Incarvillea compacta Maxim. has a short stem, and the others, I. mairei (Le´vl.) Grierson, I. dissectifoliola Q. S. Zhao, I. zhongdianensis GreyWilson, I. younghusbandii Sprague, and I. delavayi Bur. et Fanch., are acaulous. Two caulescent species are scattered among the acaulous species in all three analyses (Figs. 4–6). Biogeographical considerations—Two basal subgenera, Niedzwedzkia and ‘‘Incarvillea olgae,’’ are endemic to central Asia, while the apparently most derived group, subgenus Pteroscleris, is distributed in the eastern Himalaya and the Hengduan Mountains. The short branch lengths on the phylogenetic trees within subgenus Pteroscleris may indicate that these species have undergone a recent radiation, perhaps related to the uplift of the Himalaya-Hengduan massifs. The Himalaya and Hengduan Mountains are currently the center of diversity for the genus with three subgenera and 14 species (Fig. 3). This suggests the dispersal of Incarvillea may have been from central Asia to eastern Asia. If so, this dispersal must have happened at least before the Miocene, after which the Himalaya Mountains would have been an effective barrier to migration. Subgenus Amphicome is interesting because it has one species shared between central Asia and eastern Asia, perhaps indicating ancient dispersal of this relatively basal group. Pteroscleris is adapted to the high altitude environment of the Himalaya-Hengduan Mountains and has there undergone a considerable radiation. The continuous distribution of subgenus Incarvillea from Himalaya-Henduan Mountains to the Russian Far East, on the other hand, could be at least partly the result of Quaternary expansion as part of its range was glaciated.
Subgen. Pteroscleris
Incarvillea olgae
Suffruticose Alternate 10 Tube Swollen Racemose Glabrous Cylindrical
Herbaceous Alternate or radical 5 Tube Not swollen Racemose Glabrous Cylindrical
Suffruticose Opposite 5 Tube Not swollen Paniculate Glabrous Cylindrical
Coriaceous Loculicidal No Hyaline wing
Subligneous Loculicidal No Opaque wing
Coriaceous Loculicidal No Hyaline wing
LITERATURE CITED BEARDSLEY, P. M., AND R. G. OLMSTEAD. 2002. Redefining Phrymaceae: the placement of Mimulus, tribe Mimuleae, and Phryma. American Journal of Botany 89: 1093–1102. BOWDEN, W. M. 1940. Diploidy, polyploidy and winter hardiness relationships in the flowering plants. American Journal of Botany 27: 357–371. BREMER, K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795–803. BREMER, B., K. BREMER, N. HEIDARI, P. ERIXON, R. G. OLMSTEAD, A. A. ANDERBERG, AND M. KA¨LLERSJO¨. 2002. Phylogenetics of asterids based on 3 coding and 3 non-coding chloroplast DNA markers and the utility of non-coding DNA at higher taxonomic levels. Molecular Phylogenetics and Evolution 24: 273–300. BUREAU, E. 1864. Monographie des Bignoniace´es: recherches sur les caracte`res, la composition, les limites de cet ordre naturel de plantes. L. Martinet, Paris, France. BURTT, B. L., AND A. J. C. GRIERSON. 1953. The name Incarvillea arguta. Notes from the Royal Botanic Garden Edinburgh 19: 155–156. CHEN, S. T., K. Y. GUAN, Z. K. ZHOU, AND T. FUJIKI. 2003. Pollen morphology of the genus Incarvillea (Bignoniaceae). Acta Botanica Yunnanica 25: 457–467. CHEN, S. T., Z. K. ZHOU, K. Y. GUAN, AND M. NAKATA. 2004. Karyomorphological study of Incarvillea Juss. (Bignoniaceae) and its implications in distribution and taxonomy. Botanical Journal of the Linnean Society 144: 113–121. DON, G. 1838. A general history of the dichlamydous plants. J. G. and F. Rivington, London, UK. FARRIS, J. S., M. KA¨LLERSJO¨, A. G. KLUGE, AND C. BULT. 1994. Testing significance of incongruence. Cladistics 10: 315–319. FEDOROV, A. N. 1969. Chromosome numbers of flowering plants. Akademiaˆ Nauk, Leningrad, USSR. FELSENSTEIN, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. GENTRY, A. G., AND A. S. TOMB. 1979. Taxonomic implications of Bignoniaceae palynology. Annals of the Missouri Botanical Garden 66: 756– 777. GENTRY, A. H. 1980. Bignoniaceae. Flora Neotropica Monograph 25: 1– 130. GOLDBLATT, P., AND A. H. GENTRY. 1979. Cytology of Bignoniaceae. Botanica Notiser 132: 475–482. GREY-WILSON, C. 1998. A new look at the subgenus Pteroscleris. The New Plantsman 1998: 76–98. GRIERSON, A. J. C. 1961. A revision of the genus Incarvillea. Notes from the Royal Botanic Garden Edinburgh 23: 303–354. HIGGINS, D. G. 1994. CLUSTAL W: multiple alignment of DNA and protein sequences. In A. M. Griffin and H. G. Griffin [eds.], Computer analysis of sequence data, part II, 307–318. Humana Press, Totowa, New Jersey, USA.
April 2005]
CHEN
ET AL.—MOLECULAR PHYLOGENY OF INCARVILLEA
MICKEVICH, M. F., AND J. S. FARRIS. 1981. The implications of congruence in Menidia. Systematic Zoology 30: 351–370. OLMSTEAD, R. G., M. ZJHRA, S. GROSE, A. ECKERT, AND R. E. SPANGLER. 2002. Molecular phylogeny, evolution, and classification of the Bignoniaceae. [online proceedings] http://www.2002.botanyconference.org/ sauthor.shtml (Abstract). SPANGLER, R. E., AND R. G. OLMSTEAD. 1999. Phylogenetic analysis of Bignoniaceae based on the cpDNA gene sequences rbcL and ndhF. Annals of the Missouri Botanical Garden 86: 33–46. SUGIURA, T. 1936. Studies on the chromosome numbers in higher plants, with special reference to cytokinesis. Cytologia 7: 544–595. SWOFFORD, D. L. 2001. PAUP*: phylogenetic analysis using parsimony (* and other methods), version 4.0 Beta10. Sinauer, Sunderland, Massachusetts, USA. TABERLET, P., L. GIELLY, G. PAUTON, AND J. BOUVET. 1991. Universal primers for amplification of three non-coding regions of choloroplast DNA. Plant Molecular Biology 17: 1105–1109. VASSILCZENKO. 1957. Niedzwedzkia. Notulae Systematicae Unionis Rerumpublicarum Socialisticarum Sovieticarum 18: 219–224. VASSILCZENKO. 1958. Niedzwedzkia. Flora Unionis Rerumpublicarum Socialisticarum Sovieticarum 23: 5.
633
WANG, F. S., N. F. CHIEN, AND Y. L. ZHANG. 1997. Pollen flora of China, 2nd ed., 97–101. Science Press, Beijing, China. WANG, W. T., K. Y. PAN, Z. Y. ZHANG, AND Z. Y. LI. 1990. Incarvillea Juss. Flora Reipublicae Popularis Sinicae 69: 34–49. WEI, Z. X., H. WANG, AND Q. J. JIN. 2001. Pollen morphology of Bignoniaceae in China. Acta Botanica Yunnanica 23: 225–230. WHITE, T. J., T. BRUNS, S. LEE, AND J. TAYLOR. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. Innis, D. Gelfand, J. Sninsky, and I. White [eds.], PCR protocols: a guide to methods and application, 315–322. Academic Press, San Diego, California, USA. XIAO, H., Q. X. ZHOU, Z. J. GU, AND K. Y. GUAN. 2002. Karyomorphology of six Incarvillea species. Acta Botanica Yunnanica 24: 87–93. ZHAO, Q. S. 1985. A study on the genus Incarvillea Juss. of the Transverse Mountain Range. Exploration of Nature 12: 170–174. ZHAO, Q. S. 1988. A new species of Incarvillea (Bignoniaceae) from Sichuan. Acta Phytotaxonomica Sinica 26: 78–79. ZIMMER, E. A., E. H. ROALSON, L. E. SKOG, J. K. BOGGAN, AND A. IDNURM. 2002. Phylogenetic relationships in the Gesnerioideae (Gesneriaceae) based on nrDNA ITS and cpDNA trnL-F and trnE-T spacer region sequences. American Journal of Botany 89: 296–311.
