Binding of neutralizing monoclonal antibodies to regions ... - CiteSeerX

Journal of General Virology (1993), 74, 2559-2565. Printedin Great Britain

2559

Binding of neutralizing monoclonal antibodies to regions of the fusion protein of respiratory syncytial virus expressed in Escherichia coli G. R. Lounsbach, C. Bourgeois,~ W. H. L. West, J. W. Robinson, M. J. Carter and G. L. Toms* Division of Virology, School of Pathological Sciences, The Medical School, University o f Newcastle upon Tyne, Framlington Place, Newcastle upon Tyne NE2 4HH, U.K.

cDNA containing the entire coding sequence of the respiratory syncytial (RS) virus fusion (F) protein gene (574 amino acids) and two large PstI restriction fragments, encoding amino acids 18 to 212 and 214 to 574, were expressed in Eseherichia coli as C-terminal chimeras with fl-galactosidase (fl-gal) in the pEX expression vector system. A further cDNA fragment, overlapping the PstI restriction site and encoding amino acids 190 to 289, was derived by PCR and expressed in a similar manner. Polyclonal rabbit serum raised against RS virus bound to all four chimeric proteins but most strongly to those containing C-terminal sequences. Two monoclonal antibodies (MAbs), 1E3 and RS348, capable of neutralizing the virus and inhibiting the viral fusion function, bound to all chimeras except that derived from the N-terminal PstI fragment, suggesting that their binding sites were located between amino acids 214 and 289. Further analysis of binding to

expressed fragments from restriction enzyme digests and PCR amplification demonstrated that both antibodies bound to amino acids 253 to 289. MAb RS348 bound to 12-mer overlapping synthetic peptides containing the sequence 265 to 272 (PITNDQKK) but MAb 1E3 failed to bind to any 12-mer peptide derived from the F protein sequence. Immunization of mice with chimeric proteins containing the whole F protein coding sequence or amino acids 253 to 384, which includes the binding site of the two MAbs identified here, failed to induce antibodies that recognized the native RS virus F protein or could neutralize the virus. This suggests that either the fl-gal partner inhibits the immune response to the protein or that elements missing from the protein expressed in E. coli, perhaps conformational or added post-translation, contribute to the neutralizing antibody epitope.

Introduction

anti-F antibody with relatively low neutralizing activity (Murphy et al., 1986, 1990; Collins et al., 1990). In addition, challenge of animals and human children postvaccination can lead to enhanced lung disease, perhaps as a result of inappropriate T cell activity (reviewed by Toms, 1991). The search for ways to circumvent these problems will require knowledge of the antigenic structure of the RS virus F protein down to the epitope level. Antibody epitopes on viral proteins may be mapped using panels of MAbs using a variety of approaches (Yewdell & Gerhard, 1981). Competitive inhibition studies and reactivity with antigenic variants may provide a topological map of antibody-binding sites which can be correlated with functional characteristics of the antibodies. These techniques have been applied extensively to the RS virus F protein (Anderson et al., 1986; Trudel et al., 1987; Beeler & Van Wyke-Coelingh, 1989; Garcia-Barreno et al., 1989; Taylor et al., 1992). However, maps generated by the study of competitive binding and the analysis of antigenic variants conflict and neither technique has successfully located functional activity. The direct biochemical characterization of

Human respiratory syncytial (RS) virus is a significant cause of bronchiolitis and pneumonia in infants, otitis media in children and pneumonia in the immunosuppressed and aged (Klein et at., 1982; Englund et al., 1988; McIntosh & Chanock, 1990). In animal models, passively administered monoclonal antibodies (MAbs) to the fusion (F) glycoprotein of the virus have been found protective and, among these, those capable of neutralizing and inhibiting the fusion function of the virus in vitro are most effective (Taylor et al., 1992). In human infants, immune globulin with high virus neutralizing activity administered intravenously has been found to be of therapeutic value (Hemming et al., 1987). To date, attempts to develop a safe vaccine against this virus have failed. Systemic immunization with formalininactivated virus, purified F protein and vaccinia virus recombinants expressing the RS virus F protein induce I"Present address: Servicede VirologieMrdicale, H6pitaldu Bocage, B.P.1542-21034, Dijon Cedex, France. 0001-1858 © 1993SGM

2560

G. R. Lounsbach and others

antigenicity by mapping antibody binding to antigen fragments or by the generation and sequencing of antibody escape mutants may be of more use. Although both approaches have limitations, the former is likely to be more effective in the location of functional epitopes on the RS virus F protein as inhibitory antibodies might be expected to react with key functional and therefore immutable sites. Therefore, in this study we have set out to express the F protein gene and defined, overlapping fragments of it in a bacterial expression vector, pEX (Stanley & Luzio, 1984). The panel of polypeptides generated can be used for rapid and accurate analysis of antibody-binding sites. This approach has been complemented and refined by analysis of antibody binding to a nested set of synthetic peptides corresponding to the amino acid sequence of the protein. Methods Monoclonal and polyclonal antisera. Mouse ascitic fluids containing MAbs IE3 and 348 to the RS virus F protein were described previously (Samson et al., 1986; Bourgeois et al., 1991). Ascites fluid containing MAb 1G9 to the capsid protein of feline calicivirus which served as a control for non-specific binding was described by Carter et al. (1989). Polyclonal antibody to RS virus F protein was raised in rabbits inoculated repeatedly on occasions 2 weeks apart with affinity-purified F protein from RS virus strain A2 in Freund's adjuvant (Routledge et al., 1988). Serum was collected after a further 3 weeks. Expression o f the R S virus strain A2 F protein coding sequence. A recombinant pBR322 plasmid containing the RS virus strain A2 F protein gene, F-25, was kindly made available by Dr Gail Wertz (Collins et al., 1984). The coding sequence of the F protein gene was amplified by PCR (Mullis & Faloona, 1987) using Vent DNA polymerase (Neuner et al., 1990) and primers 5' GGGATGGAGTTGCTAATCC 3' and 5' GTAAGAACATGATTAGGTGC 3'. The product was ligated into the SmaI site of the phagemid vector pTZ18R and transformed into Eseherichia coli POP2136 by the method of Hanahan (1985). Colonies were selected by hybridization with the 3~P-labelled PCR product. Plasmid DNA was prepared from positive colonies and digested with EcoRI and HindIII to release the insert. The sizes of inserts were estimated on agarose gels, and clones carrying an insert of 1800 bp were selected. The insert was released from the plasmid DNA of one of these clones following digestion with BamHI and EcoRI, blunt-ended and ligated into the SmaI site of the frameshift mutants 1, 2 and 3 of the plasmid pEX (Stanley & Luzio, 1984). Ligation mixtures were transformed into E. coli POP2136 and colonies were selected for ampicillin resistance and hybridization to a 32P-labelled PCR product. PstI digestion of DNA prepared from hybridization-positive cultures allowed confirmation of the orientation in the vector. The integrity of their 5' ends and the preservation of their open reading frames (ORFs) was determined directly in the pEX vector by dsDNA sequencing over the vector-insert junction from a primer within the lacZ gene upstream of the multiple cloning site (5' CCATCGCCATCTGCTGC 3'). As this recombinant plasmid would be expected to express, on induction, the full F protein of 574 amino acids, it was designated pEXFl_574. Expression o f fragments o f the R S virus F protein coding sequence (i) Amino acids 18 to 212 and214 to 574. The insert containing the F protein gene was excised from plasmid F-25 with restriction endo-

nuclease DraI and purified by agarose gel electrophoresis. Three fragments were generated by digestion with PstI, which cuts at positions 64 and 650. The two larger fragments, 65 to 650 (PstI-PstI) and 651 to 1899 (PstI-DraI), which comprise the bulk of the ORF apart from 17 amino acids at the N terminus, were extracted from the gel and ligated into the PstI site of pEX in-frame with the lacZ gene. The ligation mix was transformed into E. coli POP2136 and transformants were selected and confirmed as described above. The recombinant plasmid carrying the PstI PstI insert would be expected to express F protein amino acids 18 to 212 whereas that carrying the PstI-DraI fragment would express amino acids 214 to 574. These plasmids were therefore designated pEXF18 212 and pEXF214 ~74 respectively. The gel-extracted PstI-DraI fragment was digested further with restriction endonuclease HincII. The PstI termini were converted to blunt ends with T4 DNA polymerase and the mixture was ligated into the Sinai site of an equimolar mixture of pEX 1, 2 and 3. The ligation mixture was transformed into E. coil POP2136 and the transformants were selected for ampicillin resistance and, after induction, for binding anti-F protein MAb (see below). (ii) Amino acids 190 to 289. The 579 to 880 bp fragment was amplified from F-25 by PCR using two primers which contained respectively the BglII and SpeI restriction endonuclease sites (5' AGATCTCCAGCAAAGTGTTAGACC 3' and 5' ACTAGTCATGATAGAGTAACTTTGC 3'). The amplified fragment was ligated into the Sinai site of the pEX expression vector. After transformation into E. coli POP2136, transformants were selected as described above. The sequence of the inserts was determined after digestion of the recombinant plasmid with BglII and SpeI and recloning of the released insert into pTZ18R. This recombinant plasmid was designated pEXF190 289. Induction o f expression. Transformant colonies were induced to express fl-galactosidase (fl-gal) chimeras by temperature shift and screened for reaction with antibody to fl-gal or to RS virus F protein by the method of Stanley (1983). For larger scale production of chimeric proteins, cultures of bacteria transformed with parental or recombinant vectors were grown to an ODs~0 of 0.4 in Luria broth containing ampicillin. Expression was induced by incubating at 42 °C for 15 min followed by 2 h at 37 °C. The cells were harvested by sedimentation and resuspended in buffer A (10 mM-TribHCl pH 7.4 containing 10 mM-magnesium acetate, 200 mM-sodium chloride). The cell suspension was sonicated on ice with six 30 s bursts from a Soniprep 150 sonicator (MSE) and then clarified at 40000g. For further purification the supernatant was applied to a p-amino-fl-othiogalactosidase~garose column (Sigma) equilibrated with buffer A. The column was washed with buffer A and the fl-gal or chimeric protein was eluted with three bed volumes of buffer B (100 mM-sodium borate at pH 10.5). The eluate was dialysed against 40 mM-Tris-HC1 pH 7.5 containing 1 raM-magnesium chloride and 50% glycerol (dialysis buffer) and stored at - 2 0 °C. Peptide synthesis. A series of 147 12-mer peptides were synthesized covering the amino acid sequence of the RS virus A2 F protein (Collins et al., 1984) such that each overlapped the next by four residues. The synthesis was carried out by a pin-base strategy using a Cambridge Research Biochemical's Pin Technology Cleavable Peptides Kit. Overlapping 12-mer peptides covering a control 20 amino acid sequence, DASREAKKQVEKALEEANSK, derived from streptococcal M protein, residues 301 to 319 (Robinson et al., 1993) were synthesized simultaneously. Peptides were cleaved from the pins according to the manufacturer's instructions. One peptide overlapping the F protein C terminus and the control sequence was subjected to amino acid analysis and the results corresponded with those predicted. As cleavage is estimated to be only 80 % efficient, the post-cleavage pins were demonstrated to retain residual peptide by reacting with MAbs to linear epitopes of the M protein residues 301 to 319 (Robinson et al., 1993). Enzyme immunoassay (EIA) for MAb binding to pins was

Antibody binding to R S V fusion protein carried out according to the manufacturer's instructions for the Cambridge Research Biochemical's Epitope Scanning Kit. M o u s e immunization. Litters of 8-week to 6-month-old mice were assigned randomly to groups of four. Mice in two groups were inoculated with 80 ~tg/ml affinity-purified fl-gal from pEX2-transformed E. coli, three groups were inoculated with 80 gg/ml of the F2~a z84 chimera (see below). One group was inoculated with negative control dialysis buffer. Initially antigen was administered intravenously (25 gl), intraperitoneally (i.p.) (100 gl) and in an equal volume of incomplete Freund's adjuvant, subcutaneously (s.c.) at four sites in the neck (100 gl total). This was followed by two further inoculations at 2 week intervals by the i.p. and s.c. routes only. At this time sera were negative for antibodies to RS virus antigen by EIA. The mice were therefore further inoculated with 25 gl of antigen 1 : 1 in incomplete Freund's adjuvant into one hind footpad three times alternating at intervals of 2 weeks with 100 ~tl of antigen 1 : 1 in complete Freund's adjuvant, by the s.c. route. A further group of three mice was inoculated with 900 gg/ml of E. coli transformed with plasmid p E X F 1 5r4, sonicated and clarified after induction o f expression. Control mice were inoculated with equivalent pEX2-transformed E. coli antigen or with negative control buffer. For these groups, antigen was administered six times, alternately via the footpad and s.c. routes as described above. As a positive control a group of mice was immunized with RS virus A2 by intranasal inoculation under ether anaesthesia. All antigens were checked for the presence offl-gal and F protein sequences by Western blotting prior to inoculation. At completion of the immunization schedules, mice were bled from the orbital sinus and the blood samples tested for antibodies to the immunogen and to RS virus. Antibody assay. Mouse sera were titrated for antibodies to the control immunogen or RS virus proteins by EIA using high salt, high Tween buffer as described previously (Nandapalan et al., 1984). To assess responses to immunogen, immunoassay plates were coated with either 1 pg/ml of affinity-purified fl-gal from pEX2 transformants or 10 ]ag/ml unrefined sonicate of pEX2 transformant. To assess responses to RS virus, plates were coated with 10 gg/ml of RS virus strain A2 purified by sucrose gradient centrifugation according to the method of Ueba (1978). An equivalent concentration of an uninfected HeLa cell lysate was used as a control. Specific responses to the RS virus F protein were assessed on plates coated with 1 gg/ml of affinity-purified F and P (phosphoprotein) from the RS virus A2 strain (Routledge et al., 1988). Sera were also titrated from a 30-fold dilution for neutralizing activity against the A2 strain of RS virus according to the method o f Routledge et al. (1988).

PstI

PstI 1

I

F1-574 z/

1

t 18

F18-212

I I

HinclI HinclI ~ F214-574 ~

212 214

P 190

HinclI ~

[ 574

t 574

F190-289

2561

Results The selection of F gene fragments expressed from PstI and HincH digests for binding to MAb 1E3 In preliminary experiments MAb 1E3 was found to bind to colony blots of E. coli transformed with pEXF214_574 but not with pEXFls_2~ 2. To define further the location of the 1E3 epitope, a HincII digest of the PstI-DraI fragment (651 to 1899) of plasmid F-25 was ligated into the SmaI site of the pEX family of vectors and introduced into E. coli POP2136. Transformants were screened for expression of the 1 E3 epitope in a colony blot. Positive colonies failed to react with two further MAbs, 1A12 and 4E5, specific for the RS virus F protein but known to bind to conformation-dependent epitopes. Restriction analysis showed that the size of inserted D N A was close to that of the F gene HincII fragment comprising base pairs 769 to 1165. Double-stranded D N A sequencing confirmed this and that the inserted DNA was fused inframe to r-gal. As this fragment encodes the F protein amino acids 253 to 384, it was designated pEXF253 as4.

Reactivity of expressed fragments with anti-fl-gal and anti-RS V F protein sera fl-Gal proteins were prepared from broth cultures of the recombinant pEX transformants (Fig. 1) and a control transformed with pEX-2. Samples of each were analysed in Western blots stained with 1 : 500 diluted rabbit antifl-gal serum (Fig. 2). In all cases heavily stained bands corresponding to M r values equal to or greater than that offl-gal were observed. Their mobilities were in the order expected from the size of the insert. To confirm the antigenicity of the expressed F protein fragments, dilutions of bacterial lysates at equivalent protein concentrations were reacted with a polyclonal rabbit antiserum to the RSV F protein (1:500) in a dot blot (Fig. 3). The control pEX 2 transformant failed to react with this serum but recombinant transformants were all positive, although to different intensities. The transformant carrying the F protein fragment F253_3s4 stained most intensely. The recombinant containing the whole F protein gene and that with the F214 574 fragment stained intensely also. Staining was somewhat reduced for the F190_2s9 recombinant and markedly reduced although unambiguously positive for Fls_m.

t 289 F253-384

I 253

384

Fig. 1. A linear representation of the relative location of the F gene fragments expressed as C-terminal chimeras with r-gal. F1.574 represents the complete O R F frame of the F glycoprotein gene.

The binding of MAbs RS348 and 1E3 to F protein fragments MAb ascites at a 1:1000 dilution were reacted with pEX2 and all recombinant F protein transformant lysates in a dot blot. MAb 1G9 to feline calicivirus capsid

2562


fl-gal-F protein chimeras

M 200KI~

fl-gal

F18_212 F190_289 F214_574 F253_384 F1_574

.....

116K • 97K ml~

66K l~ Fig. 2. fl-gal F protein chimeric gene products purified by gel filtration and resolved by PAGE followed by Western blotting. The blots were stained with antiserum to fl-gal, fl-gal is derived from bacteria transformed with the plasmid pEX 2 after heat induction. Lane M, Mr markers. This lane was cut off after blotting and stained Indian ink.

45K

]3-gal-F fragments F253-384

F1-574

F18-212

F214-574

/3-gal

F19o-289

HeLa

RSV

1:40

1:80 o "~ M

"~
1.5 at 1 : 640 compared to < 0' 1 for buffer-immunized or unimmunized control groups). Specific responses to the F protein were assessed by comparison of binding to F and P antigens at a 1:40 dilution (Fig. 6). Sera from all mice immunized with the F25a 3s4 chimera bound more strongly to the F protein than to the P protein with a mean difference in A of 0-38. The binding of anti-F~53_ss~ sera was significantly higher than that of either control group (T19 = 4"0, /o < 0"001 versus native fl-gal-immunized mice; T19 = 3"1, P < 0.01 versus buffer-immunized mice). Mice immunized with the pEXF~ 574 transformant lysate showed no evidence of specific binding to the F protein. Sera were also tested for reactivity with sucrose gradient-purified RS virus and control uninfected H e L a cell lysate at equivalent protein concentrations. No RS

I

O.5

I:

00o 0

-0-5

~ fl-gal-F253_384 chimera

_;

.I

•

"il

~ fl-gal

Buffer

Fig. 6. The F protein-specific reactivity of sera from mice inoculated with F253.a, 4 or control preparations. A ( F - P ) , A values obtained in EIAs of mouse sera tested at 1:40 on affinity-purified F protein corrected by subtraction of equivalent results on affinity-purified P protein.

virus-specific antibody was detected at a serum dilution of 1:40 in any of the mice inoculated with either the F253kss4 or the F1.574 chimeric proteins or with any of the controls inoculated with pEX2 transformant proteins or buffer alone. Serum from RS virus-infected mice titrated in the same assay gave an A value corrected for nonspecific binding of 1"7 to 2-0 at a dilution of 1 : 40. All sera from mice inoculated with the pEXFl_57 ~ transformant, and sera from the two mice inoculated with the F25a_ss4 chimera showing the highest reactivity against the viral F protein in EIA, were tested for neutralization of the virus with appropriate controls. None of these sera were

2564


capable of neutralizing the virus at the lowest dilution tested, 1 : 30.

Discussion The expression of the full RS virus F protein in E. coli has not been achieved previously. Martin-Gallardo et al. (1991) found that the hydrophobic N-terminal signal sequence was toxic when the eDNA was introduced into a bacterial expression vector under the inducible control of the 2 promoter. A full-length gene product was not detected but three cleavage products were expressed ranging from M r 18 500 to 45 000. In this study, using the expression vector pEX which also utilizes the 2 promoter but to express inserts introduced at the C terminus of a cro-lacZ gene generating a fl-gal chimera, no such problems have been encountered. The Mr of the expressed chimera was consistent with expression of the entire unglycosylated F 0 protein including the signal peptide ( M r 65000). It would appear that association with fl-gal has reduced the toxicity of the signal sequence. As the chimera is largely insoluble this may also explain the reduced vulnerability to protease degradation. The pattern of reactivity of hyperimmune rabbit serum with the expressed fragments of the F protein indicates a marked preference for the mid-region of the molecule. It is not clear whether this reflects a higher incidence of antibody specificities for this region or that the structure of the molecule is such that binding sites are more readily preserved when expressed in bacteria. The two neutralizing, fusion-inhibiting MAbs chosen for mapping, 1E3 and RS348, have previously been shown to bind to the F protein in the presence of SDS and 2-mercaptoethanol indicating that at least some of their binding capacity is conformation-independent (Samson et al., 1986; Bourgeois et al., 1991). Both of these also bound to the C-terminal half of the molecule and to fragments containing amino acids 253 to 289 but not to fragments containing only sequences N-terminal to amino acid 212. The specificity of MAb RS348 for amino acids 253 to 289 was independently corroborated by the demonstration that this antibody binds to only two synthetic 12-mer peptides, overlapping on amino acids 265 to 272, from a nested set of 12-mers covering the whole of the F protein sequence. The failure of 1E3 to react with any 12mer peptides may indicate that there is a conformational element to the binding site of this antibody which cannot be mimicked by too short a peptide. It is particularly interesting that the epitopes for several other neutralizing MAbs have been mapped to this region of the protein by mutations that confer antibody resistance. Arbiza et al. (1992) found that amino acid changes occurred most frequently at positions

262, 268 and 272 in mutants able to escape neutralization by MAbs 7C2, B4, AK13A2 and 47F. This, with our data, contrasts sharply with the results of mapping studies utilizing binding to short synthetic peptides which have been carried out in a number of laboratories with some apparently irreconcilable results. Thus, whereas Arbiza et al. (1992) report that MAb B4 binds to synthetic peptide 255 to 275 in an ELISA, Trudel et al. (1991) described binding of a number of neutralizing MAbs, including B4 and 7C2, to peptides containing amino acids 216 to 237 in dot blots. Bourgeois et al. (1991) observed binding of hyperimmune rabbit sera to peptides containing F protein amino acids between 200 and 225 as well as amino acids 255 to 278. MAb RS348 bound only to amino acids 205 to 225, and not to the peptide comprising amino acids 255 to 278. It is perplexing, therefore, that in the current study using 12mer peptides immobilized on pins we have found that RS348 binds to amino acids 261 to 272 but not to peptides overlapping the region between 205 and 225. These two sites both contain the motif PI-N-Q which might account for their reactivity with the same MAb. These inconsistent results of peptide-binding studies hint at a greater complexity to the neutralization epitopes under study than suspected hitherto. This impression is reinforced by the report that, in some MAb escape double mutants, substitutions were observed at residues 190, 216 and 258 (Arbiza et al., 1992). It comes as little surprise, therefore, to find that the sequences which bind neutralizing MAbs are incapable alone of inducing an antibody response to the native protein. Even the whole protein expressed in E. coli, and therefore neither glycosylated, cleaved, nor, presumably, folded correctly, gave rise to very low titres of antibody cross-reactive with the native virus, and no neutralizing activity. However this failure of immunogenicity may in part derive from poor solubility of the chimera or from the association of the F protein with an immunodominant carrier,/q-gal, as a synthetic peptide has previously been found sufficient to induce antibodies to the native protein (Bourgeois et al., 1991). In this study we have demonstrated the value of overlapping eDNA fragments expressed in E. coli for rapid preliminary mapping of RS virus F protein MAbs. This approach is complementary to the sequencing of escape mutants and to mapping with synthetic peptides and should be applied to as wide a panel of anti-F protein MAbs as possible in concert with the latter techniques to build up a picture of protein surface residues that interact directly with neutralizing antibodies. These chimeras may also be of value in the analysis of the human response to RS virus although it might be expected that most functional antibody to the virus will be directed to conformational epitopes and the

Antibody binding to RSV fusion protein simple demonstration that some antibody in human sera can bind to some fragments will not be very informative. Nonetheless, in future work it will be important to ascertain whether the site identified here (amino acids 253 to 289), which interacts with two distinct neutralizing MAbs, plays any role in virus neutralization by human sera and what, if any, is its role in the function of the F protein.

References ANDERSONL. J., HIERHOLZER,J. C., STONE,Y. O., TSOU,C. & FERNIE, B. F. (1986). Identification of epitopes on respiratory syncytial virus proteins by competitive binding irnmunoasgay. Journal of Clinical Microbiology 23, 475480. ARBIZA,J., TAYLOR,G., LdPEZ, J. A., FURZE,J , WYLD, S., WHYTE,P., STOTT, E. J., WERTZ, G., SULLENDER,W., TRUDEL, M. & MELERO, J. A. (1992). Characterization of two antigenic sites recognized by neutralizing monoclonal antibodies directed against the fusion glycoprotein of human respiratory syncytial virus. Journal of General Virology 73, 2225 2234. BEELER, J.A. & VAN WYKE-COELINGH,K. (1989). Neutralization epitopes of the F glycoprotein of respiratory syncytial virus: effect of mutation upon fusion function. Journal of Virology 63, 2941 2950. BOURGEOIS,C., CORVAISIER,C., BOUR, J. B., KOHLI, E. & POTHIER, P. (1991). Use of synthetic peptides to locate neutralizing antigenic domains on the fusion protein of respiratory syncytial virus. Journal of General Virology 72, 1051 1058. CARTER, M. J., ROUTLEDGE,E. G. & TOMS, G. L. (1989). Monoclonal antibodies to feline calicivirus. Journal of General Virology 70, 2197 2200. COLLINS, P.L., HUANG, Y. T. & WERTZ, G.W. (1984). Nucleotide sequence of the gene encoding the fusion (F) glycoprotein of human respiratory syncytial virus. Proceedings of the National Academy of Sciences, U.S.A. 81, 7683-7687. COLLINS, P. L., PURCELL, R. H., LONDON, W. T., LAWRENCE, L.A., CnANOCK, R. M. & MURPHY, B. M. (1990). Evaluation in chimpanzees of vaccinia virus recombinants that express the surface glycoproteins of human respiratory syncytial virus. Vaccine 8, 164-168. ENGLUND, J.m., SULLIVAN, C.J., JORDAN, M.C., DEHNER, L.P., VERCELOTTI,G. M. & BALFOUR,H. H. (1988). Respiratory syncytial virus infection in immunocompromised adults. Annals of Internal Medicine 109, 203-208. GARCIA-BARRENO,B., PALOMO, C., PENAS, C., DELGADO,T., PEREZBRENA, P. & MELERO, J.A. (1989). Marked differences in the antigenic structure of human respiratory syncytial virus F and G glycoproteins. Journal of Virology 63, 925-932. HANAHAN,D. (1985). Techniques for transformation of E. coli. In DNA Cloning, vol. 1, pp. 109-135. Edited by D. M. Glover. Eynsham: IRL Press. HEMMING, V.G., RODRIGUEZ, W., KIM, H.W., BRANDT, C.D., PARROT,R. H., BURCH,B., PRINCE,G. A., BARON,P. A., FINK, R. J. & REAMAN, G. (1987). Intravenous immunoglobulin treatment of respiratory syncytial virus infections in infants and young children. Antimicrobial Agents and Chemotherapy 31, 1882-1886. KLEIN, B. S., DOLETTE, F. R. & YOLKEN, R. H. (1982). The role of respiratory syncytial virus and other viral pathogens in acute otitis media. Journal of Pediatrics 101, 16-28. MCINTOSH, K. & CHANOCK,R. M. (1990). Respiratory syncytial virus. In Virology, 2nd edn, pp. 1045 1072. Edited by B. N. Fields & D. M. Knipe. New York: Raven Press.

2565

MARTIN-GALLARDO,A., FIEN, K. A., Hu, B. T., FARLEY,J. F., SLID, R., COLLINS, P.L., HILDRETH, S.W. & PARADISO, P.R. (1991). Expression of the F glycoprotein gene from human respiratory syncytial virus in Escherichia coli: mapping of a fusion inhibiting epitope. Virology 184, 428432. MULLIS, K. B. & FALOONA,F. A. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods in Enzymology 155, 335-350. MURPHY, B. R., PRINCE, G. A., WALSH, E. E., KIM, H. W., PARROT, R.H., HEMMING, V.G., RODRIGUEZ, W.J. & CHANOCK, R.M. (1986). Dissociation between serum neutralising and glycoprotein antibody responses of infants and children who received inactivated respiratory syncytial virus vaccine. Journal of Clinical Microbiology 24, 197 202. MURPHY, B. R., SOTNIKOV,A. V., LAWRENCE,L. A., BANKS, S. M. & PRINCE, G.A. (1990). Enhanced pulmonary histopathology is observed in cotton rats immunized with formalin-inactivated respiratory syncytial virus (RSV) or purified F glycoprotein and challenged with RSV 3 6 months after immunization. Vaccine 8, 497 502. NANDAPALAN,N., ROUTLEDGE,E. & TOMS, G~ L. (1984). An enzymelinked immunosorbent assay (ELISA) for IgG and IgA antibodies to respiratory syncytial virus in low dilutions of human serum and secretions. Journal of Medical Virology 14, 285-293. NEUNER, A., JANNASCH,H. W., BELKIN, S. & STETTER,K. O. (1990). Thermococcus litoralis sp. nov. : a new species of extremely thermophilic marine archaebacteria. Archives of Microbiology 153, 205-207. ROBINSON,J. H., CASE,M. C. & KEHOE,M. A. (1993). Characterisation of a conserved helper T cell epitope from group A streptococcal M proteins. Infection and Immunity (in press). ROUTLEDGE,E. G., WILLCOCKS,M. M., SAMSON,A. C. R., MORGAN, L., SCOTT,R., ANDERSON,J. J. & TOMS,G. L. (1988). The purification of four respiratory syncytial virus proteins and their evaluation as protective agents against experimental infection in BALB/c mice. Journal of General Virology 69, 293 303. SAMSON, A. C. R., WILLCOCKS,M. M., ROUTLEDGE,E. G., MORGAN, L. A. & TOMS,G. L. (1986). A neutralizing monoclonal antibody to respiratory syncytial virus which binds to both F 1 and F 2 components of the fusion protein. Journal of General Virology 67, 1479 1483. STANLEY,K. K. (1983). Solubilization and immune detection of betagalactosidase hybrid proteins carrying foreign antigenic determinants. Nucleic Acids Research 11, 40774092. STANLEY,K. K. & LUZlO, J. P. (1984). Construction of a new family of high efficiency bacterial expression vectors: identification of cDNA clones coding for human liver proteins. EMBO Journal3, 1429-1434. TAYLOR, G., STOTT, E.J., FURZE, J. & SOPP, P. (1992). Protective epitopes on the fusion protein of respiratory syncytial virus recognized by murine and bovine monoclonal antibodies. Journal of General Virology 73, 2217 2223. TOMS, G.L. (1991). Vaccination against respiratory syncytial virus: problems and progress. FEMS Microbiology and Immunology 76, 243-256. TRUDEL,M., NADON,F., SEGU1N,C., PAYMENT,P. & TALBOT,P. (1987). Respiratory syncytial virus fusion glycoprotein: further characterization of a major epitope involved in virus neutralization. Canadian Journal of Microbiology 33, 933 938. TRUDEL,M., STOTT,E. J., TAYLOR,G., OTH, D., MERCIER,G., NADON, F., SEGUIN,C., SIMARD,C. & LACROlX,M. (1991). Synthetic peptides corresponding to the F protein of RSV stimulate murine B and T cells but fail to confer protection. Archives of Virology 117, 59-71. UEBA, O. (1978). Respiratory syncytial virus 1. Concentration and purification of the infectious virus. Acta medica okayama 32, 265-272. YEWDELL,J. W. & GERHARD,W. (1981). Antigenic characterization of viruses by monoclonal antibodies. Annual Review of Microbiology 35, 185-206.

(Received 28 May 1993," Accepted 23 July 1993)