Biochemical Characteristics of an Alanine Racemase ... - Springer Link

ISSN 00262617, Microbiology, 2015, Vol. 84, No. 2, pp. 202–209. © Pleiades Publishing, Ltd., 2015.

EXPERIMENTAL ARTICLES

Biochemical Characteristics of an Alanine Racemase from Aeromonas hydrophil HBNUAh011 Dong Liu, Xipei Liu, Lu Zhang, Hongwei Jiao, Jiansong Ju, and Baohua Zhao2 College of Life Science, Hebei Normal University, Shijiazhuang, China Abstract—We reveal that the genome of Aeromonas hydrophila HBNUAh01has an alanine racemase gene (alr2); this gene encodes a functional enzyme that can complement the alanine racemase deficiency of Escherichia coli strain MB2795. The gene alr2 was cloned and expressed in E. coli BL21 (DE3). The gene has an open reading frame (ORF) of 1230 bp encoding a protein of 369 amino acids with a calculated molec ular mass of 40.39 kD. The amino acid sequence deduced revealed similarity of 98, 84 and 68% with alanine racemases from A. hydrophila ATCC7966, Aeromonas caviae_Ae398, Aeromonas vickers_b565, respectively. The optimal temperature and pH for enzyme activity was 37°C and pH 10. The enzyme had broad substrate specificity. The alanine racemase was shown to belong to the pyridoxal 5'phosphate (PLP)dependent family of enzymes that require a certain concentration of PLP for activity. The kinetic parameters Km and Vmax at 40°C of alanine racemase were 35.9 mM, 2898 units/mg for Lalanine and 15.36 mM, 1209 units/mg for D alanine, respectively. Keywords: Aeromonas hydrophila HBNUAh01, alaine racemase, characterization, kinetic parameters DOI: 10.1134/S0026261715020071 1

Aeromonas hydrophila (A. hydrophila) is a gram negative bacterium with worldwide distribution, belonging to the family Aeromonadaceae. It has also been associated with diseases in marine and freshwater fish. Although motile Aeromonas species are typically recognized as opportunistic pathogens or secondary invaders, cases of A. hydrophila acting as a primary fish pathogen have been reported [1]. Currently, the dis ease caused by A. hydrophila is mainly controlled by the use of antibiotics. However, extensive use of anti biotics has led to the generation of antibiotic resis tance in microorganisms [2] and poses a risk of trans fer of resistance to other aquatic bacteria/human pathogens and also to humans. Vaccination is an important prophylactic measure that can be used to prevent diseases [3, 4]. However, no vaccines for the protection of fish against A. hydrophila infections are commercially available at present, which may be related to the high heterogeneity of this bacterium with the consequent reduced efficacy of the vaccines against different isolates or serogroups [1]. Alanine racemase (EC 5.1.1.1) forms part of the peptidoglycan biosynthetic pathway [5] and cata lyzes the racemization of the Lisomer of alanine to the Disomer and viceversa [6]. Alanine racemase is important to both grampositive and gramnegative bacteria, since it is required for the synthesis of the 1 The article is published in the original. 2 Corresponding author; email: [email protected]

peptidoglycan in the cell wall. The enzyme requires pyridoxal 5'phosphate (PLP) as a cofactor attached to the enzyme via an internal Schiff’s base linkage. Alanine racemase genes (alr) have been identified and wellstudied in a variety of bacterial species [7]. Bacte rial usually have either one or two alanine racemase genes. In bacteria with two alanine racemase genes, one is typically expressed constitutively and used for Dalanine biosynthesis, whereas the other is typically inducible and used for catabolism of Dalanine [8]. In E. coli, alr encodes an alanine racemase that is consti tutively expressed, while dadX encodes an alanine racemase that is involved in Lalanine catabolism. Dalanine is the essential component of the pepti doglycan layer in the cell wall of both gramnegative and grampositive bacteria [9]. Alanine racemase is ubiquitous among bacteria but is absent from humans and rare in eukaryotes with only some exceptions: the fungi, the yeast, and plants [10, 11]. Inhibition of ala nine racemase is lethal to those bacteria, making the enzyme an important antibiotic drug target [12, 13]. In this study, we identified the genes that encode alanine racemase in A. hydrophila HBNUAh01 iso lated from sick Paral ichthys olivaceus [14]. We purified the alanine racemase for characterization and analysis of the kinetic parameters of enzyme activity. Further more, we compared the properties of the enzyme with its prokaryotic counterparts.

202

BIOCHEMICAL CHARACTERISTICS OF AN ALANINE RACEMASE

MATERIALS AND METHODS Bacterial strains, plasmid and media. A. hydrophila HBNUAh01 was previously isolated and maintained in our laboratory for research [14]. The bacterial was cultured at 30°C in LuriaBertani (LB) medium. Escherichia coli (E. coli) strains used in this study were DH5α and BL21, used as the host strains for cloning and expression, Dalanine auxotroph MB2795 (alr::FRT, dadX::FRT) [15] cultured in LB medium at 37°C. Ampicillin (AMP) was added at 100 μg/mL. Expression vector, pET25b(+) (Novagen, Germany) and TA cloning vector, pMD18T (Takara, China) were used in this work. Cloning of alanine racemase gene and DNA sequencing. The genomic DNA of A. hydrophila HBNUAh01 was isolated using a Bacterial DNA kit according to the manufacture’s instruction. The ala nine racemase genes (alr) were amplified with a set of primers, based on the alanine racemase genes of A. hydrophila ATCC7966: the primer pairs alr1up (5' CCATATGAAAGCGGCTATC3') and alr1down (5'CCTCGAGGACGTATTCCATAA3'); alr2up (5'CCATATGAACACAGTTACGGCCA3') and alr2down (5'GAAGCTTCGGCCAGCTTCAACA 3'); alr3up (5'CCATATGCACAAGAAGACACT GCT3') and alr3down (5'CCAAGCTTGCGCT TGATCTTCTTGG3'). The PCR product was puri fied and cloned into the pMD18T to construct pMDalr. The plasmid pMDalr was digested with restriction endoncleases, to form a DNA fragment which was deduced as an open reading frame (ORF) for alr gene. The fragment was cloned into pET25b (+) to form the recombinant plasmid pET25balr. The alr gene was sequenced and analysis. The deduced amino acid sequence of the ORF was analysis by the Blast software. Complementation of E. coli MB2795 with cloned alanine racemase genes from A. hydrophila HBNUAh01. To assess the function of the putative ala nine racemase proteins encoded by alr, we trans formed the pET25balr into E. coli alr dadX double mutant MB2795 (alr::FRT, dadX::FRT) made com petent by chemical treatment. E. coli MB2795 trans formants containing pET25balr was selected on LB agar without added Dalanine. Purification of alanine racemase. Precultured BL 21(DE3) cells with alr gene cloned in pET25b(+) (2 mL) were inoculated into 200 mL fresh LB culture, and incubated at 37°C. When the cell density at OD600 reached 0.6, IPTG was added at a final concentration of 1 mM, and incubation was continued at 28°C over night. Cells were harvested, resuspended into 20 mL of sample buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, and 10 mM imidazole), and sonicated for sev eral times until the solution became clear. Sonicated cells were centrifuged to remove cell debris, and the cellfree supernatant was mixed with 2 mL of 50% Ni MICROBIOLOGY

Vol. 84

No. 2

2015

203

NTA agarose slurry (Qiagen, Germany) and incu bated gentle at 4°C for 1 h. Unbound Proteins to the NiNTA were washed three times with 4 mL of buffer. Bound proteins were eluted four times with 0.5 mL of buffer. The elution were combined, concentrated and dia lyzed against the same buffer with 10% glycerol by ultrafiltration with an Amicon Ultra15 Centrifugal Filter Devices (30K MWCO, Millipore). The purity and molecular weight of the enzyme was checked and determined by sodium dodecyl sulfate polyacryl amide gel electrophoresis (SDSPAGE). Western blotting. Protein in sample buffer (0.1% SDS, HCl, pH 6.8) were boiled and subjected to SDS PAGE. Protein was transferred to polyvinyllidone dif luoride (PVDF) membrane by semidry blotting [15]. Filters were blocked for 15 min and incubated over night at 4°C with a solution of a monoclonal antibody against the polyHistag, then incubated with a 1/100 goat anti mouse IgG1 conjugated to horseradish peroxidase. Immunoreactive bands were revealed by washing in 20 mM NaCl, 50 mM Tris HCl, pH 7.5 and a solution containing 0.05% H2O2 and 2.8 mM 4chloro1naphthol for the peroxidase conjugate. Enzyme and protein assays. The activity of alanine racemase was assayed as described previously with some modification [10]. The standard racemization mixture contained PLP (10 μM), NaHCO3NaOH buffer, Lalanine (50 mM), and appropriate protein in a final volume of 200 μL. After 10minutes incubation by adding protein at 35°C, the reaction was terminated by adding 25 μL of 2 M HCl. Following 2min incuba tion at 4°C, the mixture was centrifuged at 15000 rpm for 10 min at 4°C. An aliquot (180 μL) of the superna tant was mixed with 20 μL of 2M NaOH for neutral ization. The amount of Dform amino acids was mea sured with Damino acid oxidase at 37°C for 30 min as described by Soda et al. [16]. One unit (U) of enzyme was defined as the purified enzyme that catalyzed the formation of 1 μmol of Dalanine from Lalanine per min. Protein concentration of purified protein was determined by BCA Protein Assay Reagent Kit, bovine serum albumin was used as a protein standard. Effect of temperature and pH on enzyme activity and stability. To determine the optimal temperature of enzyme activity, the enzyme was incubated at various temperatures from 0 to 60°C under standard racemase assay. The thermalstability of the enzyme was exam ined by preincubated in reaction buffer for 1 h at tem peratures ranging from 20 to 60°C without substrate. Thereafter, Lalanine was added as a substrate for determination of the relative residual enzyme activity. The pH optimum was investigated by incubating the enzyme in reaction buffers with pH values between pH 4.0 and pH 12.0. The pH stability of the enzyme was examined by incubation of the enzyme in buffers

204

DONG LIU et al. (a)

(b)

pET25balr1

pET25balr2

pET25balr3

Fig. 1. Genetic complementation tests of alanine race mase. (a) 0mM Dala + AMP; (b) 0.5 mM Dala + AMP.

with pH ranging from 4.0 to 12.0 at 4°C for 1 h without substrate, and the relative residual enzyme activity was measured. Substrate Specificity of Alanine Racemase. The substrate specificity of racemase was based upon the standard enzyme activity assay. Racemase activity converting Lamino acids to Damino acids was mea sured by using 18 kinds of Lamino acid as substrates. Kinetic parameters. Alanine racemase activity was determined by measuring the amounts of D and L alanine by high performance liquid chromatography (HPLC) as described previously [17]. One unit of the enzyme was defined as the amount of enzyme that cat alyzed the formation of 1 μmol of L or Dalanine from either enantiomer per min. RESULTS Identification of gene in A. hydrophila HBNUAh01 that encode alanine racemase. Analysis of the genome sequence of A. hydrophila strain ATCC7966 revealed three putative alanine racemase genes: alr1 which encodes a 357 amino acid protein, alr2 which encodes a 369 amino acid protein and alr3 which encodes a 408 amino acid protein. We used genetic complementation tests in E. coli MB2795 to demon strate which alr from A. hydrophila HBNUAh01 encode functional alanine racemase. E. coli MB2795 was unable to grow on LB agar or in LB broth without Dalanine. MB2795 is auxotrophic for Dalanine and provide genetic evidence that it does not produce functional alanine racemase. We constructed plasmids of pET25balr1, pET25balr2 and pET25balr3 and transformed them individually into E. coli MB2795. At 37°C on LB agar without Dalanine, vis ible growth of E. coli MB2795 (pET25balr2) trans formants was detected after 15 hours. Introducing plasmid pET25balr2 into E. coli MB2795 restored the ability of MB2795 to grow in LB medium without added Dalanine. In contrast, MB2795 (pET25balr1), MB2795 (pET25balr3) and the

E. coli MB2795 (pET25b) vector control did not grow under these conditions unless Dalanine was added at 5 mM (Fig. 1). These data demonstrate that alr2 encode functional alanine racemase proteins. The nucleotide sequence of alr2 consisting of 1,107 bp has been submitted to GenBank under acces sion number KC884242. The similarity of the nucle otide sequence of alr with that of alr2 from A. hydro phila ATCC7966 was 97%, while the sequence homol ogy of alr of E. coli and Salmonella typhimurium was 55.6 and 44.3% respectively. The alr2 gene was pre dicted to encode a polypeptide of 369 amino acids with a calculated molecular mass of 40.39 kDa. The deduced protein showed amino acid sequence similar ity to the known alanine racemases from A. hydrophila ATCC7966 (Alr2, 98%), Aeromonas caviae_Ae398 (Alr1, 84%), Aeromonas vickers_B565 (Alr, 68%) and Aeromonas salmonicida subsp. salmonicida A449 (Alr 1, Alr2, 67%), and E. coli (Alr, 55.4%). The molecu lar mass of Alr2 was measured to be 41 kDa, in good accordance with the calculated value of 40.39 kDa, based on the amino acid sequence. According to the sequence similarity analysis, the protein also carried the expected motifs such as the characteristic pyridoxal phosphate binding site (AV [VL]KAN AYGHG) near the Nterminal, including the critical lysine residues K34, the catalytic active cen ter ([AP]VGYG [GA]⎯[HN]W) near the Ctermi nal, including the critical tyrosine residue Y253 [18] (Fig. 2). Purification of alanine racemase. Alanine racemase incorporating a six histidine Cterminal tag was over expressed in E. coli BL21(DE3) cells and purified using NiNTA agarose. SDSpolyacrylamide gel elec trophoresis showed that the purified Histagged ala nine racemase (Alr2) occurred as a single protein band with a molecular weight of approximately 43 kDa, which is in accordance with the predicted molecular mass. Western blot analysis using the anti polyHis antibody confirmed the identity of the puri fied protein as the Histag alanine racemase with a rel ative molecular mass of 43 kDa (Fig. 3). Characterization of the enzyme. The optimal tem perature for Alr2 catalysis of the conversion of Lala nine to Dalanine was approximately 37°C. The enzyme was found to be very stable over the tempera ture range from 10 to 50°C and retained 90% of its activity at 50°C (Fig. 4). The optimal pH for Alr2 catalysis of the conver sion of Lalanine to Dalanine was approximately 10 at 40°C, thus demonstrating that Alr2 is a basophilic enzyme. The enzyme was found to be very stable from pH 8 to 11 and retained 90% of its activity. (Fig. 5). The effects of various metal ions on the activity of Alr2 were determined using Lalanine as a substrate. The enzyme was preincubated with metal ions (final concentration, 10 mmol/L) at 4°C for 30 min before measuring the residual enzyme activity. The data indi MICROBIOLOGY

Vol. 84

No. 2

2015

BIOCHEMICAL CHARACTERISTICS OF AN ALANINE RACEMASE β1

Alr_Ec

1

α1 10

20

β2 30

α5 90

β5 100

α2

α3

205

α4

β3

40

50

60

70

110

120

130

α7 140

170

190

Alr_Ec Alr_St Alr2 Alr2_ATCC7966 Alr1_Ac Alr2_Ac Alr1_As Alr2_As Alr_AV

* β4

Alr_Ec

TT

η1

80

α6


β7

Alr_Ec

150

160

TT TT

α8 170

β8

α9

η2

β9

200

210


η3

Alr_Ec

η4 220

β10

230

240

β11 η5 β12 250

β13

260

T

270

280


* T

Alr_Ec

TT

β14 290

β15 300

β16 TT 310

TT

320

β17

TT

330

α10

α11 340

350


TT

Alr_Ec

β18


Fig. 2. Structurebased alignment of alanine racemase amino acid sequences from A. hydrophila and other organisms. The black box indicates the conserved PLP binding site and catalytic active center, the asterisks (*) mark the PLPbound Lys residue and the catalytic Tyr residue.

cated that Cu2+ enhanced the catalytic activity up to 300%, with a slight increase in enzyme activity observed in the presence of Mg2+, Ca2+, and Na+. In contrast, the enzyme activity was markedly inhibited MICROBIOLOGY

Vol. 84

No. 2

2015

by Co2+ and Zn2+. Enzyme activity was not sensitive to the metalchelating agent EDTA, indicating that diva lent cations are not required for enzyme activity (Fig. 6).

206

DONG LIU et al. kDa

1

M

2

37°C for 30 min, followed by dialysis against 10 mM potassium phosphate buffer (pH 8.0) overnight. The apoenzyme activity was completely inhibited. DTT at 1 mmol/L inhibited 67% of the enzyme activity com pared with the control and DTT at 5 mmol/L resulted in complete inhibition of the enzyme activity.

3

97.2 66.4 44.3

29.0

20.1 Fig. 3. SDSPAGE analysis of the purified alanine race mase Alr2. Lane M: molecular weight standards; Lane 1: supernatant from BL21(DE3) cells expressing alr2 after sonication and centrifugation; Lane 2: alanine racemase containing a six histidine tag on the Cterminal was puri fied from BL21 cells expressing alr2; Lane 3: Western blot analysis of the purified recombinant Histagged protein.

Substrate specificity. Purified alanine racemase was assayed using 18 types of Lamino acids as sub strates. The highest activity (designated 100%) was measured using Lalanine as the substrate. The enzyme also showed suboptimal activity with Largin ine (50%), Llysine (25%), L histidine (25%), and L valine (12%). Essentially no racemase activities for other Lamino acids substrates were detected. These results showed that the Alr2 from A. hydrophila has broad substrate specificity (Fig. 7). Effect of PLP on enzyme activity. A variety of chemical substances have been reported to inhibit ala nine racemase activity, including hydroxylamine and dithiothreitol (DTT). This study analyzed the inhibi tory effect of hydroxylamine and DTT on the enzy matic activity of alanine racemase. Hydroxylamine (1 mM) strongly inhibited enzyme activity (reduced to 83% of the control). To obtain the apoenzyme, the enzyme was incubated with 10 mM hydroxylamine at

Kinetic parameters of purified alanine racemase activity. Determination of the kinetic parameters of alanine racemase using Lalanine or Dalanine as sub strates was performed by HPLC. Analysis of the enzyme kinetic data with GraphPad Prism 5 showed that the substrate affinity constant (Km) of alanine racemase for Lalanine was 35.9 mM, with a maximal velocity (Vmax) of 2,898 units/mg, while the Dalanine Km value was 15.36 mM with a Vmax of 1,209 units/mg. This suggested a greater binding capacity of the enzyme for Lalanine compared with that for Dala nine, although the maximum reaction velocity of L alanine was more than two times that of its enanti omer. Relative activity Stability 100 80 Relative activity, %

Relative activity Stability 100 Relative activity, %

Racemase activity can be categorized as two types based on the requirement for cofactors or metal ions. All types of alanine racemase have been shown to exhibit a requirement for PLP as a cofactor [19]. To confirm this in the case of Alr2, the purified enzyme was treated with 10 mM hydroxylamine and dialyzed to obtain the apoenzyme. The results showed com plete loss of enzyme activity, which was almost com pletely recovered following addition of different final concentrations of PLP. These data demonstrates that the alanine racemase is a PLPdependent enzyme, requiring a concentration of 0.01 mM PLP to main tain its activity (Table 1).

80 60 40

60 40 20

20 0

20

40 T, °C

60

80

Fig. 4. Effect of temperature on the relative activity and stability of Alr.

0 6

7

8

10

9

11

12

pH Fig. 5. Effects of pH on the relative activity and stability of Alr. MICROBIOLOGY

Vol. 84

No. 2

2015

13

120 100 80 60 40 20 0

Amino acids, 10 mmol/L

C

Metal ions and chemicals, 10 mmol/L Fig. 6. Effect of the various substances on the activity of alanine racemase. Note: Data represent the average of three independent determinations (standard deviation was less than 5%).

The equilibrium constant calculated according to the formula (Keq (L/D)) was 1.03 (Table 32), which is consistent with the reported theoretical equilibrium constant (Keq = 1) for alanine racemase [20] (Table 2). DISCUSSION Aeromonas hydrophila is a major pathogen both of aquatic and terrestrial organisms, including humans. Infection with A. hydrophila results in severe econom ics losses to the aquaculture industry. In humans, A. hydrophila infections are known to cause gastroen teritis and wound infections. The A. hydrophila HBNUAh01 was isolated from the sick Paral ichthys olivaceus [14]. Biochemical experimental results showed that this bacterium was identified as A. hydro phila. This bacteria was also detected by using poly merase chain reaction based on the aerolysin gene and the 16S rDNA sequence of A. hydrophila reported on Genebank. The result of the molecular detection was consistent with the biochemical detection. We have cloned the outer membrane protein A (ompA) gene of this strain and transiently expressed the protein in tobacco (Nicotiana tabacum) leaf cells [21]. Currently, many genome sequences of A. hydro phila are now available at the NCBI database. The first genome sequence of A. hydrophila (strain ATCC7966) is circular and 4,744,448 nucleotides long, with 82% of the genome being coding sequence [22]. According to the genome sequence of A. hydrophila (strain ATCC7966) in GenBank, it is predicted that there are three alanine racemase genes. However, it is known that bacteria contain either one or two alanine race mase genes [23]. The possibility that A. hydrophila contains three alanine racemase genes is very interest ing. In this study, the three genes from A. hydrophila HBNUAh01 were cloned; we constructed plasmids of pET25balr1, pET25balr2 and pET25balr3 and transformed them individually into Dalanine auxotroph E. coli MB2795. The results indicated that MICROBIOLOGY

Vol. 84

No. 2

2015

207

L A L l a Ar L g L Lys H L ys L Se r T L h r A L sp M L et V L al Tr L y G L l u P L he P L ro Le L u Ll e G L ly C L y s G ln

Relative activity, %

320 280 240 200 160 120 80 40 0 Al uS r M O4 gS O C 4 aC N l2 a2 S M O4 nS N O4 aN O 3 N Pb aC (N l O 3) C 2 oC Zn l2 SO ED 4 TA

Relative activity, %

BIOCHEMICAL CHARACTERISTICS OF AN ALANINE RACEMASE

Fig. 7. Substrate specificity of alanine racemase. Note: Data represent the average of three independent determi nations (standard deviation was less than 5%).

alr2 was successfully expressed and exhibited alanine racemase activity, while the other genes did not exhibit alanine racemase activity in E. coli. The optimal temperature and pH for Alr catalysis of the conversion of Lalanine to Dalanine was 37°C and pH 10. The enzyme was demonstrated to exhibit broad temperature and pH optima. The effects of metal ions and other reagents on enzymes are diverse. Some studies of other bacterial alanine racemases have revealed that divalent cations, such as Ca2+ and Mg2+ enhanced racemization and dehydration by alanine racemase. It’s worth noting that Cu2+ enhanced the catalytic activity up to 300%. One report inferred that Cu2+ inhibited the activity of an alanine racemase from Pseudomonas putida YZ26 [24]. In contrast, Cu2+ caused 30 to 40% stimulation of enzyme activity of the Serine racemase from Pyrobaculum islandicum [25]. From the results above, it can be deduced that Cu2+ could be a cofactor of the alanine racemase and play an important role in the catalytic activity. Table 1. Effect of various chemicals on alanine racemase activity Chemical

Concentration, mM

None Hydroxylamine

DTT Pyridoxal 5phos phate, PLP

Relative activity, % 100

0.1

45

1

17

10

0

1

33

5

0

0.01

95

0.04

92

0.06

97

208

DONG LIU et al.

Table 2. Kinetic parameters for racemization by alanine racemase Alr2 L → Dalanine

D → Lalanine

Km

Vmax

Km

Vmax

Alr2 35.9

2898

15.36

1209

Keq(L/D) 1.03

Alanine racemase is a highly specific amino acid racemase [26]. Investigation of substrate specificity indicated that Lalanine is the optimal substrate, although suboptimal activity was detected for Largi nine, Lhistidine, and Llysine. However, enzyme did not catalyze the racemization of Lserine and other amino acids. Similar to our results, the enzyme from Corynebacterium glutamicum did not show any enzyme activity with Lserine [27]. In contrast to our results, alanine racemase from P. putida YZ26 [24] showed very low activity with Lserine. Interestingly, to date, very few reports describing the racemization of Largi nine, Lhistidine, and Llysine by alanine racemase have been published. Furthermore, the enzyme activ ity of Larginine was approximately 50% of the activity detected using Lalanine as the substrate. Different substrate specificities reflect different structures of ala nine racemases, therefore further investigation of the structure and catalytic mechanism of this alanine racemase is required. As an essential and uniquely prokaryotic enzyme, alanine racemase has long been pursued as a target for antimicrobial drug discovery [28]. Numerous enzyme inhibitors have been identified. Recently, some studies have employed the structurebased design approach to identify novel alanine racemase inhibitors [9, 12, 13, 29]. Based on this approach, some small molecules in the 200–350 MW range that successfully docked to the active site were identified as possible inhibitors [2, 13]. Sharma et al. [30] carried out the in silico analysis of the A. hydrophila genome for various aspects of its biology and identification of potential vaccine and drug targets. The study revealed 2,097 genes which were nonhomologous to the human genome, and 87 enzymes that may be used as drug targets, as they are not present in humans. Alanine racemase was one of the 15 enzymes belonging to pathways present only in bacteria. Therefore, this enzyme is regarded as a drug target for further investigation to develop effec tive drugs against A. hydrophila. Future investigation will focus on selection of novel enzyme inhibitors of A. hydrophila. ACKNOWLEDGMENTS This study was supported by Research Fund for the Doctoral Program of Hebei Normal University (L2010B10) and Natural Science Foundation of Hebei Province (C2013205103).

REFERENCES 1. Toranzo, A.E., Romalde, J.L., Magariños, B., and Barja, J.L., Present and future of aquaculture vaccines against fish bacterial diseases, Options Méditer ranéennes, 2009, no. 86, pp. 155–176. 2. Saavedra, M.J., GuedesNovais, S., Alves, A., Rema, P., Tacão, M., Correia, A., and MartínezMurcia, A., Resistance to βlactam antibiotics in Aeromonas hydro phila isolated from rainbow trout (Onchorhynchus mykiss), Int. Microbiol., 2004, vol. 7, no. 3, pp. 207– 211. 3. Ni, X.D., Wang, N., Liu,Y.J., and Lu, C.P., Immuno proteomics of extracellular proteins of the Aeromonas hydrophila China vaccine strain J1 reveal a highly immunoreactive outer membrane protein, FEMS Immunol. Med. Microbiol., 2010, vol. 58, no. 3, pp. 363–373. 4. Guan, R., Xiong, J., Huang, W., and Guo, S., Enhancement of protective immunity in European eel (Anguilla anguilla) against Aeromonas hydrophila and Aeromonas sobria by a recombinant Aeromonas outer membrane protein, Acta. Biochim. Biophys. Sin., 2011, vol. 43, no. 1, pp. 79–88. 5. Cava, F., Lam, H., de Pedro, M.A., and Waldor, M.K., Emerging knowledge of regulatory roles of Damino acids in bacteria, Cell Mol. Life Sci., 2011, vol. 68, no. 5, pp. 817–831. 6. di Salvo, M.L., Florio, R., Paiardini, A., Vivoli, M., D’Aguanno, S., and Contestabile, R., Alanine race mase from Tolypocladium inflatum: a key PLPdepen dent enzyme in cyclosporin biosynthesis and a model of catalytic promiscuity, Arch Biochem. Biophys., 2013, vol. 529, no. 2, pp. 55–65. 7. Pierce, K.J., Salifu, S.P., and Tangney, M., Gene clon ing and characterization of a second alanine racemase from Bacillus subtilis encoded by yncD, FEMS Micro biol. Lett., 2008, vol. 283, no. 1, pp. 69–74. 8. Strych, U., Davlieva, M., Longtin, J.P., Murphy, E.L., Im, H., Benedik, M.J., and Krause, K.L., Purification and preliminary crystallization of alanine racemase from Streptococcus pneumoniae, BMC Microbiol., 2007, vol. 7, p. 40. 9. Zajdowicz, S.L., JonesCarson, J., VazquezTorres, A., Jobling, M.G., Gill, R.E., and Holmes, R.K., Alanine racemase mutants of Burkholderia pseudomallei and Burkholderia mallei and use of alanine racemase as a nonantibioticbased selectable marker, PLoS One, 2011, vol. 6, p. e21523. 10. Couñago, R.M., Davlieva, M., Strych, U., Hill, R.E., and Krause, K.L., Biochemical and structural charac terization of alanine racemase from Bacillus anthracis (Ames), BMC Struct. Biol., 2009, vol. 9, p. 53. 11. Priyadarshi, A., Lee, E.H., Sung, M.W., Nam, K.H., Lee, W.H., Kim, E.E., and Hwang, K.Y., Structural insights into the alanine racemase from Enterococcus faecalis, Biochim. Biophys. Acta., 2009, vol. 1794, no. 7, pp. 1030–1040. 12. Im, H., Sharpe, M.L., Strych, U., Davlieva, M., and Krause, K.L., The crystal structure of alanine racemase from Streptococcus pneumniae, a target for structure based drug design, BMC Microbiol., 2011, vol. 11, p.116. MICROBIOLOGY

Vol. 84

No. 2

2015

BIOCHEMICAL CHARACTERISTICS OF AN ALANINE RACEMASE 13. Scaletti, E.R., Luckner, S.R., and Krause, K.L., Struc ture features and kinetic characteization of alanine racemase from Staphylococcus aureus (Mu50), Acta Crystallographica section D Biol. Crystallography, 2011, vol. 68, Pt 1, pp. 82–92. 14. Li, N., Sun, Y.M., Tian, L.Y., and Zhao, B.H. The iso lation and identification of Aeromonas hydrophila, J. Hebei Normal Univ./Nat. Sci. Ed., 2009, vol. 33, no. 2, pp. 240–243. 15. KysheAndersen, J., Electroblotting of multiple gels: a simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose, J. Biochem. Biophys. Methods, 1984, vol. 10, pp. 203–209. 16. Soda, K., Microdetermination of Damino acids and Damino acid oxidase activity with 3methyl2ben zothiazolone hydrazone hydrochloride, Anal. Bio chem., 1968, vol. 25, no. 1, pp. 228–235. 17. Ju, J., Misono, H., and Ohnishi, K., Directed evolution of bacterial alanine racemases with higher expression level, J. Biosci. Bioeng., 2005, vol. 100, no. 3, pp. 246– 254. 18. Cao, Q., Zhao, Z., Zhang, Y.Z., Wang, Y., and Ding, J.Y., Cloning sequence analysis and expression of alanine racaemase gene in Pseudomonas putida, Wei Sheng Wu Xue Bao, 2006, vol. 46, no. 1, pp. 80–84. 19. Francois, J.A. and Kappock, T.J., Alanine racemase from the acidophile Acetobacter aceti, Protein Expri. Purif., 2007, vol. 51, no. 1, pp. 39–48. 20. Wasserman, S.A., Daub, E., Grisafi, P., Botstein, D., and Walsh, C.T., Catabolic alanine racemase from Sal monella typhimurium: DNA sequence, enzyme purifi cation, and characterization, Biochemistry, 1984, vol. 23, no. 22, pp. 5182–5187. 21. Zhang, L., Sun, C., Zhang, Y., Yang, J., and Zhao, B., Transient expression of Aeromonas hydrophila HBNUAh01 outer membrane protein A gene in tobacco leaf cells, Wei Sheng Wu Xue Bao, 2012, vol. 52, no. 2, pp. 184–190. 22. Seshadri, R., Joseph, S.W., Chopra, A.K., et al., Genome sequence of Aeromonas hydrophila ATCC

MICROBIOLOGY

Vol. 84

No. 2

2015

23.

24.

25.

26.

27.

28.

29.

30.

209

7966T: Jack of all trades, J. Bacteriol., 2006, vol. 188, pp. 8272–8282. Milligan, D.L., Tran, S.L., Strych, U., Cook, G.M., and Krause, K.L., The alanine racemase of Mycobacte rium smegmatis is essential for growth in the absence of Dalanine, J. Bacteriol., 2007, vol. 189, no. 22, pp. 8381⎯8386. Liu, J.L., Liu, X.Q., and Shi, Y.A., Expression, purifi cation, and characterization of alanine racemase from Pseudomonas putida YZ26, World J. Microbiol. Bio technol., 2012, vol. 28, no. 1, pp. 267–274. Ohnishi, M., Saito, M., Wakabayashi, S., Ishizuka, M., Nishimura, K., Nagata, Y., and Kasai, S., Purification and characterization of serine racemase from a hyper thermophilic archaeon, Pyrobaculum islandicum, J. Bacteriol., 2008, vol. 190, no. 4, pp. 1359–1365. Kino, K., Sato, M., Yoneyama, M., and Kirimura, K., Synthesis of DLtryptophan by modified broad speci ficity amino acid racemase from Pseudomonas putida IFO 129962007, Appl. Microbiol. Biotechnol., 2007, vol. 73, no. 6, pp. 1299–1305. Oikawa, T., Tauch, A., Schaffer, S., and Fujioka, T., Expression of alr gene from Corynebacterium glutamicum ATCC 13032 in Escherichia coli and molec ular characterization of the recombinant alanine race mase, J. Biotechnol., 2006, vol. 125, no. 4, pp. 503–512. Conti, P., Tamborini, L., Pinto, A., Blondel, A., Minoprio, P., Mozzarelli, A., and De Micheli, C., Drug discovery targeting amino acid racemases, Chem. Rev., 2011, vol. 111, no. 11, pp. 6919–6946. Ciustea, M., Mootien, S., Rosato, A.E., Perez, O., Cir illo, P., Yeung, K.R., Ledizet, M., Cynamon, M.H., Aristoff, P.A., Koski, R.A., Kaplan, P.A., and Anthony, K.G., Thiadiazolidinones: a new class of ala nine racemase inhibitors with antimicrobial activity against methicillinresistant Staphylococcus aureus, Biochem. Pharmacol., 2012, vol. 83, no. 3, pp. 368– 377. Shama, V., Gupta, P., and Dixit, A., In silico identifica tion of putative drug targets from different metabolic pathways of Aeromonas hydrophila, In Silico. Biol., 2008, vol. 8, pp. 331–338.