Biophysical Chemistry

ISSN 2038 - 0321 Vol. 2 N. 3 June 2011

International Review of

Biophysical Chemistry (IREBIC)

Contents: SPECIAL SECTION ON

3RD INTERNATIONAL MEETING ON G-QUADRUPLEXES AND G-ASSEMBLY Editorial by Concetta Giancola, Antonio Randazzo

65

Do Anions Exert any Structural Changes on Dimeric d(G4T4G4)2 Quadruplex in Aqueous Solution? by Primož Šket, Rok Pirh, Janez Plavec

68

Preparation and AFM-Characterization of Self-Assembled Monolayers Functionalized with a Thrombin Binding Aptamer by Brendan Manning, Isaac Gállego, María Tintoré, Mª Carme Fàbrega, Anna Aviñó, Ramon Eritja

74

Template Assembled Synthetic G-Quadruplex: a Novel Biomolecular System for Investigating the Interactions of Ligands with Constrained Quadruplex Conformation by R. Bonnet, P. Murat, N. Spinelli, A. Van Der Heyden, P. Labbé, P. Dumy, E. Defrancq

78

Density Functional Study of the Structure of Guanine Octets in Aqueous Medium by Mykola M. Ilchenko, Igor Ya. Dubey

82

Switching between Supramolecular Assemblies of Lipophilic Guanosine Derivatives Triggered by External Stimuli by Stefano Masiero, Lucia Gramigna, Paolo Neviani, Rosaria C. Perone, Silvia Pieraccini, Gian Piero Spada

87

PNA Oligomers as Tools for Targeting G-Quadruplex Structures by Jussara Amato

96

Structural and Functional Characterization of Thrombin Binding Aptamer Minor Loop by Giuseppe Marson, Manlio Palumbo, Claudia Sissi

102

Copyright © 2011 Praise Worthy Prize S.r.l. - All rights reserved

International Review of Biophysical Chemistry (IREBIC) Editor-in-Chief: prof. Concetta Giancola Department of Chemistry Faculty of Mathematical, Physical and Natural Sciences FEDERICO II University Via Cinthia - Complesso Monte S. Angelo - I80126, Naples, Italy [email protected]

Editorial Board: Barone Vincenzo

(Italy)

Scuola Normale Superiore di Pisa

Berliner Lawrence J.

(U.S.A.)

University of Denver - Department of Chemistry & Biochemistry

Catala' Angel

(Argentina)

Universidad Nacional de La Plata - Facultad de Ciencias Exactas

Chaires Jonathan B.

(U.S.A.)

University of Louisville - James Graham Brown Cancer Center

Gabelica Valérie

(Belgium)

University of Liege - Mass Spectrometry Laboratory

Gadda Giovanni

(U.S.A.)

Georgia State University - Department of Chemistry

Kim Byeang Hyean

(Korea)

Pohang University of Science and Technology

Kotlyar Alexander

(Israel)

Tel-Aviv University of Israel

Markovitsi Dimitra

(France)

Francis Perrin Laboratory- CEA/Sacaly

Mergny Jean- Louis

(France)

Institut Européen de Chimie et Biologie

Pa'li Tibor László

(Hungary)

Institute of Biophysics - Biological Research Centre

Plavec Janez

(Slovenia)

National Institute of Chemistry

Sugimoto Naoki

(Japan)

Konan University - Frontier Institute for Biomolecular Engineering Research (FIBER)

Toshev Borislav

(Bulgaria)

University of Sofia - Department of Physical Chemistry

Ventura Salvador

(Spain)

Universitat Autonoma de Barcelona - Institut de Biotecnologia i de Biomedicina

The International Review of Biophysical Chemistry (IRe.Bi.C.) is a publication of the Praise Worthy Prize S.r.l.. The Review is published bimonthly, appearing on the last day of February, April, June, August, October, December. Published and Printed in Italy by Praise Worthy Prize S.r.l., June 30, 2011. Copyright © 2011 Praise Worthy Prize S.r.l. - All rights reserved. This journal and the individual contributions contained in it are protected under copyright by Praise Worthy Prize S.r.l. and the following terms and conditions apply to their use: Single photocopies of single articles may be made for personal use as allowed by national copyright laws. Permission of the Publisher and payment of a fee is required for all other photocopying, including multiple or systematic copying, copying for advertising or promotional purposes, resale and all forms of document delivery. Permission may be sought directly from Praise Worthy Prize S.r.l. at the e-mail address: [email protected] Permission of the Publisher is required to store or use electronically any material contained in this journal, including any article or part of an article. Except as outlined above, no part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without prior written permission of the Publisher. E-mail address permission request: [email protected] Responsibility for the contents rests upon the authors and not upon the Praise Worthy Prize S.r.l.. Statement and opinions expressed in the articles and communications are those of the individual contributors and not the statements and opinions of Praise Worthy Prize S.r.l.. Praise Worthy Prize S.r.l. assumes no responsibility or liability for any damage or injury to persons or property arising out of the use of any materials, instructions, methods or ideas contained herein. Praise Worthy Prize S.r.l. expressly disclaims any implied warranties of merchantability or fitness for a particular purpose. If expert assistance is required, the service of a competent professional person should be sought.

International Review of Biophysical Chemistry (I.RE.BI.C.), Vol. 2, N. 3 Special Section on 3rd International Meeting on G-Quadruplexes and G-assembly June 2011

PNA Oligomers as Tools for Targeting G-Quadruplex Structures Jussara Amato Abstract – G-quadruplex-forming sequences (QFS) are widely distributed in the human genome, including chromosomal telomeres and regulatory regions of oncogenes, and are involved in a variety of biological contexts. Molecular probes that selectively target QFS have been investigated to delineate their biological role and to identify potential therapeutic agents. Peptide nucleic acids (PNAs) targeting to QFS can be designed using two different approaches. In the first, complementary cytosine-rich PNAs can hybridize to the target QFS by forming PNA:DNA or PNA:RNA hybrid duplexes. In the second, guanine-rich PNAs can hybridize to the homologous DNA or RNA target by forming the corresponding heteroquadruplexes. This review discusses the principles and the recent improvements of the complementary and homologous hybridization modes of PNA oligomers. Copyright © 2011 Praise Worthy Prize S.r.l. - All rights reserved.

Keywords: G-Quadruplex, Peptide Nucleic Acid (PNA), Hybridization

I.

Understanding of physiological roles of G-quadruplex structures is expanding rapidly. These structures have been experimentally found to form from genomic sequences in critical regions such as telomeres, gene promoters and UTRs [3], and to have physiological effects in each of these regions. This explains the considerable interest in the development of ligands that selectively target G-quadruplexes, as tools for delineating their biological roles, as well as for obtaining potential therapeutic agents. A large majority of papers in this area describe small molecules able to recognize the “shape” of Gquadruplexes [4]-[6]. The planar tetrads, grooves and loops offer distinctive surfaces to which small molecules can interact by making π-π stacking, hydrogen bond or van der Waals interactions. An alternative strategy for quadruplex binding is based on “sequence recognition” which requires quadruplex unfolding, in order to access the sequence information encoded within the nucleobases [7]-[10]. In this field, Peptide Nucleic Acids (PNAs) represent a promising class of synthetic DNA mimics, able to hybridize to DNA and RNA sequences with higher specificity and thermodynamic stability than natural nucleic acids [11], [12]. In PNA oligomers the entire sugar-phosphate backbone is replaced by a pseudopeptide strand (Fig. 2). The bases extend from the polyamide backbone, made of repeated 2-(aminoethyl)glycine units, at approximatively the same distances as in natural DNA or RNA [11]. This allows PNAs to hybridize to their complementary DNA or RNA sequences in a sequence-specific manner following the Watson-Crick rules (Fig. 2). Since the PNA backbone is uncharged, the hybridization results in more stable complexes [13].

Introduction

Guanine-rich DNA and RNA sequences are known to fold into secondary structures called G-quadruplexes. The quadruplex motif consists in a core of four guanines, arranged in a quasi-square planar structure, known as Gtetrad (Fig. 1) [1]. In a G-tetrad the guanine bases are associated through a cyclic array of Hoogsteen hydrogen bonds, in which each guanine base both accepts and donates two hydrogen bonds. π-stacking of the G-tetrads and the coordination of metal ions to the guanine O6 carbonylic oxygens lead to further stabilization of the structure [2]. H N

N

N

H N

N N

N

H N

O

O

H

N H H

N

N

H

H N O

H

O N

N

N

H N H N

N

N

N H

Fig. 1. Molecular representation of a G-tetrad

Manuscript received and revised May 2011, accepted June 2011


96

J. Amato

Interestingly, PNA:DNA duplex stability is highly affected by the presence of a single mismatched basepair [20]. Thus, PNA probes are very sequence-selective and they are preferred to DNA probes in recognizing single-base mispairing. Complementary PNAs have been used for detection and sizing of the single stranded overhanging telomeric DNA [21]. Human telomeres contain long stretches of the repetitive sequence “TTAGGG” which are bound by specific proteins. With each cell division, telomeres shorten by 50–200 bp and when they become too short, the cell either dies or stops dividing. In cancer cells, the enzyme telomerase keeps rebuilding the telomeres, by adding “TTAGGG” repeats onto the telomeres using its intrinsic RNA as a template for reverse transcription [22], so the cell never stops dividing. The most prominent hypothesis is that maintenance of telomere stability is required for the long-term proliferation of tumors. This makes telomerase a target not only for cancer diagnosis but also for the development of novel anti-cancer therapeutic agents. At this purpose, C-rich PNA probes have been used for telomerase inhibition. There are numerous reports of PNA being targeted to the RNA component of telomerase and inhibiting the enzyme [23]-[27]. In addition, homopyrimidine PNAs can recognize complementary homopurine target sites in double stranded (ds) DNA by the “strand invasion” mechanism (Figs. 3) [28]. In this context, homopyrimidine PNA strands bind a poly-purine target of dsDNA by local displacement of the DNA pyrimidine strand by forming a PNA:DNA:PNA triplex [29]. The strand invasion mechanism can be also extended to other secondary motifs adopted by nucleic acids, such as G-quadruplexes. In 2001, Datta and Armitage reported the ability of short C-rich PNAs to overcome the G-quadruplex structure formed by Thrombin Binding Aptamer (TBA) sequence d(5’-GGTTGGTGTGGTTGG-3’) [7]. TBA represents a simple secondary structure to test the impact of the G-quadruplex target-folding on PNA hybridization. TBA sequence folds into a stable intramolecular quadruplex structure featuring two stacked guanine tetrads and three loops (Fig. 4(a)) [30]. The authors synthesized a short 7-mer homopyrimidine PNA, complementary to the central seven bases of TBA, and demonstrated the ability of this PNA probe to spontaneously disrupt the target Gquadruplex structure by forming a surprisingly stable PNA:DNA hybrid duplex (Fig. 3(a)), considering that only seven base pairs were formed. Since the probe is significantly shorter than the target, hybridization leads to the formation of overhangs on both 3’- and 5’- ends of the target DNA. Further experiments revealed that the overhanging nucleotides, contribute to the heteroduplex stability. This effect was also observed with other duplex and overhang sequences, indicating that it is not specific to the PNA:DNA hybrid used in this study.

Fig. 2. Chemical structure of PNA and DNA and their base pairs

PNA oligomers targeting G-quadruplex-forming sequences (QFS) can be designed following two different approaches. In the first approach, namely “complementary hybridization” (Fig. 3(a)), a WatsonCrick complementary PNA-strand (C-rich PNA) is synthesized to be targeted to a sequence within the target G-quadruplex structure [7], [8]. The high G-content of the target combined with the high affinity of PNA towards DNA and RNA, allows short complementary oligomers to bind and form stable hybrid duplexes. The alternative approach, called “homologous hybridization” (Fig. 3(b), involves an homologous PNAstrand (G-rich PNA), having the same G-rich sequence of the target [14], [15]. Homologous PNAs form hybrid G-quadruplexes with nucleic acid targets. These structures exhibit stabilization by specific metal ions such as potassium and sodium (but not lithium), analogously to pure DNA and RNA quadruplexes [16], [17]. Moreover, the hybrid quadruplexes are very stable and readily form at low nanomolar concentrations [18]. This review focus on the use of PNA oligomers to target QFS and the main results obtained with these two approaches are discussed.

II.

Hybridization of Complementary PNA to G-Quadruplexes

Homopyrimidine PNAs can bind to complementary homopurine tracts by forming stable hybrid duplexes. While in DNA:DNA duplexes the two strands are always in an antiparallel orientation (with the 5’-end of one strand opposed to the 3’-end of the other), PNA:DNA adducts can display two different orientations, arbitrarily termed parallel and antiparallel, both adducts being formed at room temperature, with the antiparallel orientation (Fig. 2) showing higher stability [19]. Copyright © 2011 Praise Worthy Prize S.r.l. - All rights reserved

International Review of Biophysical Chemistry, Vol. 2, N. 3 Special Section on 3rd International Meeting on G-Quadruplexes and G-assembly

97

J. Amato

Figs. 3. Schematic representation of (a) complementary hybridization, and (b) homologous hybridization with PNA molecules

In 2003, Balasubramanian and coworkers reported studies on the kinetics of opening of the intramolecular quadruplex formed by the 21-mer oligonucleotide containing 3.5 repeats of the human telomeric sequence d[(GGGTTA)3GGG] by using C-rich PNA strands [31]. They found that the opening is zero-order with respect to PNA, thus resulting different from PNA hybridization to unstructured DNA or DNA hairpins, whereas PNA invasion was found to be first-order to both components, making it second-order overall. They also provided a possible explanation for the observed reaction order for hybridization of the PNA to the quadruplex, suggesting that the initial step is a rate-limiting internal rearrangement of the quadruplex, followed by a fast hybridization step. In 2005, Marin and Armitage demonstrated that the complementary recognition of quadruplexes by PNA can be extended to RNA targets [15]. They used as target a RNA aptamer selected for binding to the Fragile X mental retardation protein, RDQ, which folds in a structure containing distinct duplex and quadruplex domains (Fig. 4(b)) [32]. A PNA probe complementary to the quadruplex domain of RDQ was designed and successfully used to hybridize by “invading” the quadruplex domain, thus forming a stable heteroduplex. The PNA:DNA heteroduplex stability is relatively insensitive to changes in ionic strength of the solution [33], although the stability of all the competing secondary structures of the DNA target are very sensitive to the ionic strength. This effect was clearly demonstrated with the TBA quadruplex [7]. Indeed, a buffer solution containing 10 mM potassium phosphate and 100 mM KCl yielded a PNA:DNA hybrid with a melting temperature (Tm) of 34 °C, while when KCl concentration was reduced to 10 mM, Tm value of the hybrid complex increased to 55 °C. This phenomenon was almost entirely ascribed to the stabilization of the quadruplex structure by the presence of higher ions concentration. In this context, we have also investigated the interaction between several QFS, each containing one or more TGGGGT motif, and the short complementary Copyright © 2011 Praise Worthy Prize S.r.l. - All rights reserved

H-ACCCCA-OH PNA, by varying the ionic strength of the buffer solution [10]. The main results of this study are that (i) quadruplex stability greatly influences PNA binding mode and the stoichiometry of the resulting hybrid complexes; (ii) when PNA is added to unfolded QFS, PNA:DNA heteroduplexes are favored at high ionic strength, while PNA:DNA:PNA triplex complexes are favored at low ionic strength. This is because triplex formation requires a greater number of hydrogen bonds, which are stabilized at low ionic strength. Therefore, one can expect a significant ionic strength dependence for PNA hybridization to DNA or RNA quadruplex targets.

Figs. 4. Schematic representation of (a) TBA, (b) RDQ, and (c) c-Kit87up quadruplex structures

Recently, we reported the first example of PNA probes able to bind to a biological relevant DNA quadruplex without disrupting its scaffold [34]. Particularly, we investigated the c-Kit87up quadruplex targeting (Fig. 4(c)) with C-rich PNA probes and demonstrated that PNA binding mode depends on the quadruplex stability. At this purpose, we performed the design and synthesis of short PNAs (Table I) potentially able to bind to suitable complementary sequences of loops and/or stem regions of the G-quadruplex structure formed by the c-Kit87up sequence in two different cation solutions, K+ and NH4+ solutions. The overall picture emerging from this study is that the investigated PNAs are able to interact with c-Kit87up quadruplex in both K+


98

J. Amato

and NH4+ solutions, but with a different binding mode. As known, the nature of the cations in solution significantly influences the stability of G-quadruplexes. The different behaviour of PNA molecules arises just from the relative stability of the quadruplex in the two ionic solutions. In K+ solution, where the quadruplex structure stability is highest, the PNAs are still able to bind to the quadruplex without overcoming it, thus acting as “quadruplex-binding agents”. On the contrary, in NH4+ solution, where the quadruplex stability is lowest, the PNAs are able to overcome the less stable quadruplex structure hybridizing the DNA sequence, thus acting as “quadruplex openers”.

conditions, two- and four-stranded G-quadruplex structures can be formed. The PNA tetramer H-TGGGLys-OH assembles into a four-stranded antiparallel quadruplex arrangement to minimize the positive charged termini of the PNA strands [37]. The PNA dodecamer H-G4T4G4-Lys-NH2 preferentially assembles into a dimeric quadruplex, although a small amount of tetrameric structures are observed in the presence of potassium [14]. No evidences of monomeric quadruplexes, made of PNA only, exist. Interestingly, it has recently shown that conformation and composition of homo- or hybrid-quadruplexes can be programmed by π-π stacking interactions exerted by aromatic units attached at 5’- and N-termini of DNA and homologous PNA, respectively [38]. For example, the conjugation of the 5’-terminus of the d(G4T4G4) sequence with hydrophobic head groups having large planar π-surface, allows the formation of highly stable dimeric and tetrameric parallel quadruplexes, in contrast with the antiparallel dimeric hairpin quadruplex structure formed by the unmodified d(G4T4G4) oligonucleotide sequence. In addition, the π-π stacking interactions between the aromatic groups, which guide the formation of parallel quadruplex, are strong enough to resist a disruption by the PNA probe. Programming the formation of PNA and DNA quadruplex combined with the high affinity of G-rich PNA for the homologous DNA, suggest numerous biological applications. In principle, homologous G-rich PNA could target the G-rich strand by forming PNA:DNA heteroquadruplexes, then, by definition, the same PNA strand would be complementary to the C-rich DNA strand and thus forming hybrid duplexes. This would permit the same PNA to hybridize to both strands at the target site and could greatly improve the potency for antigene activity. In addition, a new mode of sequencespecific targeting, by using G-rich PNAs, was recently proposed by Panyutin and collaborators [39]. They designed short duplex- and triplex-forming G-rich PNAs (bis-PNA), targeting the G-rich sequence in the BCL2 gene 176-bp upstream of the P1 promoter. Those probes were able to invade the dsDNA by selectively binding to the complementary cytosine-rich sequence, thus promoting quadruplex formation in the guanine-rich segment.Recently, a surprising degree of kinetic discrimination for PNA heteroquadruplex formation was demonstrated [40]. A fastest hybridization was observed for targets folded into parallel morphologies. Since PNA:DNA and PNA:RNA heteroquadruplexes favor anti dG conformations, this could account for the faster PNA hybridization to the parallel targets rather than to hybrid and non-canonical parallel quadruplex structures.

TABLE I SEQUENCES USED IN C-KIT QUADRUPLEX-TARGETING STUDY Name

Sequence

c-Kit87up P1 P2 P3 P4 P5

d(5’AGGGAGGGCGCTGGGAGGAGGG3’) H2NLys-TCCTC-H H2NLys-TCCTCCC-H H2NLys-TCCCTCCC-H H2NLys-TCCCTCCCGCGAC-H H2NLys-TTTTTTTT-H

c-Kit87up guanines forming G-tetrads are underlined

III. Hybridization of Homologous PNA to G-Quadruplexes G-rich PNAs can invade DNA and RNA quadruplexes to form stable PNA:DNA or PNA:RNA heteroquadruplexes [35]. Noteworthy, it has been demonstrated that the flexibility of the PNA backbone plays a fundamental role in improving the thermodynamic properties of quadruplex formation [36]. In 2003, Armitage and coworkers reported the first example of a PNA probe binding to a DNA target by using G-tetrad molecular recognition mode [16]. They targeted a dimeric G-quadruplex formed by the Oxytricha nova telomeric sequence d(G4T4G4) with a homologous PNA probe. UV-vis and CD spectroscopy revealed that a stable PNA:DNA hybrid quadruplex was formed, while fluorescence resonance energy transfer (FRET) experiments determined a four-stranded character of the hybrid. FRET results indicated that the two PNA strands are parallel to each other, the same occurred in the case of the two DNA strands. The relative strand orientation was also determined, the 5’termini of the DNA strands align with the N-termini of the PNA strands. G-rich PNA sequences, comprising at least three tandem guanine residues, can also selfassembly to form quadruplex structures based solely on PNA. The ion dependency of homo- and heteroquadruplex structures is analogous to that reported for DNA quadruplexes. Therefore, quadruplex polymorphism, which is well-known for various guanine rich DNA sequences, is also detected for PNA quadruplexes [14]. Depending on the sequence and length of a G-rich PNA, as well as on solution


IV.

Advantages and Drawbacks

A key aspect of designing compounds able to regulate gene transcription is optimizing the selectivity so that they could specifically modulate the activation or


99

J. Amato

inhibition of the specific gene. Respect to small molecules targeting G-quadruplexes, PNA sequences offer the advantage of a higher selectivity due to the specific base-sequence recognition. Interestingly, PNA sequences could be used to increase the selectivity of small molecules by conjugating them with PNA probes. Despite the large interaction surface provided by the PNA oligomers, “sequence-targeted” approaches to Gquadruplex recognition have several limitations. Complementary oligonucleotides must exhibit high sequence selectivity in order to avoid off-target effects. This is particularly difficult in the case of G-rich targets, since duplexes containing single mismatches might still be quite stable at physiological temperatures. Thus, it would be difficult to avoid off-target effects for C-rich probes targeting quadruplexes by heteroduplex formation. In the homologous hybridization strategy, the probe must (i) avoid binding to complementary competitors (e.g. cytosine-rich RNAs) and (ii) successfully hybridize to a specific quadruplex. Two strategies for improving selectivity of a G-rich PNA for binding to homologous quadruplex target versus complementary sequences, have been recently reported [18]. In the first approach, the bases not involved in Gtetrad formation have been replaced with abasic miniPEG units, to eliminate two potential Watson-Crick base-pairs with a complementary competitor. In the second approach, chiral modifications in the PNA backbone have been introduced by using D-γ-modified PNA residues, thus realizing left-handed D-γ-PNAs. D-γPNAs binding to complementary DNA and RNA targets results significantly weakened compared to the binding to the homologous DNA to form PNA:DNA heteroquadruplexes. Finally, combining abasic and D-γmodified residues, high selective PNAs for homologous versus complementary targets were obtained. Nevertheless, these strategies are focused on address only a part of the problems concerning the quadruplextargeting PNAs. To date, modified PNAs able to successfully hybridize to a specific quadruplex have not been yet employed. If the goal is targeting a single quadruplex, innovative strategies could take in consideration distinctive secondary recognition elements of the quadruplex structures, such as loops and grooves.

V.

involves the lengthening of PNA to allow additional base-pairs formation. However, long PNA molecules are less soluble in physiological liquids. In addition, increasing the size of PNA oligomers decrease the already poor cellular uptake showed by these molecules. Recent efforts to provide higher selectivity for homologous hybridization include modifications of backbone and the development of novel base analogs. Ongoing work could provide the basis for future applications of PNA in regulation of gene expression.

Acknowledgements The author would like to thank Dr. Bruno Pagano for helpful suggestions, discussions, and critical reading of the manuscript. This work was supported by Italian PRIN funding. The COST Action MP0802 is acknowledged.

References [1]

A.T. Phan, Human telomeric G-quadruplex: structures of DNA and RNA sequences, FEBS Journal, Volume 277, (Issue 5), March 2010, Pages 1107-1117. [2] M.A. Keniry, Quadruplex structures in nucleic acids, Biopolymers, Volume 56, (Issue 3), 2001, Pages 123–146. [3] D.J. Patel, A.T. Phan, V. Kuryavyi, Human telomere, oncogenic promoter and 5′-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics, Nucleic Acids Research, Volume 35, (Issue 22), October 2007, Pages 7429-7455. [4] L. Martino, B. Pagano, I. Fotticchia, S. Neidle, C. Giancola, Shedding light on the interaction between TMPyP4 and human telomeric quadruplexes, Journal of Physical Chemistry B, Volume 113, (Issue 44), November 2009, Pages 14779-14786. [5] B. Pagano, I. Fotticchia, S. De Tito, C.A. Mattia, L. Mayol, E. Novellino, A. Randazzo, C. Giancola, Selective Binding of Distamycin A Derivative to G-Quadruplex Structure [d(TGGGGT)]4, Journal of Nucleic Acids, Volume 2010, May 2010, Article ID 247137, 7 Pages. [6] L. Petraccone, I. Fotticchia, A. Cummaro, B. Pagano, L. GinnariSatriani, S. Haider, A. Randazzo, E. Novellino, S. Neidle, C. Giancola, The triazatruxene derivative azatrux binds to the parallel form of the human telomeric G-quadruplex under molecular crowding conditions: Biophysical and molecular modeling studies, Biochimie., Volume 93, (Issue 8), August 2011, Pages 1318-1327. [7] B. Datta, B.A. Armitage, Hybridization of PNA to structured DNA targets: quadruplex invasion and the overhang effect, Journal of the American Chemical Society, Volume 123, (Issue 39), October 2001, Pages 9612-9619. [8] J.J Green, L. Ying, D. Klenerman, S. Balasubramanian, Kinetics of unfolding the human telomeric DNA quadruplex using a PNA trap. Journal of the American Chemical Society, Volume 125, (Issue 13), April 2003, Pages 3763-3767. [9] N. Kumar, A. Patowary, S. Sivasubbu, M. Petersen, S. Maiti, Silencing c-MYC expression by targeting quadruplex in P1 promoter using locked nucleic acid trap, Biochemistry, Volume 47, (Issue 50), December 2008, Pages 13179-13188. [10] J. Amato, G. Oliviero, E. De Pauw, V. Gabelica, Hybridization of short complementary PNAs to G-quadruplex forming oligonucleotides: An electrospray mass spectrometry study, Biopolymers, Volume 91, (Issue 4), April 2009, Pages 244-255. [11] P.E. Nielsen, M. Egholm, R.H. Berg, O. Buchardt, Sequenceselective recognition of DNA by strand displacement with a thymine-substituted polyamide, Science, December 1991, Volume 254, (Issue 5037), Pages 1497-1500. [12] M. Egholm, O. Buchardt, L. Christensen, C. Behrens, S.M. Freier,

Conclusion

In the last decade, sequence-targeting approaches to recognize QFS by using PNAs, have been employed. The results described above illustrate that both complementary and homologous PNAs can hybridize with high affinity and selectivity to G-quadruplexforming targets. Moreover, the hybrid complexes are very stable and readily form at low nanomolar concentration. However, enhancements in PNA sequence selectivity are needed to achieve a most selective binding in cells. Improvement in the selectivity of complementary PNAs is straightforward and primarily



100

J. Amato

[13]

[14]

[15]

[16] [17] [18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

D.A. Driver, R.H. Berg, S.K. Kim, B. Norden, P.E. Nielsen, PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen-bonding rules, Nature, Volume 365, (Issue 6446), October 1993, Pages 566-568. D. Jakimov, D. Cetojevic-Simin, V. Kojic, J. Mrdanovic, Peptide Nucleic Acid (PNA) - more than anyone could imagine at the first sight, Archive of Oncology, Volume 8, (Issue 1), January 2000, Pages 11-14. B. Datta, M.E. Bier, S. Roy, B.A. Armitage, Quadruplex formation by a guanine-rich PNA oligomer, Journal of the American Chemical Society, Volume 127, (Issue 12), March 2005, Pages 4199-4207. V.L. Marin, B.A. Armitage, Hybridization of complementary and homologous peptide nucleic acid oligomers to a guanine quadruplex-forming RNA, Biochemistry, Volume 45, (Issue 6), February 2006, Pages 1745-1754. B. Datta, C. Schmitt, B.A. Armitage, Formation of a PNA2−DNA2 hybrid quadruplex, Journal of the American Chemical Society, Volume 125, (Issue 14), April 2003, Pages 4111–4118. J.R. Williamson, M.K. Raghuraman, T.R. Cech, Monovalent cation-induced structure of telomeric DNA: the G-quartet model, Cell, Volume 59, (Issue 5), December 1989, Pages 871-880. S. Lusvarghi, C.T. Murphy, S. Roy, F.A. Tanious, I. Sacui, W.D. Wilson, D.H. Ly, B.A. Armitage, Loop and backbone modifications of PNA improve G-quadruplex binding selectivity, Journal of the American Chemical Society, Volume 131, (Issue 51), December 2009, Pages 18415–18424. I.V. Smolina, V.V. Demidov, V.A. Soldatenkov, S.G Chasovskikh, M.D. Frank-Kamenetskii, End invasion of peptide nucleic acids (PNAs) with mixed-base composition into linear DNA duplexes, Nucleic Acids Research, Volume 33, (Issue 17), October 2005, Pages e146. F. Totsingan, S. Rossi, R. Corradini, T. Tedeschi, S. Sforza, A. Juris, E. Scaravelli, R. Marchelli, Label-free selective DNA detection with high mismatch recognition by PNA beacons and ion exchange HPLC, Organic and Biomolecular Chemistry, Volume 6, (Issue 7), April 2008, Pages 1232-1237. N. Rufer, W. Dragowska, G. Thornbury, E. Roosnek, P.M. Lansdorp, Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry, Nature Biotechnology, Volume 16, (Issue 8), August 1998, Pages 743747. J. Feng, W.D. Funk, S.S. Wang, S.L. Weinrich, A.A. Avilion, C.P. Chiu, R.R. Adams, E. Chang, R.C. Allsopp, J.H. Yu, et al., The RNA component of human telomerase, Science, Volume 269, September 1995, Pages 1236–1241. S.E. Hamilton, A.E. Pitts, R.R. Katipally, X. Jia, J.P. Rutter, B.A. Davies, J.W. Shay, W.E. Wright, D.R. Corey, Identification of determinants for inhibitor binding within the RNA active site of human telomerase using PNA scanning, Biochemistry, Volume 36, (Issue 39), September 1997, Pages 11873-11880. A.E. Pitts, D.R. Corey, Inhibition of human telomerase by 2'-Omethyl-RNA, Proceedings of the National Academy of Sciences USA, Volume 95, (Issue 20), September 1998, Pages 1154911554. J.G. Harrison, C. Frier, R. Laurant, R. Dennis, K.D. Raney, S. Balasubramanian, Inhibition of human telomerase by PNAcationic peptide conjugates, Bioorganic and Medicinal Chemistry Letters, Volume 9, (Issue 9), May 1999, Pages 1273-1278. S.E. Hamilton, C.G. Simmons, I.S. Kathiriya, D.R. Corey, Cellular delivery of peptide nucleic acids and inhibition of human telomerase, Chemical Biology, Volume 6, (Issue 6), June 1999, Pages 343-351. R. Villa, M. Folini, S. Lualdi, S. Veronese, M.G. Daidone, N. Zaffaroni, Inhibition of telomerase activity by a cell-penetrating peptide nucleic acid construct in human melanoma cells, FEBS Letters, Volume 473,(Issue 2), May 2000, Pages 241-248. V.V. Demidov, E. Protozanova, K.I. Izvolsky, C. Price, P.E. Nielsen, M.D. Frank-Kamenetskii, Kinetics and mechanism of the DNA double helix invasion by pseudocomplementary peptide nucleic acids, Proceedings of the National Academy of Sciences USA, Volume 99, (Issue 9), April 2002, Pages 5953-5958. P.E. Nielsen, M. Egholm, O. Buchardt, Evidence for


[30]

[31]

[32] [33] [34]

[35]

[36]

[37] [38]

[39]

[40]

(PNA)2/DNA triplex structure upon binding of PNA to dsDNA by strand displacement, Journal Molecular Recognition, Volume 7, (Issue 3), September 1994, Pages 165-70. J.A. Kelly, J. Feigon, T.O. Yeates, Reconciliation of the X-ray and NMR structures of the thrombin-binding aptamer d(GGTTGGTGTGGTTGG), Journal Molecular Biology, Volume 256, (Issue 3), March 1996, Pages 417-422. J.J. Green, L. Ying, D. Klenerman, S. Balasubramanian, Kinetics of unfolding the human telomeric DNA quadruplex using a PNA trap, Journal of American Chemical Society, Volume 125, (Issue 13), April 2003, Pages 3763-3767. A. Ramos, D. Hollingworth, A. Pastore, G-quartet-dependent recognition between the FMRP RGG box and RNA, RNA, Volume 9, (Issue 10), October 2003, Pages 1198-1207. B.A. Armitage, The impact of nucleic acid secondary structure on PNA hybridization, Drug Discovery Today, Volume 8, (Issue 5), March 2003, Pages 222-228. J. Amato, B. Pagano, N. Borbone, G. Oliviero, V. Gabelica, De Pauw E., S. D'Errico, V. Piccialli, M. Varra, C. Giancola, G. Piccialli, L. Mayol, Targeting G-quadruplex structure in the human c-Kit promoter with short PNA sequences, Bioconjugate Chemistry, Volume 22,(Issue 4), April 2011, Pages 654-663. S. Roy, F.A. Tanious, W.D. Wilson, D.H. Ly, B.A. Armitage, High-affinity homologous peptide nucleic acid probes for targeting a quadruplex-forming sequence from a MYC promoter element, Biochemistry, Volume 46, (Issue 37), September 2007, Pages 10433-10443. L. Petraccone, B. Pagano, V. Esposito, A. Randazzo, G. Piccialli, G. Barone, C.A. Mattia, C. Giancola, Thermodynamics and Kinetics of PNA-DNA Quadruplex-Forming Chimeras, Journal of American Chemical Society, Volume 127, (Issue 46), November 2005, Pages 16215-16223. Y. Krishnan-Ghosh, E. Stephens, S. Balasubramanian, A PNA4 quadruplex, Journal of American Chemical Society, Volume 126, (Issue 119), May 2004, Pages 5944-5945. S. Saha, J. Cai, D. Eiler, A.D. Hamilton, Programming the formation of DNA and PNA quadruplexes by pi-pi-stacking interactions, Chemical Communication, Volume 46, (Issue 10), March 2010, Pages 1685-1687. M.I. Onyshchenko, T.I. Gaynutdinov, E.A. Englund, D.H. Appella, R.D. Neumann, I.G. Panyutin, Stabilization of Gquadruplex in the BCL2 promoter region in double-stranded DNA by invading short PNAs, Nucleic Acids Research, Volume 37, (Issue 22), December 2009, Pages 7570-7580. S. Roy, K.J. Zanotti, C.T. Murphy, F.A. Tanious, W.D. Wilson, D.H. Ly, B.A. Armitage, Kinetic discrimination in recognition of DNA quadruplex targets by guanine-rich heteroquadruplexforming PNA probes, Chemical Communication, Volume 47, (Issue 30), August 2011, Pages 8524-8526.

Authors’ information Dipartimento di Chimica delle Sostanze Naturali, Università degli Studi di Napoli “Federico II”, via D. Montesano 49, 80131, Napoli, Italy. Tel.: +39 081678550; Fax: +39 081678552. E-mail: [email protected] Jussara Amato graduated in Pharmaceutical Chemistry in 2003 and received her PhD degree in Molecular Biotechnology in 2007 at the University of Naples “Federico II”, Italy (supervisor Prof. Gennaro Piccialli). Her main research interests include the chemical synthesis of DNA and PNA molecules and the structural characterization of their complexes by CD, NMR and MS. During her post-doc she also has been a guest scientist in the Mass Spectrometry group at the University of Liége (Belgium), where she worked on the applications of MS to the study of DNA assemblies (duplexes and quadruplexes) under the supervision of Dr. Valerie Gabelica. Dr. Jussara Amato has published more than 25 articles in the subject of nucleic acids chemistry, mainly focused on Gquadruplex structure investigation.


101

International Review of Biophysical Chemistry (IREBIC) Aims and scope The International Review of Biophysical Chemistry (IRe.Bi.C.) is a peer-reviewed journal that publishes original theoretical and applied papers on all physicochemical aspects of Biomolecules and Biological Systems. The scope of the Journal encompasses, but is not restricted to the following areas: quantitative analysis of the properties of biological macromolecules, macromolecular assemblies and cell components in terms of kinetics, thermodynamics, NMR, X-ray structural biology, single-molecule detection, fluorescence methods, advanced in vivo fluorescence microscopy; physical chemistry of native and engineered proteins, of natural and synthetic oligonucleotides, polysaccharides and phospholipids of biological and pharmaceutical interest; bioenergetics; molecular docking and dynamics simulation, protein structure prediction; physicochemical aspects in bio-nanotechnology. The Editorial policy is to maintain a reasonable balance between papers regarding different research areas so that the Journal will be useful to all interested scientific groups. The journal publishes invited tutorials or critical reviews; original scientific research papers (regular papers), letters to the Editor and research notes which should also be original presenting proposals for a new research, reporting on research in progress or discussing the latest scientific results in advanced fields; short communications and discussions, book reviews, reports from meetings and special issues describing research on all of physicochemical aspects of Biomolecules and Biological Systems.

Instructions for submitting a paper Contributions may consist of invited tutorials or critical reviews; original scientific research papers (regular paper); letters to the Editor and research notes which should also be original presenting proposals for a new research, reporting on research in progress or discussing the latest scientific results in advanced fields. All papers will be subjected to a fast editorial process. Any paper will be published within two months from the submitted date, if it has been accepted. Papers must be correctly formatted, in order to be published. Formatting instructions can be found in the last pages of the Review. An Author guidelines template file can be found at the following web address: www.praiseworthyprize.com/Template_of_IREBIC.doc Manuscripts should be sent via e-mail as attachment in .doc and .pdf formats to: [email protected] The regular paper page length limit is defined at 15 formatted Review pages, including illustrations, references and author(s) biographies. Pages 16 and above are charged 10 euros per page and payment is a prerequisite for publication.

Subscription rates: on Cd-Rom, per year: Institutional: Individual: Individual Article: *

263* (euros) 263* (euros) 30 (euros)

Print copy, per year: 263** (euros) 263** (euros) 40** (euros)

To be downloaded Shipment costs to be charged

**

Abstracting and Indexing Information: Academic Search Complete - EBSCO Information Services Cambridge Scientific Abstracts - CSA/CIG Copernicus Autorizzazione del Tribunale di Napoli n. 30 del 12/04/2010

2038-0321(201106)2:3;1-V Copyright © 2011 Praise Worthy Prize S.r.l. - All rights reserved