Blood Pressure in Patients with Primary Aldosteronism Is Influenced

0013-7227/02/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 87(7):3337–3343 Copyright © 2002 by The Endocrine Society

Blood Pressure in Patients with Primary Aldosteronism Is Influenced by Bradykinin B2 Receptor and ␣-Adducin Gene Polymorphisms PAOLO MULATERO, TRACY A. WILLIAMS, ALBERTO MILAN, CRISTINA PAGLIERI, FRANCO RABBIA, FRANCESCO FALLO, AND FRANCO VEGLIO Department of Medicine and Experimental Oncology (P.M., T.A.W., A.M., C.P., F.R., F.V.), Hypertension Unit, University of Torino, 10133 Torino, Italy; and Department of Medical and Surgical Sciences (F.F.), Division of Endocrinology, University of Padova, 35121 Padova, Italy Primary aldosteronism (PA) is the most common cause of endocrine hypertension. PA is most frequently presented as moderate to severe hypertension, but the clinical and biochemical features vary widely. The aim of our study was to identify genetic variants that influence the phenotype of patients with PA. We hypothesized that genetic variants potentially affecting aldosterone production (aldosterone synthase, CYP11B2), renal proximal tubule reabsorption (␣-adducin), or the mechanisms of counterbalance leading to vasodilatation and sodium excretion (bradykinin B2-receptor, B2R) could influence the clinical and biochemical characteristics of patients with PA. We studied three polymorphisms of these genes (C-344T of CYP11B2, G460W of ␣-adducin, and C-58T of B2R) in 167 primary aldosteronism patients (56 with aldoste-

P

RIMARY ALDOSTERONISM (PA) is the most common cause of endocrine hypertension. It is widely believed to occur in 1–2% of hypertensive patients, although increasing evidence indicates a considerably higher frequency (7– 8%) (1). PA is predominantly caused by either adrenocortical aldosterone-producing adenomas (APAs) or idiopathic hyperaldosteronism (IHA) associated with bilateral adrenal hyperplasia. A rare genetic form of PA is glucocorticoid remediable aldosteronism (GRA), which is caused by the presence of a chimeric 11␤-hydroxylase (CYP11B1)/aldosterone synthase (CYP11B2) gene (2); another genetic form also exists, familial hyperaldosteronism type II, that maps to chromosome 7 (7p22), but its molecular basis remains unknown (3). CYP11B2 activity is required for normal aldosterone secretion. This enzyme exhibits the steroid 11␤-hydroxylase, 18-hydroxylase, and 18-oxidase activities that are required to catalyze the synthesis of aldosterone from 11-deoxycorticosterone (4, 5). We recently described an association between one haplotype of the CYP11B2 gene and the susceptibility to Abbreviations: APA, Aldosterone-producing adenoma; BK, bradykinin; BMI, body mass index; B2R, bradykinin B2 receptor; CYP11B2, aldosterone synthase; DBP, diastolic blood pressure; DBPbas, basal diastolic blood pressure; EH, essential hypertension; GRA, glucocorticoid remediable aldosteronism; IHA, idiopathic hyperaldosteronism; K⫹, plasma potassium; KKS, kallikrein-kinin system; MHS, Milan hypertensive strain of rat; PA, primary aldosteronism; PRA, plasma renin activity; sAldo, supine plasma aldosterone; SBP, systolic blood pressure; SBPbas, basal systolic blood pressure; sPRA, supine plasma renin activity; upAldo, upright plasma aldosterone; upPRA, upright plasma renin activity.

rone-producing adenoma and 111 with idiopathic hyperaldosteronism). B2R and ␣-adducin genotypes were strong independent predictors of both systolic and diastolic blood pressure levels; plasma renin activity and aldosterone also play a marginal role on BP levels. Body mass index, age, sex, and CYP11B2 genotype displayed no significant effect on the clinical parameters of our population. In particular, ␣-adducin and B2R polymorphisms accounted for 13.2% and 11.0% of the systolic and diastolic blood pressure variance, respectively. These data suggest that genetic variants of ␣-adducin and the bradykinin B2-R influence the blood pressure levels in patients with primary aldosteronism. (J Clin Endocrinol Metab 87: 3337–3343, 2002)

develop IHA (6). Polymorphisms of the same gene have been described in association with hypertension and aldosterone secretion in different populations (7–10). In particular, a C-344T polymorphism of the CYP11B2 gene promoter located in the putative-binding site for the transcription factor steroidogenic factor-1 has been postulated to alter the transcription rate of the gene (11) and is associated with increased aldosterone levels in essential hypertension (EH) (9). ␣-Adducin is a cytoskeleton protein involved in cell membrane ion transport and signal transduction (12, 13). Studies on the Milan hypertensive (MHS) rat have demonstrated that 50% of their higher blood pressure is due to variants of the ␣-adducin gene. Further, the expression of MHS adducin in rat renal epithelial cells results in significantly greater sodium pump activity and a larger number of pumps expressed at the cell surface (12, 14). In humans, genetic variants of the ␣-adducin gene have been found more frequently in hypertensive than normotensive subjects (15). A functional point mutation in the ␣-adducin coding region (G460W) is associated with essential hypertension in Italian and French populations (16), although not in other populations (17). Hypertensive patients carrying the 460W allele display lower plasma renin and significantly greater falls in blood pressure with sodium restriction or diuretic treatment (16). These findings suggest that ␣-adducin variants could affect blood pressure by changes in renal sodium handling (18). The kallikrein-kinin system (KKS) is implicated in blood pressure regulation via the action of bradykinin (BK) as a

3337

3338

Mulatero et al. • B2R and ␣-Adducin Gene Polymorphisms in PA

J Clin Endocrinol Metab, July 2002, 87(7):3337–3343

potent vasoactive peptide (19). BK infusion results in the dilation of arterial vessels and a fall in the total peripheral vascular resistance and blood pressure. In the kidney, BK promotes water and sodium excretion (20). The known cardiovascular actions of BK are mediated by the BK B2 receptor (B2R) (19): Transgenic mice overexpressing human B2R show a significant reduction in blood pressure, and further, the administration of a specific B2R antagonist, Hoe 140, restores the blood pressure to normal levels (21). Additionally, mutant mice lacking B2Rs display a moderate increase in the basal blood pressure; however, under dietary sodium excess, they exhibit severe hypertension and end-organ damage (22, 23). A polymorphism at position ⫺58 of the B2R promoter has been described, C-58T, where the ⫺58C allele results in a decrease in the rate of gene transcription (24). In addition, the ⫺58C variant is associated with hypertension in African Americans (25), a population with a high prevalence of saltsensitive hypertension (26). PA is most frequently presented as moderate to severe hypertension; however, the clinical and biochemical features vary widely, and PA patients who are normotensive have even been described (27, 28). Aldosterone secretion leads to sodium and fluid retention; in fact, patients with PA display a greater plasma volume for any level of peripheral resistance than patients with essential hypertension, at least in the early phases of the disease (29). The aim of our study was to identify genetic variants that influence the blood pressure levels in patients with PA. We hypothesized that genetic variants that could affect aldosterone production (CYP11B2), renal proximal tubule reabsorption (␣-adducin), or the mechanisms of counterbalance that lead to vasodilation and sodium excretion (B2R) could affect the clinical and biochemical characteristics of patients with PA. Patients and Methods Patients This study was approved by a local ethics review committee, and all subjects gave informed consent. A total of 167 patients (101 males and 66 females) with PA referred to our center since 1994 were included in this study. All were hypertensive and PA had been diagnosed as described previously (30). Briefly, patients with a plasma aldosterone (nanograms per deciliter)/plasma renin activity (PRA) (nanograms per milliliter per hour) ratio greater than 50 underwent saline infusion (0.9% NaCl 500 ml/h for 4 h) as a confirmatory test. Patients with plasma aldosterone levels that failed to fall below 5 ng/dl after the saline infusion were diagnosed with PA (31, 32). All patients underwent a computed tomography scan as well as adrenal venous sampling for the

differential diagnosis of APA and IHA; for adrenal venous sampling, we followed the criteria suggested by Young et al. (33). In all patients, GRA was excluded using a long-PCR technique as described previously (34). Basal blood pressure values were measured on at least five different occasions during the wash-out period from previous drugs, and the average reading was calculated. The wash-out period was for at least 3 wk for all the patients. All measurements were performed according to the World Health Organization–International Society of Hypertension recommendations (35). In particular, blood pressure was recorded between 0800 h and 1000 h after the patients had been sitting in a comfortable position in a quiet room for at least 15 min.

Genotype analyses Blood samples were withdrawn into EDTA-containing receptacles, and DNA was extracted as described elsewhere (6). The B2R C-58T, the ␣-adducin G460W, and the aldosterone synthase T-344C polymorphisms were identified by PCR amplification and digestion with the appropriate restriction endonuclease as shown in Table 1. The B2R polymorphism studied here is characterized by the substitution of a thymine for cytosine at nucleotide position ⫺58 in the promoter (24). We developed a novel method for the detection of this polymorphism: Because the C-58T substitution does not alter a recognition sequence for a restriction enzyme, we introduced a partial recognition site for MaeIII by the introduction of a single mismatched base in the sense primer for PCR amplification (Table 1, underlined). The MaeIII site is then completed in the presence of the ⫺58C allele. PCR contained 100 ng genomic DNA, 10 pmol of each primer (Table 1), 15 mmol/liter Tris-HCl (pH 8.0), 50 mmol/liter KCl, 1.5 mmol/liter MgCl2, 250 ␮mol/liter of each deoxynucleotide triphosphate, and 1 U AmpliTaq Gold polymerase (Applied Biosystems, Foster City, CA) in a final volume of 20 ␮l. The cycling conditions are shown in Table 1. PCR products (10 ␮l) were then incubated with MaeIII (1 U, Roche Diagnostics, Indianapolis, IN) at 55 C for 2 h. Digested products were resolved on 3.5% MetaPhor agarose (BioWhittaker, Inc. Molecular Applications, Rockland, ME) gels (Fig. 1). The ␣-adducin G460W polymorphism is characterized by the substitution of guanine by thymine at nucleotide position 614 of exon 10 (16), resulting in the substitution glycine by tryptophan at amino acid position 460. The G460W polymorphism was evaluated by a method we modified from Clark et al. (17) using different primers and PCR conditions. A partial site for BsaMI digestion was introduced by a mismatched base in the antisense primer for PCR amplification (Table 1, underlined). The BsaMI site is then completed in the presence of the T (W) allele. PCR mixes were as described for the B2R polymorphism except that a final concentration of 5% dimethyl sulfoxide was included. PCR products (10 ␮l) were incubated with BsaMI (3 U, Promega Corp. Madison, WI)) at 65 C for 2 h, and digested products were resolved on 3.5% MetaPhor agarose gels (Fig. 1). The aldosterone synthase (CYP11B2) T-344C polymorphism was determined by PCR amplification followed by HaeIII digestion in which PCR products are digested in the presence of the C allele. PCR mixes were as described for the B2R polymorphism, and cycling conditions are shown in Table 1. PCR products (10 ␮l) were incubated with HaeIII (5 U, New England Biolabs, Inc., Beverly, MA) at 37 C for 2 h, and digested

TABLE 1. Genotyping BK B2 receptor, ␣-adducin, and aldosterone synthase polymorphisms Primer

BK B2 receptora Sense Antisense ␣-Adducina Sense Antisense Aldosterone synthaseb Sense Antisense

Sequence (5⬘ ↓ 3⬘)

PCR product (bp)

Restriction enzyme

Digested fragments (bp)

GCCCAGGAGGCTGATGACGTCA TCACCACCGTCCCCACCC

110

MaeIII

92 ⫹ 18

CCCCACTCAGACACAGTTTTC TGGGACTGCTTCCATTCTGGC

108

BsaMI

90 ⫹ 18

CAGGGGGTACGTGGACATTT CAGGGCTGAGAGGAGTAAAA

151

HaeIII

95 ⫹ 56

The PCR cycling conditions were: a 95 C 7 min; 35 ⫻ (94 C 20 sec, 55 C 20 sec, 72 C 20 sec), 72 C 10 min. b 95 C 7 min; 35 ⫻ (94 C 30 sec, 52 C 30 sec, 72 C 30 sec), 72 C 10 min.


J Clin Endocrinol Metab, July 2002, 87(7):3337–3343 3339

FIG. 1. Genetic analysis of polymorphisms in B2R, adducin, and CYP11B2 genes. PCRs were performed for each polymorphism as described in Patients and Methods and Table 1. PCR products were digested with MaeIII for B2R, BsaMI for ␣-adducin, and HaeIII for CYP11B2 and separated on 3.5% (B2R and adducin) or 3% (CYP11B2) MetaPhor agarose gels as described in Patients and Methods. The genotype corresponding to each restriction pattern is indicated at the top of each gel and the numbers on the left show the size of the DNA fragments in base pairs. The lower band in each sample for the CYP11B2 genotypes is unused PCR primers and is also present in control samples without AmpliTaq polymerase. TABLE 2. Clinical parameters of PA patients divided into APA and IHA

No. of patients K⫹ (mEq/liter) sPRA (ng/liter䡠sec) upPRA (ng/liter䡠sec) sAldo (pmol/liter) upAldo (pmol/liter) SBPbas (mm Hg) DBPbas (mm Hg) BMI (kg/m2) Age (yr) a

APA

IHA

All patients

Pa

56 3.69 ⫾ 0.7 0.041 ⫾ 0.03 0.063 ⫾ 0.05 932 ⫾ 377 1123 ⫾ 405 178 ⫾ 21 106 ⫾ 9 26 ⫾ 3 54.9 ⫾ 8.1

111 4.07 ⫾ 0.4 0.050 ⫾ 0.03 0.083 ⫾ 0.05 655 ⫾ 275 993 ⫾ 427 176 ⫾ 20 105 ⫾ 9 26.2 ⫾ 2.7 57.1 ⫾ 7.6

167 3.94 ⫾ 0.5 0.047 ⫾ 0.03 0.075 ⫾ 0.05 746 ⫾ 338 1037 ⫾ 422 177 ⫾ 20 106 ⫾ 9 26.1 ⫾ 2.9 54.3 ⫾ 7.8

⬍0.0001 0.001 0.026 0.004 0.65 0.63 0.84 0.24 0.60

Values were calculated by a t test and refer to differences between APA and IHA parameters.

products were resolved on 3% MetaPhor agarose (BioWhittaker, Inc.) gels (Fig. 1). For the B2R and CYP11B2 polymorphisms, two patients for each genotype were selected on the basis of the restriction digestion patterns described above. A PCR (50 ␮l final volume) was performed for each genotype, purified using a High Pure PCR product purification kit (Roche Diagnostics, Indianapolis, IN), according to the manufacturer’s instructions, and an aliquot (1/100) of the purified PCR product was used for direct sequencing. Sequencing was performed on an ABI PRISM 377 DNA sequencer using an ABI PRISM BigDye terminator cycle sequencing reaction kit with AmpliTaq DNA polymerase FS (Perkin Elmer Corp., Foster City, CA). Sequencing data were analyzed by the Sequencing Analysis 3.0 computer program (Perkin Elmer Corp.). In each case the genotype predicted from the restriction enzyme digestion analysis was confirmed by sequencing. These samples then served as control samples for subsequent analyses. For the ␣-adducin genotyping, control samples of genomic DNA for each genotype were provided by Prof. Nicola Glorioso (University of Sassari, Italy). All genotyping was performed by a researcher who had no knowledge of the clinical parameters.

Statistical analyses Continuous data were expressed as means ⫾ sd according to genotype. A t test was performed to compare parameters between APA and IHA groups. A chi-square test was used to assess the fit of the observed allele frequencies to the Hardy-Weinberg distribution. The differences between the variables in the different genotype groups were tested by ANOVA using Bonferroni’s corrections for multiple comparisons. Data analysis was performed before and after adjustments for age, sex, and body mass index (BMI). We also performed a Pearson moment product correlation analysis between clinical [systolic blood pressure (SBP) and diastolic blood pressure (DBP)] and hormonal [supine plasma renin activity (sPRA), upright plasma renin activity (upPRA), supine plasma aldosterone (sAldo), and upright plasma aldosterone (upAldo)] parameters. A stepwise multiple regression analysis was used to assess the quantitative effect of age, sex, BMI, sPRA, sAldo, and different genotype (␣-adducin, B2R, CYP11B2) on clinical variables (SBP and DBP). ␣-

Adducin, B2R, CYP11B2, and sex were considered as dummy variables in the model. The ␣ level for entry and removal of terms at each forward step was 0.15. The SAS V8 program (SAS Institute, Cary, North Carolina) was used for all statistical analyses.

Results

The clinical and hormonal parameters of the patients are summarized in Table 2. Plasma potassium (K⫹) and both sPRA and upPRA were lower in patients with APA, compared with IHA (P ⬍ 0.001, P ⫽ 0.001, and P ⫽ 0.026, respectively); sAldo but not upAldo was higher in the APA group, compared with IHA (P ⬍ 0.004). Basal systolic and diastolic blood pressure (SBPbas and DBPbas, respectively), BMI, and age were not different between the two subgroups of PA. In correlation analysis, SBP was associated with sAldo (r2 ⫽ 0.03; P ⫽ 0.01) and upAldo (r2 ⫽ 0.05; P ⫽ 0.002) levels. Similarly, DBP was related with upAldo (r2 ⫽ 0.025; P ⫽ 0.04) but not with sAldo (r2 ⫽ 0.02; P ⫽ 0.09). Each group of genotypes was in Hardy-Weinberg equilibrium for each polymorphism. B2R

There were no significant differences in the K⫹, sPRA, upPRA, sAldo, and upAldo measurements when the patients were classified according to the patient’s genotype for the B2R C-58T polymorphism (Table 3). Similarly, no differences were observed for these parameters when APA and IHA patients were analyzed separately (data not shown). In contrast, in the general group of PA patients, SBPbas and DBPbas were significantly lower in patients with the TT


CT

75 3.88 ⫾ 0.6 56.1 ⫾ 8.1 26.2 ⫾ 2.7 0.047 ⫾ 0.03 0.075 ⫾ 0.05 716 ⫾ 305 987 ⫾ 383 177.3 ⫾ 19.7 105.1 ⫾ 8.4 177.35 ⫾ 2.3 105.14 ⫾ 1.06 29 4.04 ⫾ 0.4 54.9 ⫾ 9.3 25.8 ⫾ 3.5 0.041 ⫾ 0.03 0.058 ⫾ 0.05 824 ⫾ 430 1184 ⫾ 535 180.7 ⫾ 20.8 106.6 ⫾ 11.3 180.29 ⫾ 3.74 106.25 ⫾ 1.73

63 3.96 ⫾ 0.5 57.3 ⫾ 6.6 26.1 ⫾ 2.7 0.05 ⫾ 0.03 0.086 ⫾ 0.05 749 ⫾ 324 1024 ⫾ 402 174.2 ⫾ 19.4 105.8 ⫾ 8.9 174.45 ⫾ 2.52 105.97 ⫾ 1.16

genotype, compared with patients with the CC and the CT genotypes (P ⱕ 0.01). These results were confirmed after adjustment of the parameters for age, sex, and BMI (Fig. 2). In the IHA subgroup, SBPbas was significantly lower in the TT group, compared with the CC group (P ⫽ 0.02), and DBPbas was significantly lower in the TT group, compared with the CC and CT groups (P ⫽ 0.01) before and after adjustment for age, sex, and BMI (Fig. 2). In the APA subgroup, the SBPbas and DBPbas were not significantly different among the three genotypes (Fig. 2), before and after adjustment. ␣-Adducin

SBPadj and DBPadj are blood pressure values after adjustment for age, sex, and BMI.

7 3.78 ⫾ 0.5 51.7 ⫾ 7.8 25.8 ⫾ 1.9 0.036 ⫾ 0.01 0.036 ⫾ 0.03 901 ⫾ 449 1223 ⫾ 496 197.4 ⫾ 27.8 115.8 ⫾ 10.1 196.56 ⫾ 7.34 115.21 ⫾ 3.4 43 3.86 ⫾ 0.5 57.0 ⫾ 8 26.5 ⫾ 2.9 0.047 ⫾ 0.05 0.077 ⫾ 0.08 779 ⫾ 330 1040 ⫾ 391 182.6 ⫾ 19.2 107.4 ⫾ 10.1 182.58 ⫾ 2.94 107.54 ⫾ 1.3 117 3.98 ⫾ 0.5 56.4 ⫾ 7.8 25.9 ⫾ 2.8 0.047 ⫾ 0.03 0.077 ⫾ 0.05 727 ⫾ 333 1024 ⫾ 430 173.3 ⫾ 18.4 104.3 ⫾ 8.2 173.46 ⫾ 1.77 104.38 ⫾ 0.8 31 3.95 ⫾ 0.6 57.7 ⫾ 6.4 25.4 ⫾ 2.6 0.044 ⫾ 0.03 0.072 ⫾ 0.05 702 ⫾ 291 979 ⫾ 391 167.3 ⫾ 17.8 101 ⫾ 7.6 167.39 ⫾ 3.5 100.99 ⫾ 1.62 82 3.98 ⫾ 0.5 56.5 ⫾ 8.4 26.1 ⫾ 2.8 0.047 ⫾ 0.03 0.077 ⫾ 0.05 782 ⫾ 344 1043 ⫾ 413 177.6 ⫾ 20.9 106.4 ⫾ 9.2 177.81 ⫾ 2.15 106.5 ⫾ 0.99 54 3.89 ⫾ 0.5 55.5 ⫾ 7.6 26.4 ⫾ 3 0.047 ⫾ 0.03 0.072 ⫾ 0.05 718 ⫾ 352 1060 ⫾ 460 180.8 ⫾ 17.8 107.1 ⫾ 9.1 180.58 ⫾ 2.66 107.02 ⫾ 1.22 No. of patients K⫹ (mmol/liter) Age (yr) BMI (kg/m2) sPRA (ng/liter䡠sec) upPRA (ng/liter䡠sec) sAldo (pmol/liter) upAldo (pmol/liter) SBPbas (mm Hg) DBPbas (mm Hg) SBPadj (mm Hg) ⫾ SE DBPadj (mm Hg) ⫾ SE

CYP11B2

␣-Adducin

GW TT CT CC

B2 R

GG

WW

CC

TT


TABLE 3. Clinical and biochemical parameters of the patients according to B2R, ␣-adducin, and CYP11B2 genotypes

3340

There were no significant differences in the K⫹, sPRA, upPRA, sAldo, and upAldo measurements when the patients were classified according to the patient’s genotype for the ␣-adducin G460W polymorphism (Table 3). Similarly, no differences were observed when APA and IHA patients were analyzed separately (data not shown). However, in PA patients, the SBPbas and DBPbas were significantly higher in patients with the GW and WW genotypes, compared with the GG genotype (P ⱕ 0.002) (Fig. 2). When the PA patients were subdivided into APA and IHA groups, we did not find significant differences between genotypes in the APA group except for a SBPbas of the GW group, compared with the GG genotype (P ⫽ 0.02) (Fig. 2). In the IHA group, SBPbas and DBPbas were significantly different between the WW, compared with the GW and GG genotypes (P ⱕ 0.005), but not for GW, compared with the GG genotype, before and after adjustment (Fig. 2). Aldosterone synthase (CYP11B2)

In our population of PA patients, there were no significant differences between any of the measured clinical parameters when they were classified according to the patient’s genotype for the T-344C polymorphism of CYP11B2 before and after adjustment for the variables (Table 3). This was also the case when the PA patients were subdivided into IHA and APA (Fig. 2). Stepwise multiple regression analysis

Table 4 shows multiple regression analysis results: ␣adducin and B2R genotypes were the most important independent predictors of both SBP (␤ ⫽ 9.66 ⫾ 2.57, P ⫽ 0.0002 for ␣-adducin; ␤ ⫽ ⫺6.13 ⫾ 2.03 P ⫽ 0.0029 for B2R) and DBP (␤ ⫽ 4.1 ⫾ 1.19 P ⫽ 0.0007 for ␣-adducin, ␤ ⫽ ⫺2.71 ⫾ 0.94 P ⫽ 0.0047 for B2R) levels. Also, a small but significant effect on SBP and DBP levels were determined by sAldo (0.02 ⫾ 0.01; R2 ⫽ 0.02, P ⫽ 0.02 ), sPRA (⫺13.85 ⫾ 5.82; R2 ⫽ 0.029, P ⫽ 0.018), respectively. BMI, age, sex, and CYP11B2 gene variants were not entered in the model. Discussion

Studies on the pathophysiology and clinical management of PA have become more widespread since the demonstration that its occurrence is more frequent than previously accepted (1, 36). Although we have already described an association between a haplotype of the CYP11B2 gene and



FIG. 2. Blood pressure parameters of the patients. SBP (white columns) and DBP levels (gray columns) of the patients according to the genotypes of B2R, ␣-adducin, and CYP11B2. The patients are considered as the general PA population (All) and the two subgroups of APA and IHA. The blood pressure values indicated are obtained after adjustment for sex, age, and BMI. Bars indicate the SEM.

3342



TABLE 4. Linear regression analysis (Stepwise) Variable

SBP Step Step Step DBP Step Step Step

1 2 3 1 2 3

␤⫾

SE

Intercept 167.85 ⫾ 6.01 ␣-Adducin 9.66 ⫾ 2.57 B2R ⫺6.13 ⫾ 2.03 sAldo 0.02 ⫾ 0.01 Intercept 107.49 ⫾ 2.71 ␣-Adducin 4.1 ⫾ 1.19 B 2R ⫺2.71 ⫾ 0.94 sPRA ⫺13.85 ⫾ 5.82

Partial r2

Total r2

0.086 0.046 0.027

0.086 0.132 0.160

0.067 0.042 0.029

0.067 0.110 0.140

P

⬍.0001 0.0002 0.0029 0.0213 ⬍.0001 0.0007 0.0047 0.0186

We performed this analysis using SBP and DBP as dependent variables and using age, BMI, Sex, sPRA, sAldo, and genotype of ␣-adducin (GG ⫽ 1, GW ⫽ 2, WW ⫽ 3), B2R (CC ⫽ 1, CT ⫽ 2, TT ⫽ 3), and CYP11B2 (CC ⫽ 1, CT ⫽ 2, TT ⫽ 3) as independent variables.

the risk of developing IHA (6), little is known about the genetic influences on the susceptibility to develop PA. The clinical manifestations of PA vary from severe hypertension to normotension. It is reasonable to hypothesize that factors other than aldosterone hypersecretion could influence the clinical phenotype of PA. Because PA is a condition of increased sodium reabsorption, all components that play a physiological role in water and sodium homeostasis could potentially have an effect on the blood pressure levels of these patients. To investigate this possibility further, we evaluated the effect of genetic variants of ␣-adducin and the B2R on a range of clinical and biochemical features of PA; in addition, we analyzed the effect of an aldosterone synthase variant on the same range of parameters. In this study we show that a polymorphism in the B2R promoter (C-58T) is strongly associated with blood pressure levels in patients with PA. The ⫺58C allele of this polymorphism is associated with a decrease in the rate of gene transcription of a reporter gene transfected in human embryonic kidney cells, compared with those transfected with the T-58 allele (24). We can hypothesize that in patients with PA, the mechanisms that induce vasodilation and natriuresis, such as the KKS, may be activated: the presence of a decreased number of receptors could lead to a reduction of the physiological role of the KKS resulting in higher blood pressure levels. In other words, PA patients with higher blood pressure levels could have a reduction of the vasodilation and natriuresis induced by the increased BK production stimulated by hyperaldosteronism. This relative lack of effect of the BK could be mediated by the reduction in B2R transcription. The protective role of the KKS under conditions of increased aldosterone secretion has already been described in patients with GRA, in which families with increased kallikrein excretion display lower blood pressure levels (37). ␣-Adducin is a protein of the cytoskeleton involved in the function of the Na⫹/K⫹ pump in the kidney. MHS, a rat model of hypertension, displays a primary increase in renal tubular sodium reabsorption that is due to a functional point mutation within the gene coding for ␣-adducin (14, 38). Previous studies have shown that a mutation (Gly460Trp) in human ␣-adducin might be involved in sodium retention and an increase in blood pressure (16, 18). In this study we found a strong association of the W (Trp) variant with higher blood pressure levels in patients with PA. The role of the 460W mutation in PA could be to exaggerate further the

increased sodium reabsorption observed in this disease by stimulating the Na⫹/K⫹ pump. Finally, our results show that the CYP11B2 gene does not seem to play a major role in the determination of the clinical and the biochemical phenotypes in patients with PA. Other groups have found a relation between this polymorphism and aldosterone production. Our divergent findings could be explained in two ways. First, the influence of CYP11B2 polymorphisms could differ according with the population. Second, the effect of this polymorphism could be different under altered conditions of aldosterone secretion as in PA. In our population the aldosterone secretion is particularly high and unregulated. Therefore, we can hypothesize that a polymorphism located in the promoter region could influence aldosterone synthase transcription in normal or mildly altered conditions of aldosterone secretion but does not play a major role in conditions like PA in which the control of aldosterone production is impaired. After subdivision of the patients into the IHA and APA subgroups, it appears that the results are determined more by the IHA data than by the APA, both for the ␣-adducin and B2R gene polymorphisms. This is probably because of the lower number of patients in the second group (33.5% of the total). In fact, the trend of the BP values for the APA patients is very similar to that of the IHA. However, we cannot exclude a different effect of the two polymorphisms in the two subgroups of patients with PA. We also investigated the presence of epistatic interactions between the B2R and ␣-adducin genotypes. The protective association of B2R-TT/␣-adducin-GG display blood pressure levels significantly lower than the genotypes carrying at least one C and one W in the B2R and ␣-adducin genotypes, respectively. However, the significance of this comparison is not higher than that resulting from the single gene analysis. This could be due to the relatively small number of patients in the single subgroups resulting from the combination between the two genotypes or lack of an additive effect of these two genes on BP levels in patients with PA. The lack of statistical significance of the genetic analyses in the APA subgroup for both the B2R and adducin polymorphisms is probably due to the small number of patients when subdivided by genotype; alternatively, these genetic polymorphisms could play a less important role in APA, compared with IHA. Taken together, these data show a relevant role of variants of the ␣-adducin gene and B2R gene on the blood pressure levels in patients with PA. Only ␣-adducin and B2R polymorphisms, PRA, and aldosterone levels were independent predictors of blood pressure levels: BMI, age, sex, and CYP11B2 gene variants displayed no significant effect on the clinical parameters of our population. The role of PRA and aldosterone levels seems to be marginal, explaining, respectively, only 2.9% and 2.7% of DBP and SBP variance, whereas ␣-adducin and B2R polymorphisms were the strongest predictors of blood pressure levels, accounting for 13.2% and 11.0% of variance, respectively, of the SBP and the DBP. Our work highlights for the first time the role of genes involved in sodium homeostasis on the determination of blood


pressure levels of patients affected by a disorder of sodium and fluid reabsorption such as primary aldosteronism.


17.

Acknowledgments 18.

Received December 27, 2001. Accepted March 23, 2002. Address all correspondence and requests for reprints to: Dr. Paolo Mulatero, Department of Medicine and Experimental Oncology, Hypertension Unit, San Vito Hospital, Strada S. Vito 34, 10133 Torino, Italy. E-mail: [email protected]. P.M. and T.A.W. contributed equally to this study.

References 1. Stowasser M 2001 Primary aldosteronism: revival of a syndrome. J Hypertens 18:363–366 2. Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick S, Lalouel JM 1992 A chimaeric 11 beta-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension. Nature 355: 262–265 3. Lafferty AR, Torpy DJ, Stowasser M, Taymans SE, Lin JP, Huggard P, Gordon RD, Stratakis CA 2000 A novel genetic locus for low renin hypertension: familial hyperaldosteronism type II maps to chromosome 7 (7p22). J Med Genet 37:831– 835 4. Kawamoto T, Mitsuuchi Y, Toda K, Yokoyama Y, Miyahara K, Miura S, Ohnishi T, Ichikawa Y, Nakao K, Imura H, Ulick S, Shizuta Y 1992 Role of steroid 11␤-hydroxylase and steroid 18-hydroxylase in the biosynthesis of glucocorticoids and mineralocorticoids in humans. Proc Natl Acad Sci USA 89:1458 –1462 5. Curnow KM, Tusie-Luna MT, Pascoe L, Natarajan R, Gu JL, Nadler JL, White PC 1991 The product of the CYP11B2 gene is required for aldosterone biosynthesis in the human adrenal cortex. Mol Endocrinol 5:1513–1522 6. Mulatero P, Schiavone D, Fallo F, Rabbia F, Pilon C, Chiandussi L, Pascoe L, Veglio F 2000 CYP11B2 gene polymorphisms in idiopathic hyperaldosteronism. Hypertension 35:694 – 698 7. Brand E, Chatelain N, Mulatero P, Fery I, Curnow KM, Jeunemaitre X, Corvol P, Pascoe L, Soubrier F 1998 Structural analysis and evaluation of the aldosterone synthase gene in hypertension. Hypertension 32:198 –204 8. Davies E, Holloway CD, Ingram MC, Inglis GC, Friel EC, Morrison C, Anderson NH, Fraser R, Connell JM 1999 Aldosterone secretion rate and blood pressure in essential hypertension are related to polymorphic differences in aldosterone synthase gene CYP11B2. Hypertension 33:703–707 9. Pojoga L, Gautie S, Blanc H, Guyene TT, Poirier O, Cambien F, Benetos A 1998 Genetic determination of plasma aldosterone levels in essential hypertension. Am J Hypertens 11:856 – 860 10. Fardella CE, Rodriguez H, Hum DW, Mellon SH, Miller WL 1995 Artificial mutations in P450c11AS (aldosterone synthase) can increase enzymatic activity: a model for low-renin hypertension. J Clin Endocrinol Metab 80:1040 –1043 11. White PC, Slutsker L 1995 Haplotype analysis of CYP11B2. Endocr Res 21: 437– 442 12. Tripodi G, Valtorta F, Torielli L, Chiergatti E, Salardi S, Trusolino L, Menegon A, Ferrari P, Marchisio PC, Bianchi G 1996 Hypertension associated point mutations in the adducin ␣ and ␤ subunits affect actin cytoskeleton and ion transport. J Clin Invest 97:2815–2822 13. Mische SM, Mooseker MS, Morrow JS 1987 Erythrocyte adducin: a calmodulin-regulated actin-bundling protein that stimulates spectrin-actin binding. J Cell Biol 105:2837–2845 14. Bianchi G, Tripodi G, Casari G, Salardi S, Barber BR, Garcia P, Leoni P, Torielli L, Cusi D, Ferrandi M, Pinna LA, Baralle FE 1994 Two point mutations in the adducin genes are involved in blood pressure variation. Proc Natl Acad Sci USA 91:3999 – 4003 15. Casari G, Barlassina C, Cusi D, Zagati L, Muirhead R, Righetti M, Nembri P, Amar K, Gatti M, Macciardi F, Binelli G, Bianchi G 1995 Association of the ␣-adducin locus with essential hypertension. Hypertension 25:320 –326 16. Cusi D, Barlassina C, Azzani T, Casari G, Citterio L, Devoto M, Glorioso N, Lanzani C, Manunta P, Righetti M, Rivera R, Stella P, Troffa C, Zagato L,

19. 20. 21. 22.

23.

24.

25.

26. 27.

28.

29. 30.

31.

32. 33. 34.

35. 36.

37.

38.

Bianchi G 1997 Polymorphisms of ␣-adducin and salt sensitivity in patients with essential hypertension. Lancet 349:1353–1357 Clark CJ, Davies E, Anderson NH, Farmer R, Friel EC, Fraser R, Connell JMC 2000 ␣-adducin and angiotensin I-converting enzyme polymorphisms in essential hypertension. Hypertension 36:990 –994 Manunta P, Cusi D, Barlassina C, Righetti M, Lanzani C, D’Amico M, Buzzi L, Citterio L, Stella P, Rivera R, Bianchi G 1998 ␣-Adducin polymorphism and renal sodium handling in essential hypertensive patients. Kidney Int 53:1471– 1478 Regoli D, Barabe J 1980 Pharmacology of bradykinin and related kinins. Pharmacol Rev 32:1– 46 Mattson DL, Cowley Jr AW 1993 Kinin actions on renal papillary blood flow and sodium excretion. Hypertension 21:961–965 Wang DZ, Chao L, Chao J 1997 Hypotension in transgenic mice overexpressing human bradykinin B2 receptor. Hypertension 29:488 – 493 Madeddu P, Varoni MV, Palomba D, Emanueli C, Demontis MP, Glorioso N, Dessi-Fulgheri P, Sarzani R, Anania V 1997 Cardiovascular phenotype of a mouse strain with disruption of bradykinin B2-receptor gene. Circulation 96:3570 –3578 Alfie ME, Sigmon DH, Pomposiello SI, Carretero OA 1997 Effect of high salt intake in mutant mice lacking bradykinin-B2 receptors. Hypertension 29: 483– 487 Braun A, Kammerer S, Maier E, Bohme E, Roscher AA 1996 Polymorphisms in the gene for the human B2-bradykinin receptor: new tools assessing a genetic risk for bradykinin-associated diseases. Immunopharmacology 33:32–35 Gainer JV, Brown NJ, Bachvarova M, Bastien L, Maltais I, Marceau F, Bachvarov DR 2000 Altered frequency of a promoter polymorphism of the kinin B2 receptor gene in hypertensive African-Americans. Am J Hypertens 13: 1268 –1273 Grim CE, Robinson M 1996 Blood pressure variation in blacks: genetic factors. Semin Nephrol 16:83–93 Vantyghem MC, Ronci N, Provost F, Ghulam A, Lefebvre J, Jeunemaitre X, Tabarin A 1999 Aldosterone-producing adenoma without hypertension: a report of two cases. Eur J Endocrinol 141:279 –285 Fardella C, Mosso L, Gomez-Sanchez C, Cortes P, Soto J, Gomez L, Pinto M, Huete A, Oestreicher E, Foradori A, Montero J 2000 Primary hyperaldosteronism in essential hypertensives: prevalence, biochemical profile and molecular biology. J Clin Endocrinol Metab 85:1863–1867 Tarazi RC, Ibrahim MM, Bravo EL, Dustan HP 1973 Hemodynamic characteristics of primary aldosteronism. N Engl J Med 289:1330 –1335 Mulatero P, Veglio F, Pilon C, Rabbia F, Zocchi C, Limone P, Boscaro M, Sonino N, Fallo F 1998 Diagnosis of glucocorticoid-remediable aldosteronism in primary aldosteronism: aldosterone response to dexamethasone and long polymerase chain reaction for chimeric gene. J Clin Endocrinol Metab 83: 2573–2575 Holland OB, Brown H, Kuhnert L, Fairchild C, Risk M, Gomez-Sanchez CE 1984 Further evaluation of saline infusion for the diagnosis of primary aldosteronism. Hypertension 6:717–723 Moneva MH, Gomez-Sanchez CE 2001 Establishing a diagnosis of primary aldosteronism. Curr Opin Endocrinol Diabetes 8:124 –129 Young Jr WF, Stanson AW, Grant CS, Thompson GB, van Heerden J 1996 Primary aldosteronism: adrenal venous sampling. Surgery 120:913–919 Mulatero P, Curnow KM, Aupetit-Faisant B, Foekling M, Gomez-Sanchez C, Veglio F, Jeunemaitre X, Corvol P, Pascoe L 1998 Recombinant CYP11B genes encode enzymes which catalyse conversion of 11-deoxycortisol to cortisol, 18-hydroxycortisol and 18-oxocortisol. J Clin Endocrinol Metab 83:3996 – 4001 1999 World Health Organization-International Society of Hypertension Guidelines for the management of Hypertension. J Hypertens 17: 151–183 Lim PO, Rodgers P, Cardale K, Watson AD, MacDonald TM 1999 Potentially high prevalence of primary aldosteronism in a primary-care population. Lancet 35:40 Dluhy RG, Lifton RP 1995 Glucocorticoid-remediable aldosteronism (GRA): diagnosis, variability of phenotype and regulation of potassium homeostasis. Steroids 60:48 –51 Parenti P, Hanozet GM, Bianchi G 1986 Sodium and glucose transport across renal brush border membranes of Milan hypertensive rats. Hypertension 8:932–939