May 3, 2010 - In Kyrieleis et al study in adult, osteoporosis was observed in three of eight male and one of three female patients and there was no correlation ...
INTERNATIONAL JOURNAL Of ACADEMIC RESEARCH
Vol. 2. No. 3. May 2010
BONE MINERAL DENSITY MARKERS IN CHILDREN WITH STEROID SENSITIVE IDIOPATHIC NEPHROTIC SYNDROME M.G. Shouman1, Nagwa Abdallah I1, Abd El Meguid Ak 2, E.E.E. Salama 1, E. El Ghoroury 3, L.A. Abou Ismail 3, N.M. Emara 3 1
Department of Pediatrics, National Research Centre, 2 Department of Pediatrics, Cairo University, 3 .Department of Clinical Pathology, National Research Centre, Cairo (EGYPT) ABSTRACT Background: Glucocorticoids suppress bone formation, impair growth and induce obesity. Aim of the work: This study was performed to assess the bone mineral status among children with idiopathic nephrotic syndrome on steroid therapy. Patients and methods: The patients' age ranged from 4 to 16 years. They were 15 males and 15 females. Dual-energy X-ray absorptiometry (DXA) of the whole body, femur and spine was performed in 30 nephrotic children and 20 controls in addition to biochemical markers responsible for bone mineral density as calcium, phosphorus, magnesium, alkaline phosphatase, osteoprotegrin (OPG), osteocalcin, intact parathormone (iPTH) and the receptor activator of nuclear factor-kappaB ligand (RANKL), C-Terminal propeptide of type 1 collagen (CICP), urinary deoxypyridinoline (DPD) and vitamin D receptors. Results: The mean age at the onset of the disease was 4.61 ± 2.5 years. Five patients were suffering from hypocalcemia but three of them were suffering from bone ache. As compared with the controls, the patients had significantly higher levels of phosphorus, PTH, and Rankl; and significantly lower levels of DPD, procollagen, OPG, and osteocalcin. As regard bone mineral content of lumber spine, femur and whole body, there were no significant difference between patients and controls in spite lower adjusted (for age and sex) value in patients. As regard vitamin D receptors; Fok1 and Bsm1; no significant correlation was found between vitamin D receptors and bone mineral density. Conclusion: Steroid therapy could affect bone mineral status among children with steroid sensitive idiopathic nephrotic syndrome on steroid therapy. Biochemical markers were affected earlier than bone mineral density measured by DXA. Biochemical markers could be used as early markers of bone turnover in those patients. Key words: bone mineral, children with idiopathic nephrotic syndrome, biochemical markers, Glucocorticoids 1. INTRODUCTION Glucocorticoids (GCs) are widely used in various pediatric disorders including collagen vascular diseases as juvenile rheumatoid arthritis and systemic lupus erythematosus; and inflammatory bowel disease. Unfortunately, steroid sensitive nephrotic syndrome (SSNS) relapses in the majority of children when the GCs are reduced resulting in protracted, repeated courses of GCs (1). GC therapy in children is associated with multiple adverse side effects, including obesity, impaired linear growth, and increased fracture rates (2&3). Studies have consistently shown that GCs results in decreased bone formation because of decreased osteoclast differentiation and activity; and increased bone resorption because of increased osteoblast and osteocyte apoptosis (4,5,6&7). GCs promote osteoclastogenesis and inhibit osteoclast apoptosis; however, GCs also directly impair osteoclast adherence to bone and bone degradation, resulting in a state of low bone turnover (8&9). DXA was used in addition to biochemical markers to examine GC effects on bone and body composition in children with SSNS (10,11&12). Studies of GC effects on bone mineral content have produced conflicting results and thus this study aimed to evaluate bone mineral density and biochemical markers of bone metabolism in children with steroid sensitive idiopathic nephrotic syndrome on steroid therapy.
2. SUBJECTS AND METHODS The study was conducted on 30 nephrotic children attending pediatric nephrology clinic, Cairo University Specialized Children Hospital. The patients' age ranged from 4 to 16 years (mean 8.37 ± 2.9 years). They were 15 males and 15 females. All patients were subjected to full history taking and thorough clinical examination where patients fulfilling the diagnostic criteria of glucocorticoids sensitive nephrotic syndrome (defined by a negative urine-dipstick test within 8 weeks after the initiation of the prednisone treatment)(13) were eligible, provided they had received steroid therapy within 6 months before the study visit. Exclusion criteria included patients on immunosuppressive drugs other than glucocorticoids and those with renal impairment. Twenty healthy children attending the pediatric clinics were served as controls. Informed consent was obtained from the children and their parents and the study was approved by ethical committee of National Research Centre. Dual-energy X-ray absorptiometry scans (DXA) of the whole body, femur and lumber spines were performed in addition to assessment of biochemical markers responsible for bone mineral density and bone metabolism, and vitamin D receptors FOK1 and BSA. Dual-energy X-ray absorptiometry (Norland-XR-46 scanner,USA) was used to assess bone mineral content (BMC), and bone mineral density (BMD) of whole body, lumber spine (L1-L4 anteroposterior), and left hip (femoral head, trochanter and words triangle). Absolute values were converted to z-scores.
150
URL: www.ijar.lit.az
INTERNATIONAL JOURNAL Of ACADEMIC RESEARCH
Vol. 2. No. 3. May 2010
The biochemical markers included routine assessment of serum calcium (Ca), magnesium (Mg), phosphorus (P), and alkaline phosphatase (AP) using automated analyzer Olympus AU600 (Olympus Diagnostica GMBH, Japan). In addition to bone formation markers as osteoprotegrin (OPG) using host-ELISA technique (Biovendor Laboratory Medicine, Inc., Czech Republic), Cat. No RD 194003200. It is biotin labeled antibody based sandwich enzyme immunoassay for quantitative measures).; and osteocalcin (OC) using host-ELISA technique (Biosource, Europe, S.A); and bone resorption markers as intact parathormone (iPTH) using hPTH-EASIA kit, Biosource Europe S.A. Nivelles, Belgium; the receptor activator of nuclear factor-kappaB ligand (RANKL) using ELISA kit, Biomedica, Biomedica Medicine Product, GmbH and Co; C terminal propeptide of type 1 collagen (CICP) using METRA CICP EIA kit (QUIDEL corp.); and urinary deoxypyridinoline (DPD) by METRA DPD EIA kit (QUIDEL corp.). Vitamin D receptors (Fok1 and Bsm1 genotypes): Gene polymorphism was done and examined where the relationship between it and BMD. DNA was extracted by using spin column kit (supplied from Qiagen).A polymerase chain reaction (PCR) amplification and enzymatic digestion of the products with Bsm1 and Fok1. For the Bsm1 polymorphism, two milligrams of genomic DNA was amplified with each of forward primer 5”AAGACTACAAGTACCGCGTCAGTG and a reverse primer 5”AACCAGCGGGAAGAGGTCAAGGG (supplied by Biosynthesis). PCR was performed with a Biometra thermoblock, under standard conditions, for 35 cycles, and with 65Co as annealing temperature. After amplification, the PCR product (0.825 kb) was digested with restriction endonuclease BsmI and electrophoresed in a 1.2% agarose gel. With the enzyme Bsm1 ( Fermentas , Lithuania ), the respective genotypes were defined as B (indicating the absence of the restriction site) or b (indicating the presence of the restriction site).The PCR product for the Bsm1 polymorphism was 825bp, and the restriction fragments were 650bp and 175bp. For the Fok1 polymorphism, two milligrams of genomic DNA was amplified with each of forward primer 5”AGCTGGCCCTGGCACTGACTCTGGCTCT and a reverse primer 5”ATGGAAACACCTTGCTTCTTCTCCCTC products were digested with restriction enzyme BseGI (Fermentas, Lithuania), an isoschizomer of the FokI enzyme, at 55 C for 120 min. Fragments were electrophoresed through a 2% agarose gel containing ethidium bromide, visualized, and photographed. The presence of the FokI restriction site on both alleles (defined before as ff) generates 196- and 69-bp fragments, whereas the absence (FF) yields one undigested 265-bp fragment. Heterozygous Ff exhibits fragments of 265, 196, and 69 bp (14). Steroid Dosage: The glucocorticoid exposure was collected from follow up patient's record and summarized in terms of cumulative dose in milligrams, cumulative dose per weight, average dose (cumulative dose in milligrams per day), and average dose per weight (cumulative dose in milligrams per kilogram per day). Statistical methods: Data were expressed as mean ± standard deviation, range and percentage. Comparison of means between two different groups was performed using the non-paired student t-test and Mann-Whitney test. Comparison of descriptive data was performed using Chi-Square test. Correlations between variables were performed using the Spearman's rho correlation coefficient (r). P-value was considered significant if
