BRCA1 as a potential human prostate tumor suppressor - Nature

Oncogene (1998) 16, 3069 ± 3082  1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc

BRCA1 as a potential human prostate tumor suppressor: modulation of proliferation, damage responses and expression of cell regulatory proteins Saijun Fan1, Ji-An Wang1, Ren-qi Yuan1, Yong Xian Ma1, Qinghui Meng1, Michael R Erdos2, Lawrence C Brody2, Itzhak D Goldberg1 and Eliot M Rosen1 1

Department of Radiation Oncology, Long Island Jewish Medical Center, The Long Island Campus for the Albert Einstein College of Medicine, 270-05 76th Avenue, New Hyde Park, New York 11040; 2Genetics and Molecular Biology Branch, National Human Genome Research Institute, National Institutes of Health, Building 49, Room 3A14, Bethesda, Maryland 20892, USA

In addition to breast and ovarian cancer in women, recent evidence suggests that germ-line mutations of the breast cancer susceptibility gene-1 (BRCA1) also confer an increased life-time risk for prostate cancer in male probands. However, it is not known if and how BRCA1 functions in prostate cancer. We stably expressed wildtype (wt) and tumor-associated mutant BRCA1 transgenes in DU-145, a human prostate cancer cell line with low endogenous expression of BRCA1. As compared with parental cells and vector transfected clones, wtBRCA1 clones exhibited: (1) a slightly decreased proliferation rate (doubling time=25 h as compared with 22 h for control cells); (2) a (3 ± 6)-fold increase in sensitivity to chemotherapy drugs (adriamycin, camptothecin, and taxol); (3) increased susceptibility to druginduced apoptosis; (4) reduced repair of single-strand DNA strand breaks; and (5) alterations in expression of key cellular regulatory proteins (including BRCA2, p300, Mdm-2, p21WAF1/CIP1, Bcl-2 and Bax). Clones transfected with the 5677insA breast cancer-associated mutant BRCA1 (insBRCA1) displayed a similar phenotype to wtBRCA1 clones, except that insBRCA1 clones had a signi®cantly decreased proliferation rate (doubling time=42 h). On the other hand, cells transfected with with 185delAG mutant BRCA1 showed no obvious phenotype as compared with parental or vector transfected cells. These ®ndings suggest that BRCA1 may function as a human prostate tumor suppressor by virtue of its ability to modulate proliferation and various components of the cellular damage response. They also suggest several potential target gene products for a BRCA1 prostate tumor suppressor function. Keywords: prostate cancer; DU-145; BRCA1; DNA damage; apoptosis; p300

Introduction Germ-line mutations of the breast cancer susceptibility gene-1 (BRCA1) gene on human chromosome 17q21 confer a signi®cantly increased life-time risk for breast and ovarian cancer in women (Ford et al., 1994; Friedman et al., 1994; Easton et al., 1995). Emerging evidence suggests that these mutations may also confer an increased risk of prostate cancer in

Correspondence: S Fan or EM Rosen Received 20 March 1998; revised 7 May 1998; accepted 8 May 1998

male probands. Although most prostate cancers (590%) are sporadic rather than hereditary, there is a linkage between breast, ovarian, and prostate cancers in certain cancer-prone families (Tulinius et al., 1992; Jishi et al., 1995). Subsequent studies suggest that male carriers of BRCA1 mutations have an increased risk for prostate cancer and that some of these cancers occur at an earlier age, although this has not been established de®nitively (Ford et al., 1994; Langston et al., 1996; Streuwing et al., 1997). Genetic linkage studies suggest the existence of a prostate tumor suppressor gene on chromosome 17q at or near the BRCA1 locus (Gao et al., 1995); and fragments of normal chromosomal region 17q that include the BRCA1 gene inhibited tumorigenicity of a human prostate cancer cell line (Murakami et al., 1995). A recent study of unselected sporadic prostate cancers suggests the existence of a second prostate tumor suppressor gene on 17q distal to BRCA1 (Williams et al., 1996). However, this study does not rule out a role for BRCA1 genetic alterations in the development of prostate cancers occurring in patients with germ-line mutations of BRCA1. The BRCA1 gene encodes an 1863 amino acid (220 kDa) protein (Miki et al., 1994) that is targeted to the nucleus by nuclear localization sequences (amino acids 503 ± 508 and 606 ± 615) that interact with the nuclear transport signal receptor (Chen et al., 1996). BRCA1 has an N-terminal ring ®nger domain and a Cterminal transcription activation domain that activates transcription when linked to a DNA-binding domain (Chapman and Verma, 1996; Monteiro et al., 1996). Over-expression of BRCA1 inhibited growth of breast and ovarian cancer cells (Holt et al., 1996) and enhanced sensitivity of NIH3T3 ®broblasts to apoptosis induction (Shao et al., 1996); while antisense inhibition of BRCA1 stimulated mammary epithelial cell growth (Thompson et al., 1995) and made 3T3 cells resistant to apoptosis (Rao et al., 1996). Breast cancers from patients with BRCA1 germ-line mutations had 2 ± 3-fold more chromosomal loss compared to sporadic cancers (Tirkkonen et al., 1997). These ®ndings suggest a role for BRCA1 in `sensing' genomic damage and orchestrating the cellular responses. Various studies implicate BRCA1 in cell cycle regulation. BRCA1 levels vary cyclically, with peak levels at the G1/S border and low levels in late S or G2 (Rajan et al., 1996; Vaughn et al., 1996). Expression is down-regulated during growth arrest of mammary epithelium due to serum deprivation or TGF-b and is up-regulated during mammary epithelial cell differen-

BRCA1 as a prostate tumor suppressor S Fan et al

3070

tiation (Rajan et al., 1996). BRCA1 associates and colocalizes with Rad51, the human homolog of bacterial recombinase RecA and may be involved in DNA recombination events in mitotic and meiotic cycles (Scully et al., 1997a). DNA damage of human breast cancer cells caused the rapid redistribution of BRCA1 and Rad51 to complexes containing proliferating cell nuclear antigen and DNA along with hyperphosphorylation of BRCA1, suggesting BRCA1 may participate in an S-phase DNA-damage check-point (Scully et al., 1997b). BRCA1-induced cell cycle arrest of human colon cancer cells required the G1 cyclin dependent kinase inhibitor p21WAF1/CIP1; and BRCA1 activated the p21WAF1/CIP1 promoter independently of p53 (Somasundaram et al., 1997). While BRCA1 overexpression inhibited proliferation of human breast and ovary cancer cells (Holt et al., 1996), the murine homolog Brca1 was found to be essential for mouse embryo development; and Brca1 (7/7) cells exhibited a severe defect in cell cycle progression (Hakem et al., 1996). There is little or no existing information on the potential activity of BRCA1 in prostate cancer. Because of the genetic-epidemiologic data suggesting an increased risk for prostate cancer in males harboring BRCA1 germ-line mutations, we undertook studies to determine if and how BRCA1 may function in human prostate cancer cells.

vector (Invitrogen), under control of the strong CMV promoter); (2) pcBRCA1-5677insA (cDNA for breast cancer-associated mutation 5677insA, which results in a protein truncation at amino acid 1853); (3) pcBRCA1-185delAG (cDNA for breast cancer-associated mutation 185delAG, which results in a protein truncation at amino acid 39); and (4) pcDNA3 (the empty vector, which contains the neomycin resistance gene). Transfectants were selected in G418; and clones that stably expressed wild-type or mutant BRCA1 were isolated and assayed for expression of BRCA1 mRNA and protein. We used semi-quantitative RT ± PCR assays (Andres et al., in press) to assess and compare BRCA1 mRNA levels in transfected cell lines. The ampli®ed BRCA1 segment was located upstream of the 5677insA mutatin site, and was thus of identical length in wtBRCA1 and insBRCA1 clones. RT ± PCR assays revealed increased BRCA1 mRNA in wild-type (wtBRCA1) and 5677insA (insBRCA1) clones, as compared with neo clones and parental cells (Figure 2a). We have reported that ADR induces downregulation of BRCA1 mRNA expression in human breast cancer cells (Andres et al., in press). Similarly, ADR caused down-regulation of BRCA1 mRNA in control (parental and neo) DU-145 cells (Figure 2b).

Results BRCA1 expression in human prostate cancer cells We measured the levels of tumor suppressor proteins p53 and BRCA1 in three human prostate cancer cell lines: LNCaP (an androgen-responsive cell line derived from a lymph node metastasis), TsuPr-1 (an androgen-insensitive cell line from a lymph node metastasis), and DU-145 (an androgen-insensitive cell line from a brain metastasis) (Carroll et al., 1993; Webber et al., 1997). LNCaP cells have wild-type p53 and showed low basal levels of p53 that were markedly induced by exposure to a DNA damaging agent (adriamycin, ADR); while TsuPr-1 cells contain a p53 deletion mutation and expressed little or no p53 in control or ADR-treated cells. DU-145 cells have a double point mutation of p53 and expressed constitutively high levels of the mutant protein. All three cell lines expressed the full-length 220 kDa BRCA1 protein (Figure 1b) as well as BRCA1 mRNA (data not shown). As compared with human breast cancer cell line MCF-7, LNCaP had similar levels of BRCA1 protein, while DU-145 expressed considerably less BRCA1. Expression of wild-type and mutant BRCA1 transgenes in DU-145 cells To study the function of BRCA1 in prostate cancer, we transfected cDNAs encoding wild-type and mutant BRCA1 into DU-145 cells, which had the lowest endogenous level of BRCA1 mRNA and protein of the three prostate cancer cell lines tested. Cells were transfected with: (1) pcBRCA1-385 (cDNA for wildtype BRCA1 cloned into the pcDNA3 expression

Figure 1 Expression of p53 and BRCA1 in human prostate cancer cell lines LNCaP, Tsupr-1 and DU-145. (a) P53. Proliferating cells were treated+adriamycin (ADR, 10 mM62 h); washed twice; and incubated for 24 h in drug-free medium; and harvested. Equal aliquots of total protein (100 mg per lane) were blotted using an antibody that reacts against both wild-type and mutant p53. (b) BRCA1 protein levels. BRCA1 was examined in the same prostate cancer lines and, for comparison, in a human breast cancer cell line (MCF-7). Aliquots of total cell protein (100 mg per lane) were blotted to detect the 220 kDa full-length BRCA1 protein


However, there was little or no ADR-induced downregulation of BRCA1 mRNA in wtBRCA1 or insBRCA1 clones, consistent with constitutive expression of the wtBRCA1 and insBRCA1 transgenes driven by the CMV promoter in the pcDNA3 vector. As expected, wtBRCA1 and insBRCA1 clones also showed increased BRCA1 protein levels (Figure 2c). (Note: The dierence in Mr of the 1863 amino acid wtBRCA1 protein and the 1852 amino acid insBRCA1 protein is too small to resolve on our SDS-polyacrylamide gels). Dierences in culture morphology among the dierence clonal types were not dramatic, although the wtBRCA1 and insBRCA1 clones tended to show a somewhat smaller cell surface attachment area and a somewhat more rounded shape than the control (parental and neo) cells (data not shown). The 185delAG (delBRCA1) clones were similar in appearance to parental and neo clones; but we have not veri®ed expression of the highly truncated 185delAG

protein product in these clones. None of the transfected clones showed any evidence of cytotoxicity: i.e., no ¯oating cells, no morphologic evidence of cytopathology, less than 5% trypan blue-staining cells and no apoptotic DNA fragmentation. Proliferation and cell cycle kinetics of transfected DU-145 clones We compared the growth of parental, neo, delBRCA1, wtBRCA1 and insBRCA1 clones (n=three clones of each type) in standard growth medium (DMEM plus 5% fetal calf serum). For these experiments, transfected clones were taken o G418 for at least one passage. Parental, neo, and delBRCA1 clones exhibited similar growth rates (average population doubling time (Td)&22 h)); while wtBRCA1 clones grew slightly more slowly (Td&25 h) (Figure 3). Surprisingly, the insBRCA1 clones grew at a signi®cantly slower rate than any of the other clonal types (Td&42 h). Thus,

Figure 2 BRCA1 mRNA and protein levels in stably transfected DU-145 prostate cancer cell clones. (a and b) Semi-quantitative RT ± PCR. Proliferating cultures of parental cells and three clones of each type (neo, wtBRCA1, insBRCA1) were analysed by semiquantitative RT ± PCR, using a low cycle number (n=27) to quantitate basal BRCA1 mRNA levels. wtBRCA1 and insBRCA1 clones had higher basal mRNA levels than parental or neo clones (a). The 285-bp BRCA1 product was located from base position 5239 ± 5524 in the cDNA sequence; and the 764-bp b-actin product was located from base position 265 ± 1028. A higher cycle number (n=30) was used to assess adriamycin (ADR)-induced regulation of BRCA1. Twenty-four hours after exposure to ADR (100 mM62 h), BRCA1 mRNA levels were signi®cantly decreased in ADR-treated control (parental and neo) cells, as compared with untreated control cells (b). However, wtBRCA1 and insBRCA1 clones showed no ADR-induced decrease in BRCA1, consistent with constitutive expression of these BRCA1 transgenes under control of the strong CMV promoter. (c) Western blotting. Proliferating cultures of parental DU-145 cells and three clones each of neo, wtBRCA1, and insBRCA1 transfected clones were harvested. Equal aliquots of total protein (100 mg per lane) were analysed for the 220 kDa full-length BRCA1 protein. Lane 1 represents parental cells; lanes 2, 3 and 4 represent neo clones (#2, #6, and #8, respectively); lanes 5, 6, and 7 represent wtBRCA1 clones (#2, #6, and #9) (top panel) or insBRCA1 clones (#2, #8, and #9) (bottom panel). Note: wtBRCA1 and insBRCA1 proteins migrate at the same Mr of about 220 kDa

3071


3072

the wtBRCA1 transgene conferred a mild proliferation defect, but the insBRCA1 transgene conferred a more severe proliferation defect in DU-145 cells. We utilized ¯ow cytometry to compare cell cycle kinetic responses of control (parental or neo) and BRCA1 transfected cells. A representative experiment is shown in Table 1. There were no dramatic dierences in the cell cycle distributions of exponentially growing populations of control, wtBRCA1, or insBRCA1 cells. Exposure to ADR caused a moderate loss of cells from G1 and accumulation in S and/or G2/M. In the experiment shown, there was a slightly greater S-phase acumulation in wtBRCA1 cells than in the other cell lines; but this dierence was not observed in a second experiment. Treatment with the mitotic spindle poison nocodazole caused accumulation of cells in G2/M in all three cell lines. In the experiment shown, there was an increased percentage of nocodazole-treated wtBRCA1 cells in S-phase. However, this dierence was not observed in other experiments. Thus, under the conditions studied, we were unable to demonstrate consistent dierences in cell cycle kinetics as a function of clonal type.

BRCA1 modulates DU-145 cellular damage responses Chemotherapy drug sensitivity We used MTT dye conversion assays (Alley et al., 1988) to assess the eects of the BRCA1 transgenes on cell viability. Cells were treated with three dierent cytotoxic chemotherapy drugs: (1) ADR, a DNA helix intercalator and topoisomerase II inhibitor; (2) camptothecin (CPT, a DNA topoisomerase I inhibitor); and (3) paclitaxel (taxol, a mitotic spindle poison). Cell viability was assessed 72 h after exposure to drugs. wtBRCA1 and insBRCA1 clones were signi®cantly more sensitive than parental cells or neo clones to each cytotoxic drug (Figure 4a). The sensitivity of dierent clones to drugs was expressed quantitatively via an iso-eect dose, the ED60 (i.e., dose required to reduce survival to 60%) (Figure 4b). (The ED50 was not reached for control clones.) The fold increases in sensitivity of wtBRCA1 vs control clones (parental and neo) were 3.2 (adriamycin), 3.8 (camptothecin) and 5.6 (taxol). The sensitivity of insBRCA1 clones was similar to that of wtBRCA1 clones, or slightly greater for camptothecin.

Figure 3 Eect of wild-type and mutant BRCA1 on proliferation of DU-145 cells. Growing cultures of parental cells and three clones each transfected with wild-type BRCA1, 5677insA, 185delAG and vector only (neo) were harvested. Cells were seeded into 6well dishes at 56104 cells/well in growth medium (DMEM+5% fetal calf serum) on Day 0. Wells were counted by hemacytometer on days 1 ± 7. Cell counts are means of duplicate wells. Duplicate counts agreed to within+5% of the mean

Table 1

Flow cytometry analysis of cell cycle distributions of DU-145 cell clonesa

Treatment

G1

Parental S

Control (untreated) Adriamycin (10 mM62 h) Adriamycin (20 mM62 h) Nocodazole (15 mM624 h)

50 42 43 6

32 34 33 6

a

G2/M 19 24 24 88

Cell cycle distribution (% of cells) wtBRCA1 G1 S G2/M 56 42 43 6

28 38 38 42

16 20 20 51

G1

insBRCA1 S

G2/M

53 43 43 9

28 33 29 11

19 24 28 80

Subcon¯uent proliferating cultures of cells were subjected to the indicated drug treatments and harvested 24 h after the start of the treatment. The DNA content distributions of propidium iodide-stained cell nuclei were analysed by ¯ow cytometry


3073

Figure 4 Wild-type and mutant BRCA1 cDNAs sensitize DU-145 cells to cytotoxic agents. (a and b) MTT assays of cell viability. Subcon¯uent proliferating cells in 96-well dishes were treated with adriamycin (ADR, 2 h), camptothecin (CPT, 2 h) or taxol (24 h). Cells were washed twice and post-incubated in fresh drug-free medium for 72 h. Cell viability was assessed by spectrophotometric analysis of MTT dye conversion. Values are percent cell viability relative to untreated cells and are means of ten replicate wells. s.e.m. were 55% of the mean values. b shows ED60 values (i.e. doses required to reduce cell viability to 60%) calculated for each clone based on the data in a. Values are means+s.e.m. (n=1 for parental cells; n=3 for each clone type). (c) Apoptosis assays. Subcon¯uent proliferating cells in 100 mm plastic dishes were treated+adriamycin (15 mM62 h). Cells were washed twice and postincubated in fresh drug-free medium for 24 h. Cells were harvested; and DNA was extracted and electrophoresed through 1.2% agarose gels containing ethidium bromide


3074

Apoptosis induction The increased sensitivity of wtBRCA1 and insBRCA1 clones to ADR was accompanied by a marked increase in susceptibility to apoptosis induction, as indicated by patterns of interoligonucleosomal DNA fragmentation (`DNA ladders') assayed by agarose gel electrophoresis (Figure 4c). Similar ®ndings were obtained using camptothecin and taxol (data not shown). Neither the transgenes alone nor the cytotoxic drugs alone induced a signi®cant degree of apoptosis. However, the wtBRCA1 or insBRCA1 transgenes appeared to act synergistically with drugs to induce apoptosis. On the other hand, the

delBRCA1 clones were similar to parental cells and neo clones in susceptibility to cytotoxicity and apoptosis induction (data not shown). Thus, DU-145 prostate cancer cells are normally quite resistant to apoptosis induction, but become markedly sensitized by expression of either wtBRCA1 or insBRCA1. DNA strand breakage We performed DNA ®lter elution assays (Bertrand and Pommier, 1995) to assess the eect of the wtBRCA1 and insBRCA1 transgenes on ADR-induced DNA breakage and DNA repair (Figure 5). ADR caused a dose-

Figure 5 Eect of wtBRCA1 and insBRCA1 on repair of adriamycin-induced DNA strand breaks. DNA strand breakage as a function of ADR dose was measured immediately after ADR treatment (0 h) and 24 h later (24 h), using DNA ®lter elution assays (see Materials and methods). Parental cells and two clones each of neo, wtBRCA1 and insBRCA1 transfected cells were studied. (a and b) show DNA strand breakage expressed as the fraction of DNA eluted under alkaline conditions (SSBs) (a) or under netural conditions (DSBs) (b), minus the corresponding values for untreated cells. c shows the percentage of DNA SSBs and DSBs repaired during the 24 h post-incubation interval


3075

Figure 6 Alterations in levels of cellular regulatory proteins in DU-145 clones stably transfected with wtBRCA1 and insBRCA1 cDNAs. Subcon¯uent proliferating cell clones were harvested. Equal aliquots of total cell protein (100 mg per lane) were subjected to SDS ± PAGE on 6 ± 12% gels and immunoblotted to detect various proteins (see Materials and methods section). Protein expression of wtBRCA1 (a) and insBRCA1 (b) clones are compared with that of parental cells and neo clones. Equal loading of the gel was con®rmed by measurement of a-actin protein levels


3076

dependent increase in the number of single-strand breaks (SSBs) and double-strand DNA breaks (DSBs) observed immediately after treatment (0 h). The numbers of SSBs and DSBs at 0 h were similar in all clonal types (Figure 5a and b, left). By 24 h after treatment, the numbers of SSBs and DSBs were reduced, indicating a DNA repair process. However, there were signi®cantly more unrepaired SSBs in wtBRCA1 and insBRCA1 clones than in control (parental and neo) cells (Figure 5a, right). The reduction in the percentage of SSBs repaired over 24 h is illustrated for the two highest ADR doses in Figure 5c (left). Qualitatively similar results were obtained for DSBs, but the dierences between BRCA1 transfected vs control cells was less marked (Figure 5b and c, right). These ®ndings suggest that the expression of wtBRCA1 and insBRCA1 transgenes signi®cantly impairs repair of DNA strand breakage, particularly for SSBs. BRCA1 modulates expression of key cellular regulatory proteins Alterations of regulatory protein expression in wtBRCA1 and insBRCA1 clones To further examine how BRCA1 may function in DU-145 cells, we compared the expression of a variety of proteins involved in regulation of the cell cycle, apoptosis induction pathways, and transcription in wtBRCA1, insBRCA1, and control (parental and neo) clones (Figure 6). In general, wtBRCA1 clones (Figure 6a) and insBRCA1 clones (Figure 6b) showed similar patterns of altered regulatory protein expression as compared with control cells. Interestingly, levels of the breast cancer susceptibility gene-2 (BRCA2), which has also been linked to prostate cancer (see Discussion), were increased in BRCA1 transfected cells. Levels of a group of regulatory proteins were signi®cantly decreased in wtBRCA1 and insBRCA1 clones as compared with control clones. These include: p300 (a transcriptional co-activator); Mdm-2 (a p53-inducible gene product that inhibits p53 and stimulates cell cycle progression), p21WAF1/CIP1 (a G1 cyclin-dependent kinase inhibitor), the anti-apoptotic protein Bcl-2, and its pro-apoptotic binding partner Bax. The potential signi®cance of these alterations is discussed later (see Discussion). In contrast to wtBRCA1 and insBRCA1, delBRCA1 clones showed no signi®cant alterations in the levels of any of the regulatory proteins studied (data not shown). Various other regulatory proteins were expressed similarly or were only slighly altered in BRCA1 transfected (wtbRCA1 and insBRCA1) clones relative to control clones. There were no obvious BRCA1related alterations in the levels of: p53 (which has a double point mutation); Bcl-XL (an anti-apoptotic protein related to Bcl-2); c-Myc (a transcription factor involved in cell cycle progression and regulation of apoptosis); and pro-apoptotic proteins Bad and Bak (Figure 6 and data not shown). Levels of proliferating cell nuclear antigen (PCNA) were slightly decreased in wtBRCA1 and moderately decreased in insBRCA1 clones. The c-Myc binding partner Max exists in short (p21MaxS) and long (p22MaxL) isoforms with distinct biologic activities (Zhang et al., 1997). Both isoforms were increased to a slight-moderate extent in insBRCA1 transfected clones. Similarly, expression of

Table 2 Comparison of regulatory protein levels in BRCA1 transfected relative to parental/neo clonesa Protein BRCA1 BRCA2 p300 Mdm-2 p21WAF1/CIP1 Bcl-2 Bax PCNA p53 (mutant) Bcl-XL Gadd45 c-Myc MaxS and MaxL

wtBRCA1 clones ↑ ↑ ↓ ↓ ↓ ↓ ↓ slight ↓ → → → → moderate ↑

insBRCA1 clones ↑ ↑ ↓ ↓ ↓ ↓ ↓ moderate ↓ → → slight ↑ → slight ↑

a

Arrows indicate proteins whose expression is signi®cantly increased (↑), signi®cantly decreased (↓), or unchanged (→) relative to expression in control (parental and neo) cells

one or both isoforms of the damage-inducible repair protein Gadd45, was slightly increased in BRCA1 transfected clones. These ®ndings are summarized in Table 2. Transient transfection assays Some of the protein alterations in wtBRCA1 and insBRCA1 clones may be secondary to other changes induced by BRCA1 or may have occurred during the process of clonal selection. To distinguish alterations that occurred within days from those occurring more slowly, we performed transient transfection assays. Parental DU145 cells were transfected with wtBRCA1, insBRCA1, neo, or control (Lipofectamine alone or no addition); and cultures were harvested after 48 h for Western blot assays. As compared with neo transfected or untransfected controls, cultures transfected with wtBRCA1 and insBRCA1 cDNAs showed signi®cant increases in BRCA1 and BRCA2 and signi®cant decreases in p300 protein levels (Figure 7). Mdm-2 levels were moderately decreased by 48 h after transfection. However, levels of p21WAF1/CIP1, Bax, Bcl-2 and Bcl-XL were only slightly decreased (p21WAF1/CIP1, Bax) or essentially unchanged (Bcl-2, Bcl-XL) at this time. These ®ndings suggest that p21WAF1/CIP1, Bcl-2 and Bax may be regulated by mechanisms that require at least a few days to activate and/or by compensatory or feedback mechanisms. Adriamycin-induced alterations in regulatory protein expression Increased chemosensitivity and susceptibility to apoptosis induction in wtBRCA1 and insBRCA1 clones may be related not only to dierences in basal expression of regulatory proteins, but also to differences in the patterns of expression in response to the drugs. To assess possible dierences in the patterns of regulatory protein expression, we compared alterations in protein levels induced by ADR in a wtBRCA1 clone vs insBRCA1 clone vs parental cells (Figure 8). Cells wee treated with dierent doses of ADR, incubated for 24 h in drug-free medium, and harvested for Western blot assays (Figure 8a). Protein levels (relative to aactin) were quantitated by densitometry and expressed as a percentage of the value for untreated (0 ADR) parental cells (Figure 8b).


wtBRCA1 and insBRCA1 clones (0.5 mM) than in parental cells (5 mM). Parental cells showed modest alterations but maintained high levels of Bcl-2 and Bax; while wtBRCA1 and insBRCA1 clones had low Bcl-2 and Bax levels that did not change in response to ADR. All three cell lines expressed high levels of BclXL that did not change in response to ADR. In all three cell lines, both isoforms of Gadd45 (21 and 25 kDa) showed a biphasic response, with increased levels at 0.5 and 1 mM ADR and decreased levels at 55 mM ADR; but the increase in Gadd45 at low doses was more prominent for the wtBRCA1 and insBRCA1 cells than for parental cells. In all three cell lines, c-Myc was similarly down-regulated by ADR at high doses. In summary, ADR-induced alterations in regulatory proteins fell into several patterns: (1) major dierences in basal expression in wt/ins vs parental cells that were maintained following ADR treatment (p300, Bcl-2, Bax); (2) major dierences in basal expression (BRCA2, Mdm-2, p21) or in expression at low doses of ADR (Gadd45) in wt/ins vs parental cells that disappeared due to decline of protein levels at higher doses of ADR; (3) similar basal expression in wt/ins vs parental cells that did not change after ADR or else showed similar patterns of ADR-induced alterations (Bcl-XL, c-Myc, Max). Proteins exhibiting patterns of the ®rst type are good candidates as mediators of dierences in the ADR damage response; although proteins exhibiting alterations of the second type may also be contributory, especially at lower doses. Discussion

Figure 7 Transient transfection assays. Two separate dishes of DU-145 parental cells (designated 1 and 2) were transfected for each of three vectors: empty pcDNA3 vector(neo), pcBRCA1-385 (wtBRCA1) and pcBRCA1-5677insA (insBRCA1). As controls, cells were sham-treated without (parental 1) or with (parental 2) Lipofectamine. Cultures were incubated for 48 h and harvested for Western blotting to detect various regulatory proteins. Gel loading was equalized by protein content (100 mg per lane); and equal loading was con®rmed by measurement of a-actin protein levels

Parental cells showed low basal BRCA2 levels that did not change after ADR treatment. wtBRCA1 and insBRCA1 clones showed higher basal BRCA2 levels that declined after ADR treatment. Parental cells had high basal levels of p300 that declined modestly at ADR doses 55 mM; while wtBRCA1 and insBRCA1 clones had lower basal p300 levels that remained stable or declined slightly after ADR treatment. P300 levels in parental cells remained higher than those in wtBRCA1 and insBRCA1 clones at all ADR doses; whereas by doses 55 mM ADR, BRCA2 levels were similar or overlapping in the three cell lines. As noted earlier, basal Mdm-2 and p21WAF1/CIP1 levels were lower in wtBRCA1 and insBRCA1 clones than parental cells. ADR caused decreases in Mdm-2 and p21WAF1/CIP1, which occurred at lower doses in

Our ®ndings indicate that expression of BRCA1 transgenes in a human prostate cancer cell line (DU145) causes phenotypic alterations with respect to proliferation, cellular damage responses, and the expression of several cellular regulatory proteins. they also indicate a duality of BRCA1 function in prostate cancer cells: wtBRCA1 conferred a (3 ± 6)-fold increase in chemosensitivity as well as increased susceptibility to apoptosis induction, but only a mild proliferation defect (Td=25 h vs 22 h for control cells). On the other hand, a slightly truncated mutant BRCA1 (insBRCA1) conferred a more severe proliferation defect (Td=42 h) plus similar increases in chemosensitivity and apoptosis induction. Clones expressing either wtBRCA1 or insBRCA1 showed a decreased ability to repair single-stranded DNA breaks induced by ADR; and these clones also showed similar patterns of altered expression of regulatory proteins. Some of these alterations may, in part, explain the increased chemosensitivity of wtBRCA1 and insBRCA1 cells, as discussed. The decreased proliferation of insBRCA1 clones relative to wtBRCA1 clones was surprising. The Cterminal 95 ± 100 amino acids of BRCA1 function as a minimal transcription activation domain (TAD); and this function is ablated when the last 11 amino acids (the same amino acids missing in the insBRCA2 protein) are deleted (Chapman and Verma, 1996; Monteiro et al., 1996). One explanation for our ®ndings is that the TAD acts to stimulate prostate cell growth, while another more N-terminally located

3077


3078

domain inhibits growth. In this model, loss of the stimulatory TAD function in the insBRCA1 clones unmasked the growth inhibitory activity of BRCA1. Alternatively, the insBRCA1 protein may act as a competitive inhibitor to reduce the TAD activity of endogenous wild-type BRCA1 suciently to inhibit growth. Other phenotypic alterations (increased chemosensitivity, decreased DNA repair, altered protein expression) occurred equally in wtBRCA1 and insBRCA1 clones. Thus, regardless of the mechanism, it is dicult to explain our ®ndings without postulating at least two BRCA1 domains that regulate proliferation and damage response in DU-145 cells. Although we did not perform extensive analyses, we did not observe any obvious cell cycle alterations in wtBRCA1 or insBRCA1 clones. The lack of such changes may be related to the genetic background of DU-145 cells, which have loss of function mutations of both p53 and Rb (Sarkar et al., 1992; Carroll et al., 1993). Hypo-phosphorylated Rb binds to and ablates the transcriptional activity of E2F family proteins, which is needed for entry into S-phase (reviewed by Cobrinik, 1996). Lack of functional p53 and Rb coupled with down-regulation of the G1 cell cycle inhibitor p21WAF1/CIP1 may have prevented wtBRCA1 and insBRDA1 clones from arresting in G1. Mdm-2

and p300, both of which are decreased in these clones, are co-activators for E2F (Martin et al., 1995; Trouche et al., 1996). Thus, down-regulation of Mdm-2 and p300 is expected to have a greater eect on E2F activity and thus on progression from G1 to S, in cells with functional Rb. Several studies suggest that BRCA1 participates in a DNA-damage response pathway. BRCA1 associates and co-localize with Rad51, the human homolog of bacterial recombinase RecA, suggesting a role in DNA recombination events (Scully et al., 1997a). DNA damage of human breast cancer cells caused a rapid (51 h) trans-location of BRCA1 and its binding partners (Rad51 and BARD1) into PCNA-containing DNA complexes (Scully et al., 1997b). The decreased repair of ADR-induced SSBs in BRCA1 transfected cells observed in our study further implicates BRCA1 in the DNA repair pathway. During progression through S phase, unrepaired SSBs are converted to DSBs. Thus, in the absence of a G1 block, we expect more DSBs in ADR-treated wtBRCA1 and insBRCA1 clones. The relatively small eect of BRCA1 on DSBs may re¯ect recruitment of Rad51 by BRCA1 to DNA damage sites, allowing recombinational repair of DSBs. The mechanism(s) by which BRCA1 mod-


ulates DNA repair should be an important focus of further research. From the protein expression data (Figures 6 and 8), we infer that ADR-treated control cells retain Bcl2 : Bax dimers; while ADR-treated wtBRCA1 and insBRCA1 cells have few such dimers. The absence of survival-promoting Bcl-2 : Bax dimers may push these cells into apoptosis. Decreased expression of p300 in wtBRCA1 and insBRCA1 clones is another factor that may contribute to chemosensitivity. Thus, ablation of p300 function via an adenovirus E1A oncoprotein mutant that binds to p300 but not to Rb conferred increased sensitivity to ADR in keratinocytes; while inactivation of p300 and Rb family proteins each contributed to increased sensitivity to other cytotoxic agents (Sanchez-Prieto et al., 1995). In another study utilizing E1A mutants, ablation of p300 and Rb by E1A were found to be complementary factors contributing to chemosensitivity of normal ®broblasts

Figure 8 Adriamycin-induced alterations of regulatory protein levels in BRCA1 transfected (wtBRCA1 and insBRCA1) vs control cells. Subcon¯uent proliferating cells were treated with dierent doses of ADR (2 h); post-incubated in fresh growth medium for 24 h; and harvested for Western blot assays. Protein expression as a function of ADR dose is shown for parental cells, wtBRCA1 clone #2 and insBRCA1 clone #2 (a). Protein levels were quantitated by densitometry. The protein/a-actin ratio was calculated and expressed as a percentage of the corresponding value for untreated (0 ADR) parental cells (b)

(Samuelson and Lowe, 1997). Moreover, p300 interacts with the relA subunit of the survival-promoting transcription factor NF-KB and promotes its transcriptional activity (Gerritsen et al., 1997). These studies coupled with our ®ndings provide circumstantial evidence suggesting that the ability of BRCA1 to down-regulate p300 in DU-145 cells, which contain a functionally defective mutant Rb protein, contributes to the enhanced sensitivity to ADR and, possibly, to other cytotoxic agents. The ®nding of increased chemosensitivity and susceptibility to apoptosis induction of BRCA1 transfected DU-145 cells has potential clinical implications for prostate cancer. Thus, tumors with low levels of BRCA1 or those in which BRCA1 is otherwise inactivated (e.g., by mutation or cytoplasmic sequestration) may be more resistant to chemotherapy drugs than tumors with high levels of BRCA1. Furthermore, radiation therapy kills tumor cells, in part, through induction of apoptosis; and thus tumors with low levels of BRCA1 may also be more radioresistant. Conversely, it may be possible to sensitize prostate cancers to cytotoxic chemotherapy and radiation therapy by supplying BRCA1 or a portion of the molecule via a gene therapy approach. And if the ®nding that insBRCA1 inhibits prostate cancer cell proliferation can be generalized, this mutant BRCA1 transgene may be useful not only in enhancing chemo/radiosensitivity but also in suppressing tumor growth. These possibilities may be preliminarily investigated by examining the eects of wild-type and mutant BRCA1 transgenes on the growth and therapeutic responses in an animal model. Further study is needed to determine which genes are primary targets of BRCA1 and which are aected secondarily due to other BRCA1-induced alterations or to compensatory responses. Transient transfection studies revealed relatively rapid (within 448 h) BRCA1-induced alterations in BRCA2, p300, and Mdm-2 protein levels. On the other hand, downregulation of p21WAF1/CIP1, Bcl-2 and Bax required more than 48 h, although we do not know exactly how long. Decreased expression of p21 in wtBRCA1 and insBRCA1 clones is consistent with a report that p21 is up-regulated in Brca1 (7/7) mouse cells (Hakem et al., 1996), but con¯icts with the ®nding that BRCA1 transactivates the p21 promoter in human colon cancer cells (Somasundaram et al., 1997). Preliminary studies suggest that despite decreased p21 protein levels in wtBRCA1 and insBRCA1 clones, p21 mRNA levels are unchanged or slightly increased (unpublished data). Thus down-regulation of p21 in our study probably occurred at the protein level. Protein-level regulation of p21 by proteasome-dependent degradation has been described recently (Blagosklonny et al., 1996). Mdm-2, Bcl-2, p300 and BRCA2 are each attractive targets for a BRCA1 prostate tumor suppressor function. Mdm-2 binds to and inhibits the TAD of p53, but can also promote cell transformation and tumorigenesis independently of p53 (Dubs-Poterszman et al., 1995; Lundgren et al., 1997). Thus, by inhibiting Mdm-2 expression, BRCA1 may protect cells against the transforming activity of Mdm-2 and increase the susceptibility of genetically abnormal cells to p53mediated apoptosis. Conversely, prostate cells expressing low levels of BRCA1 or an inactive mutant

3079


3080

BRCA1 may be more susceptible to transformation because of sustained high levels of Mdm-2 and functional inactivation of p53. Up-regulation of Bcl-2 was implicated as a key event in prostate cancer progression to an androgen independent state (McDonnell et al., 1992 Garnick and Fair, 1996). BRCA1 transfected DU-145 cells expressed reduced levels of Bcl-2 and Bax. Conversely, loss of functional BRCA1 might increase the number of survivalpromoting Bcl-2 : Bax dimers, thus enhancing carcinogenesis by reducing the capacity to eliminate damaged cells via apoptosis. P300 interacts with nuclear receptors such as the estrogen receptor and enhances their transcriptional activity (Yao et al., 1996; Hanstein et al., 1996). By down-regulating p300, BRCA1 may not only enhance sensitivity to DNA damage but also inhibit steroid hormone responses. Since androgenic stimulation is through to play a signi®cant role in prostate carcinogenesis (reviewed by Karp et al., 1996), it is important to learn if BRCA1 down-regulates androgen receptor signaling in prostate cancer cells. Like BRCA1, germline mutations of BRCA2 appear to be associated with an increased risk for prostate cancer (Streuwing et al., 1997). The ®nding that BRCA1 transfected DU-145 cells express increased levels of BRCA2 protein raises the intriguing possibility that BRCA2 is a target for the putative BRCA1 tumor suppressor activity. In conclusion, our ®ndings suggest tht BRCA1 may function as a human prostate tumor suppressor by virtue of its ability to modulate proliferation and various aspects of the cellular damage response. Sorting out these mechanisms will be a major challenge, due to the size and complexity of the BRCA1 protein. Materials and methods Cell culture and transfection Cell lines were obtained from the American Type Culture Collection (Rockville, MD) and grown in Dulbecco's Modi®ed Eagles's Medium (DMEM) supplemented with 5% fetal calf serum, M-glutamine (5 mM), non-essential amino acids (5 mM), penicillin (100 U/ml), and streptomycin (100 mg/ml). For stable transfection, DU-145 cells in 100 mm dishes at 30 ± 40% of con¯uence were incubated overnight with 5 mg of plasmid, using Lipofectamine (Life Technologies), according to the manufacturer's instructions. Cells were selected in G418 (0.5 mg/ml). G418resistant colonies were isolated using cloning rings, expanded and screened by Western blot and RT ± PCR assays. Clones that stably over-expressed BRCA1 were frozen in liquid N2. Transient transfections were performed with 10 mg of plasmid, with Lipofectamine. Cells were post-incubated for 48 h (without G418) and harvested for Western blot assays. Flow cytometry Cells were detached using trypsin, washed in phsophatebuered saline (PBS), ®xed in 75% ethanol, and stored at 48C until use. Cells were then washed in PBS, treated with RNase (500 units/ml, Sigma) for 15 min at 378C and stained with propidiumiodide (50 mg/ml in PBS). Cell cycle analysis was performed on a Becton-Dickinson Fluorescence-Activated Cell Sorter at the Albert Einstein College of Medicine Cancer Center (Bronz, NY). The data were analysed using the MODFIT program.

MTT dye conversion assay MTT assays of cell viability were performed as described before (Alley et al., 1988). This assay is based on the ability of viable cells to convert MTT, a soluble tetrazolium salt [3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyl tetrazolium bromide] into an insoluble formazan precipitate, which is quantitated by spectrophotometry following solubilization in dimethyl sulfoxide. Brie¯y, subcon¯uent proliferating cells in 96-well dishes were treated with cytotoxic drugs in standard growth medium, washed, and then post-incubated for 3 days in fresh drug-free growth medium. At this time, the cells were solubilized and absorbance readings were taken using a Dynatech 96-well spectrophotometer. The amount of MTT dye reduction was calculated based on the dierence between absorbance at 570 nm and at 630. Cell viability was expressed as the amount of dye reduction relative to that of untreated control cells. Apoptosis assay Exponentially growing cells in 100 mm dishes were treated +drugs in standard growth medium; washed twice; incubated in fresh drug-free medium for 24 h and counted. Samples were normalized by cell number (500 000 ± 750 000 cells); and apoptotic DNA was extracted as described before (Herrmann et al., 1994). DNA was electrophoresed through 1.2% agarose gels containing 0.1 mg/ml of ethidium bromide; and gels were photographed under ultraviolet light. DNA ®lter elution assay Exponentially growing cells were labeled with [ 3H]thymidine (0.02 mCi/ml632 h); chased for 2 h in isotopefree medium; exposed to dierent doses of adriamycin for 2 h; washed twice; incubated in adriamycin-free medium for various times; and counted. Equal numbers of cells (26106) were loaded onto polycarbonate ®lters, lysed, and subjected to alkaline elution or neutral elution, as described before (Bertrand and Pommier, 1995). Radioactivity in the DNA fractions was counted; and the fraction of DNA eluted was calculated as elution fraction/[®lter+lysis+elution fraction]. Elution of DNA under alkaline conditions re¯ects the presence of singlestrand breaks (SSBs); while elution under neutral conditions re¯ects double-strand breaks (DSBs). Semi-quantitative RT ± PCR analysis RT ± PCR analysis was performed as described earlier (Andres et al., in press). Total cell RNA was extracted from cell monolayers using TriPure2 reagent (BoehringerMannheim), according to the manufacturer's instructions. The extracted RNA was treated with DNase and puri®ed by phenol-chloroform extraction. Aliquots of RNA (5 mg) were then reverse transcribed using Superscript II2 reverse transcriptase (Life Technologies) at 10 000 units/ml. Aliquots of cDNA corresponding to 0.5 mg of original RNA were used for PCR ampli®cation. DNA was ®rst denatured for 3 min at 948C, then ampli®ed using cycles of 1 min at 948C, 1 min at 508C and 1 min at 728C, with a ®nal 7 min incubation at 728C. The cycle number was adjusted so that all reactions fell within the linear range of product ampli®cation. The forward and reverse primers and expected sizes of the PCR products were: BRCA1: 5'→3' TTGCGGGAGGAAAATGGGTAGTTA; 3'→5' TGTGCCAAGGGTGAATGATGAAG; 285 bp b-Actin: 5'→3' TGTTACCAACTGGGACGATA; 3'→5' GATCTTGATCTTGGTGCT; 764 bp


The 285 bp segment ampli®ed from BRCA1 was located from positions 5239 to 5524 in the published cDNA sequence (GenBanK accession number U15595, submitted by Miki et al., 1994). b-actin was ampli®ed as a control, resulting in a 764 bp product located from positions 265 ± 1028. The identity of each PCR product was con®rmed by complete sequencing of the puri®ed product. PCR products were analysed by electrophoresis through 0.8% agarose gels containing 0.1 mg/ml of ethidium bromide; and gels were photographed under ultraviolet light. Western blotting Cells were washed with PBS and lysed at 08C for 30 min in 100 ± 200 ml of lysis buer per 100 mm dish (1% NP-40, in PBS with 2 mM 4-(2-aminoethyl)-benzene-sulfonyl ¯uoride, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 10 mM NaF, 1 mM Na orthovanadate and 5 mM Na pyrophosphate). Protein content was measured using BioRad dyebinding microassays. Aliquots of protein (100 mg/lane) were analysed by SDS ± PAGE on 6 ± 12% gels after boiling for 5 min in Laemmli buer. Proteins were transferred to Immobilon membranes (Millipore) and blocked for 30 min in 5% non-fat dry milk. Membranes were blotted with various commercial primary antibodies at dilutions ranging from 1 : 300 to 1 : 1000 and then

incubated with horseradish peroxidase-conjugated secondary antibody at a dilution of 1 : 3000. Blotted proteins were visualized using the enhanced chemiluminescence detection system (Amersham Life Sciences). Equality of protein loading was con®rmed by fast green staining of the membrane and by immunoblotting for a-actin. Colored markers (BioRad Corp.) were used as molecular size standards. The primary antibodies used in this study were as follows: BRCA1 (Ab-1 or C-20); BRCA2 (Ab-2), p53 (Ab-2), p21WAF1/CIP1 (EA10), Mdm-2 (Ab-1), Gadd45 (H-165), PCNA (PC10), Bax (P-19), Bcl-XL (S-18), Bcl-2 (N-19), p300 (05267), Bak (G-23), Bad (C-20), c-Myc (N-262), Max (C-124) and a-actin (I-19). Antibodies were obtained from Oncogene Research Products (BRCA1 Ab-1, BRCA2, p21WAF1/CIP1, p53, Mdm-2), Upstate Biotechnology (p300), and Santa Cruz Biotechnology (all others). Note: The C-20 BRCA1 antibody was used for studies of wtBRCA1 clones. This antibody was raised against a synthetic peptide corresponding to the Cterminal 20 amino cids of BRCA1. C-20 antibody crossreacts with the 190 kDa EGF receptor; which was easily distinguished from BRCA1 based on molecular size and using control cell lines that over-express one or the other protein. For blots of insBRCA1, which is missing the Cterminal 11 amino acids, we used BRCA1 Ab-1, which reacts against an N-terminal epitope of BRCA1.

References Alley MC, Scudieco DA, Monks A, Hursey ML, Czerwinski MJ, Fine DL, Abbott BJ, Mayo JG, Shoemaker RH and Boyd MR. (1988). Cancer Res., 48, 589 ± 601. Andres JL, Fan S, Turkel GJ, Wang J-A, Twu N-F, Yuan RQ, Lamszus K, Goldberg ID and Rosen EM. Oncogene, in press. Bertrand R and Pommier Y. (1995). In: Cell Growth and Apoptosis, Studzinski GP (ed.), Oxford University Press, pp. 97 ± 117. Blagosklonny MV, Wu CS, Omura S and El-Deiry WS. (1996). Biochem. Biophys. Res. Commun., 227, 564 ± 569. Carroll AG, Voeller HJ, Sugars L and Gelmann EP. (1993). Prostate, 23, 123 ± 134. Chen CF, Li S, Chen Y, Chen PL, Sharp ZD and Lee WH. (1996). J. Biol. Chem., 271, 32863 ± 32868. Chapman MS and Verma IM. (1996). Nature, 382, 678 ± 679. Cobrinik D. (1996). Curr. Top. Microbiol. Immunol., 208, 31 ± 61. Dubs-Poterszman MC, Tocque B and Wasylyk B. (1995). Oncogene, 11, 2445 ± 2449. Easton DF, Ford D and Bishop DT. (1995). Am. J. Hum. Genet., 56, 265 ± 271. Ford D, Easton DF, Bishop DT, Narod SA and Goldgar DE. (1994). Lancet, 343, 692 ± 695. Friedman LS, Ostermeyer EA, Szabo CI, Dowd P, Lynch ED, Rowell SE and King MC. (1994). Nat. Genet., 8, 399 ± 404. Gao X, Zacharek A, Grignon DJ, Sakr W, Powell IJ, Porter AT and Honn KV. (1995). Oncogene, 11, 1241 ± 1247. Garnick MB and Fair WR. (1996). Ann. Intern. Med., 125, 205 ± 212. Gerritsen ME, Williams AJ, Neish AS, Moore S, Shi Y and Collins T. (1997). Proc. Natl. Acad. Sci. USA, 94, 2927 ± 2932. Hakem R, de la Pomba JL, Sirard C, Mo R, Woo M, Hakem A, Wakeham A, Potter J, Reitmair A, Billia F, Firpo E, Hui CC, Roberts J, Rossant J and Mak TW. (1996). Cell, 85, 1009 ± 1023. Hanstein B, Eckner R, DiRenzo J, Halachmi S, Liu M, Searcy B, Kurokawa R and Brown M. (1996). Proc. Natl. Acad. Sci. USA, 93, 11540 ± 11545.

Herrmann M, Lorenz H-M, Voll R, Grunke M, Weith W and Kalden JR. (1994). Nucl. Acids Res., 22, 5506 ± 5507. Holt JT, Thompson ME, Szabo C, Robinson-Benion C, Arteaga CL, King M-C and Jensen RA. (1996). Nat. Genet., 12, 298 ± 302. Jishi MF, Itnyre JH, Oakley-Girvan IA, Piver MS and Whittemore AS. (1995). Cancer, 76, 1416 ± 1421. Karp JE, Chiarodo A, Brawley O and Kello GJ. (1996). Cancer Res., 56, 5547 ± 5556. Langston AA, Stanford JL, Wicklund KG, Thompson JD, Blasej RG and Ostrander EA. (1996). Am. J. Human Genet., 58, 881 ± 884. Lundgren K, Montes de Oce Luna R, McNeill YB, Emerick EP, Spencer B, Bar®eld CR, Lozano G, Rosenberg MP and Finlay CA. (1997). Genes Dev., 11, 714 ± 725. Martin M, Trouche D, Hagemeier C, Sorensen T, La Thangue NB and Kouzarides T. (1995). Nature, 375, 691 ± 694. McDonnell TJ, Troncoso P, Brisbay SM, Logothetis C, Chung LW, Hsieh JT, Tu SM and Campbell ML. (1992). Cancer Res., 52, 6940 ± 6944. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q, Cochran C, Bennett LM, Ding W, Bell R, Rosenthal J, Hussey C, Tan T, McClure M, Frye C, Hattier T, Phelps R, Haugen-Strano A, Katcher H, Yakumo K, Gholami Z, Shaer D, Stone S, Bayer S, Wray C, Bogden R, Dayanath P, Ward J, Tonin P, Narod S, Bristow P, Norris FH, Helvering L, Morrison P, Rosteck P, Lai M, Barrett JC, Lewis C, Neuhausen S, Cannon-Albright L, Goldgar D, Wiseman R, Kamb A and Skolnick MH. (1994). Science, 266, 66 ± 71. Monteiro AN, August A and Hanafusa H. (1996). Proc. Natl. Acad. Sci. USA, 93, 13595 ± 13599. Murakami YS, Brothman AR, Leach RJ and White RL. (1995). Cancer Res., 55, 3389 ± 3394. Rajan JV, Wang M, Marquis ST and Chodosh L. (1996). Proc. Nat. Acad. Sci. USA, 93, 13078 ± 13083. Rao VN, Shao N, Ahmad M and Reddy ES. (1996). Oncogene, 12, 523 ± 528. Samuelson AV and Lowe SW. (1997). Proc. Natl. Acad. Sci. USA, 94, 12094 ± 12099.

3081


3082

Sanchez-Prieto R, Lleonart M and Ramon y Cajal S. (1995). Oncogene, 11, 675 ± 682. Sarkar FH, Sakr W, Li YW, Macoska J, Ball DE and Crissman JD. (1992). Prostate, 21, 145 ± 152. Scully R, Chen J, Plug A, Xiao Y, Weaver D, Feunteun J, Ashley T and Livingston DM. (1997a). Cell, 88, 265 ± 275. Scully R, Chen J, Ochs RL, Keegan K, Hoekstra M, Feunteun J and Livingston DM. (1997b). Cell, 90, 425 ± 435. Shao N, Chai YL, Shyam E, Reddy P and Rao VM. (1996). Oncogene, 13, 1 ± 7. Somasundaram K, Zhang H, Zeng Y-X, Houvras Y, Peng Y, Zhang H, Wu GS, Licht JD, Weber BL and El-Deiry WS. (1997). Nature, 389, 187 ± 190. Streuwing JP, Hartge P, Wacholder S, Baker SM, Berlin M, McAdam SM, Timmerman MM, Brody LC and Tucker MA. (1997). New Engl. J. Med., 336, 1401 ± 1408. Thompson ME, Jensen RA, Obermiller PS, Page DL and Holt JT. (1995). Nat. Genet., 9, 444 ± 450. Tirkonnen M, Johannson O, Argnarsson BA, Olsson H, Invarsson S, Kahru R, Tanner N, Isola J, Barkardottir RB, Borg A and Kallioniemi O-P. (1997). Cancer Res., 57, 1222 ± 1227.

Trouche D, Cook A and Kouzarides T. (1996). Nucleic Acids Res., 24, 4139 ± 4145. Tulinius H, Egilsson V, Olafsdottir GH and Sigvaldson H. (1992). Br. Med. J., 305, 855. Vaughn JP, Davis PL, Jarboe MD, Huper G, Evans AC, Weisman RW, Berchuck A, Inglehart JD, Futreal PA and Marks JR. (1996). Cell Growth Dieren., 7, 711 ± 715. Webber MM, Bello D and Quader S. (1997). Prostate, 30, 58 ± 64. Williams BJ, Jones E, Zhu XL, Steele MR, Stephenson RA, Rohr LR and Brothman AR. (1996). J. Urol., 155, 720 ± 725. Yao TP, Ku G, Zhou N, Scully R and Livingston DM. (1996). Proc. Natl. Acad. Sci. USA, 93, 10626 ± 10631. Zhang H, Fan S and Prochownik EV. (1997). J. Biol. Chem., 272, 17416 ± 17424.