The FASEB Journal express article 10.1096/fj.01-0828fje. Published online May 8, 2002.
Release of mitochondrial Ca2+ via the permeability transition activates endoplasmic reticulum Ca2+ uptake David N. Bowser, Steven Petrou, Rekha G. Panchal, Megan L. Smart, and David A. Williams Department of Physiology, University of Melbourne, Victoria 3010 Australia Corresponding author: David A. Williams, Department of Physiology, University of Melbourne, Victoria 3010 Australia. E-mail:
[email protected] ABSTRACT Regulatory interactions between the endoplasmic reticulum (ER) and the mitochondria in the control of intracellular free Ca2+ concentration ([Ca2+]I), may be of importance in the control of many cell functions, and particularly those involved in initiating cell death. We used targeted Ca2+ sensors (cameleons) to investigate the movement of Ca2+ between the ER and mitochondria of intact cells and focused on the role of the mitochondrial permeability transition (MPT) in this interaction. We hypothesized that release of Ca2+ from mitochondria in response to a known MPT agonist (atractyloside) would cause release of ER Ca2+, perpetuating cellular Ca2+ overload, and cell death. Targeted cameleons (mitochondria and ER) were imaged with confocal microscopy 2–3 days following transient transfection of human embryonic kidney 293 cells. Opening of the MPT resulted in specific loss of mitochondrial Ca2+ (blocked by cyclosporin A), which was sequestered initially by ER. The ER subsequently released this Ca2+ load, leading to a global Ca2+ elevation, a response that was not observed when ER Ca2+-ATPases were blocked with cyclopiazonic acid. Thus, ER plays an important role in moderating changes in intracellular Ca2+ following MPT and may play a key role in cell death initiated by mitochondrial mechanisms. Key words: mitochondrial permeability transition • targeted Ca2+ sensors (cameleons)
M
itochondrial involvement in cell Ca2+ signaling is now widely accepted. Mitochondria have the ability to sequester large amounts of Ca2+ and tune cytosolic Ca2+ events, including Ca2+ transient duration and amplitude (1). More recently, investigations have focused on the close proximity of mitochondria with the primary intracellular Ca2+ stores (endoplasmic reticulum, ER) and the involvement of mitochondrial Ca2+ uptake mechanisms in “tuning” IP3R-mediated Ca2+ responses (2). However, we have only a rudimentary understanding of the dynamics of mitochondrial Ca2+ release via mitochondrial permeability transition pore (MPT) activation during cell death, and subsequent downstream effects on ER Ca2+ stores. Two experimental strategies are commonly used to directly explore the Ca2+ concentration in organelles, such as the mitochondria and ER of living, intact cells. The first involves loading of intact cells with membrane-permeant Ca2+-fluorophores, with subsequent quenching or removal of potentially confounding cytosolic fluorescence. This strategy has focused largely on the
mitochondria and, although some success has been achieved with it (3–5), these fluorescence techniques are difficult and the attribution of results to specific cell locations is usually ambiguous. The second approach involves intracellular targeting of the luminescent and Ca2+sensitive protein “aequorin” (isolated from the jellyfish Aequorea victoria) to specific organelles and has been in use for many years (6, 7). Recent developments have now provided Ca2+ sensors, termed “cameleons,” which offer a more favored alternative to chemically synthesized Ca2+ sensors and targeted Ca2+ sensors with suboptimal characteristics (8). Cameleons are genetically engineered protein sensors of free Ca2+ consisting of tandem fusions of a blue or cyan mutant of green fluorescent protein (GFP), calmodulin, calmodulin-binding protein M13, and an enhanced green- or yellow-emitting GFP. A practical advantage of genetically encoded sensors is that they can be easily targeted to intracellular locales via specific targeting sequences. In the present study, we used organelle-targeted cameleons to examine the potential exchange of Ca2+ between the ER and mitochondria in intact HEK293 cells. Furthermore, we examined the involvement of the mitochondrial permeability transition (MPT) in ER Ca2+ dynamics. We hypothesized that a known MPT agonist (atractyloside) would trigger release of mitochondrial Ca2+ that would subsequently cause release of ER Ca2+. Similarly, release of ER Ca2+ would be expected to cause a rise in mitochondrial Ca2+ and initiate MPT opening. MATERIALS AND METHODS Cameleon cDNA and construction of a mitochondrial targeted sensor The cDNA for yellow cameleon 2.1 (YC2.1) and ER-targeted cameleon-3ER (Cam3ER) inserted in Invitrogen’s pCDNA3 plasmid (Carlsbad, CA) were provided by Roger Tsien (Howard Hughes Medical Institute, University of San Diego). We constructed a mitochondrial-targeted YC2.1 (YC2.1mito) by amplifying YC2.1 from pCDNA3 by the polymerase chain reaction (PCR) with a forward primer (5' GTGCCGCGCGCCAAGATCCATTCGTTGGTCACGAAGGGCGAGGAGCTG 3') containing a PauI site and a reverse primer (5' GGGGGAGCTCTTACTTGTACAGCTCGTCCATGC 3') containing an XhoI site. The restriction-digested product was then ligated and cloned in-frame into the PauI/XhoI sites of pCMV/myc/mito (Invitrogen). Cell culture and transfection Human embryonic kidney 293 cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% (v/v) fetal bovine serum. For microscopy experiments, cells were grown on round glass coverslips (10-mm diameter) in six-well plates. Cells were transfected with 0.5–1.0 µg cDNA of YC3ER or YC2.1mito by using Qiagen’s effectine reagent (Qiagen Pty Ltd, Clifton Hill, Victoria, Australia). Reducing the transfection or expression times resulted in poorly targeted sensors (refer to Results section). For experiments, cells were bathed in a N-(2-hydroxyethyl) piperazine2'-(2-ethanesulphonic acid) (HEPES)-buffered modified Ringer’s solution containing (in mM): 118 NaCl, 4.8 KCl, 1.2 MgSO4, 1.2 KH2PO4, 25.0 Na-HEPES, 11.0 glucose, and 1.0 CaCl2. Imaging Ca2+ sensors
Cells were imaged with a Biorad MRC-1024 laser (100 mW argon ion; Hercules, CA) scanning confocal microscope coupled to a Nikon (Coherent Life Sciences, SA, Australia) TE300 inverted microscope. Our objective lens was a Nikon 60× N.A. 1.4 infinity-corrected, water-immersion lens. The cyan-mutated GFP (CFP) was excited with the 458 nm line of an argon ion laser. Binding of Ca2+ to calmodulin brings the yellow-mutated GFP (YFP) closer to CFP, allowing resonance energy transfer (RET) between the fluorescent proteins. YFP fluorescence was then collected through a 515-nm-long pass filter. All data presented were corrected for background fluorescence and expressed as observed YFP fluorescence intensity (as a result of RET) divided by the intensity before treatment. Monitoring MPT activation We used the calcein-cobalt quenching method for monitoring of MPT activation as described elsewhere (9, 10). Briefly, cells were incubated with calcein-AM (1 µM; Molecular Probes, Eugene, OR) in DMEM for 10 min, with the medium then replaced with one containing CoCl2 (1 mM) for 60 min to quench accessible (cytoplasmic) fluorescence. Cells were then rinsed with fresh medium prior to confocal imaging. On opening of the MPT pore, calcein is released from the mitochondrial matrix, which results in redistribution of the fluorescence. Calcein was excited at 488 nm and emission was collected through a 522-nm (35 nm band pass) filter. We performed more detailed image analysis to quantify pore opening. In each cell investigated, the average pixel intensity in a mitochondrial area was divided by that of a nuclear area within the same cell. All data were then expressed as the percentage change in the mitochondrial-nuclear fluorescence ratio from initial values (control) in order to compare individual cell responses. Data analysis Graphical data are the results of a single experiment on a group of cells, which is representative of several experiments performed. Where appropriate, exponential decays have been fitted to the graphical data by the formula y = y + A exp ( – x/t ), where y = Y offset, A = amplitude, and t is the time constant. Time constant data are expressed as mean ± SE. RESULTS We examined the targeting and Ca2+ sensing properties of the cameleons expressed in HEK293 cells. Using confocal microscopy, the distribution and expression levels of both cameleons compared with EGFP (Clontech’s pEGFP-N1 vector; Palo Alto, CA) up to 48 h after transfection (Fig. 1). YC3ER, which includes the C-terminal KDEL ER retention signal, was localized to the ER (reticular pattern) 36 h after transfection. The fluorescence of YC3ER continued to rise over the next 48 h, indicating increasing sensor expression. Similar expression levels (fluorescence intensity) were recorded for YC2.1mito, with obvious mitochondrial targeting (punctate fluorescence pattern) observed 48 h after transfection. Until this time, only diffuse cytoplasmic fluorescence was observed. We next investigated the ability of the cameleons to sense changes in organelle Ca2+ levels, by producing YFP fluorescence changes due to RET from CFP. Cyclopiazonic acid (CPA) causes indirect ER Ca2+ release by blocking sarco-endoplasmic reticulum Ca2+ ATPases that are primarily responsible for ER Ca2+ uptake. Addition of CPA to
the bathing solution induced loss of ER Ca2+, verifying the ability of YC3ER to sense such changes (Fig. 2A). The next step was to examine the ability of YC2.1mito to detect changes in mitochondrial Ca2+ (Fig. 2B). HEK293 cells expressing YC2.1mito were bathed in atractyloside to activate the MPT pore (MPT activation described later). After a slow (50-s duration) initial elevation of mitochondrial Ca2+ (not evident in all cells investigated), MPT pore opening allowed equilibration of Ca2+ (and other solutes
