Planta (2006) 225:183–191 DOI 10.1007/s00425-006-0339-4
O RI G I NAL ART I C LE
Calcium is essential for fructan synthesis induction mediated by sucrose in wheat Giselle Martínez-Noël · Jorge Tognetti · Vinay Nagaraj · Andres Wiemken · Horacio Pontis
Received: 22 March 2006 / Accepted: 2 June 2006 / Published online: 12 July 2006 © Springer-Verlag 2006
Abstract The role of Ca2+ in the induction of enzymes involved in fructan synthesis (FSS) mediated by sucrose was studied in wheat (Triticum aestivum). Increase of FSS enzyme activity and induction of the expression of their coding genes by sucrose were inhibited in leaf blades treated with chelating agents (EDTA, EGTA and BAPTA). Ca2+ channel blockers (lanthanum chloride and ruthenium red) also inhibited the FSS response to sucrose, suggesting the participation of Ca2+ from both extra- and intra- cellular stores. Sucrose induced a rapid Ca2+ inXux into the cytosol in wheat leaf and root tissues, shown with the Ca2+ sensitive Xuorescent probe Fluo-3/AM ester. Our results support the hypothesis that calcium is a component of the sucrose signaling pathway that leads to the induction of fructan synthesis.
Abbreviations BAPTA Bis-(o-aminophenoxy)-N⬘, N⬘, N⬘, N⬘-tetraacetic acid CDPK Ca2+-dependent protein kinase FSS Fructosylsucrose-synthesizing activity La3+ Lanthanum chloride Mt Mannitol RR Ruthenium red 6-SFT 6-Sucrose:fructan fructosyltransferase 1-SST 1-Sucrose:sucrose fructosyltransferase Ubi Ubiquitin W7 N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide
Keywords Calcium · Fructan synthesis · Sugar transduction
The functions of sucrose in metabolic processes have been widely studied, but its role as a signaling molecule has only recently been focused on (Koch 1996; Sheen et al. 1999; Gibson 2000; Smeekens 2000; Rolland et al. 2002). A number of growth and developmental processes have been found to depend on sucrose signaling (Dijkwel et al. 1997; Chiou and Bush 1998; Roldan et al. 1999). In wheat and other cool temperate grasses, conditions that favor sucrose accumulation such as low temperatures or illumination of detached leaves lead to the induction of fructan synthesis (Pontis 1989; Wagner et al. 1986; Müller et al. 2000; Nagaraj et al. 2001). These fructose polymers seem to play an important role not only as reserves but also as stress protectants (Pontis 1989; Vijn and Smeekens 1999; Livingston et al. 2005; Crafts-Brandner 2005 and references therein). Two enzymes account for net fructan synthesis: 1sucrose:sucrose fructosyltransferase (1-SST; EC 2.4.1.99)
G. Martínez-Noël (&) · H. Pontis Centro de Investigaciones Biológicas, Fundación para Investigaciones Biológicas Aplicadas (FIBA), Vieytes 3103, 7600 Mar del Plata, Argentina e-mail:
[email protected] J. Tognetti Facultad de Ciencias Agrarias, Universidad Nacional de Mar del Plata, CC 276, 7620 Balcarce, Argentina V. Nagaraj · A. Wiemken Botanisches Institut der Universität Basel, Hebelstrasse 1, 4056 Basel, Switzerland
Introduction
123
184
which catalyzes the formation of the trisaccharide 1-kestose, and 6-sucrose:fructan fructosyltransferase (6-SFT; EC 2.4.1.10) which either transfers fructosyl residues to a fructan (i.e., to 1-kestose) in (2–6) linkages, or produces 6-kestose (if only sucrose is available as a substrate). The 2–6 fructosyl–fructose linkages are by far prevailing in barley or wheat fructans; therefore in these species most of carbon Xux from sucrose to fructan is mediated by 6-SFT (Duchateau et al. 1995; Vijn and Smeekens 1999). The expression and activity of both 1-SST and 6-SFT is induced by sucrose (Wagner et al. 1986; Müller et al. 2000; Nagaraj et al. 2001), and experiments with the addition of diVerent sugars, sugar analogs and osmotic agents led to the conclusion that sucrose is, besides the natural substrate for fructan synthesis, the most likely signal molecule for the induction of fructan synthesizing enzymes in wheat leaves (Martínez Noël et al. 2001). The mechanisms underlying sucrose signal transduction are largely unknown at present. Furthermore, it is also not well understood whether or not similar mechanisms mediate the sugar-modulated expression of diVerent genes (Ohto et al. 1995). We have previously presented evidence suggesting that the induction of fructan synthesizing enzymes by sucrose might be mediated by Ca2+, since the presence of W7, a calmodulin antagonist, in the incubation medium of wheat leaves blocked the sugar response (Martínez Noël et al. 2001). Calcium has been shown to act as a second messenger in signal transduction pathway of hormones and environmental stimuli (touch, wind, chilling, light, and elicitors), which induce a rapid and transient increase in cytosolic Ca2+ level (Bush 1995; Trewavas and Malhó 1998; Pandey et al. 2000; Rudd and Franklin-Tung 1999; Sanders et al. 2002). However, reports concerning Ca2+ involvement in sucrose signal transduction are scarce. Elevation of Ca2+ concentration in the cytosol in response to signals has been shown to occur due to the inXux of Ca2+ from the apoplast and/or Ca2+ release from intracellular stores (endoplasmic reticulum -ER-, vacuoles, mitochondria, chloroplasts and nuclei) (Sanders et al. 2002). DiVerent signals use distinct Ca2+ stores for cytosolic Ca2+ transient increase, involving an array of Ca2+ sensors (Ca2+ binding proteins) which decode the Ca2+ signal (Scrase-Field and Knight 2003). Afterwards, Ca2+ eZux to the cell exterior and/or sequestration into cellular organelles like vacuoles, ER and mitochondria restores Ca2+ levels to resting state (White 2000; Reddy 2001). Calcium acts through intracellular protein mediators, like calmodulin and Ca2+regulated kinases (Roberts and Harmon 1992). Increasing evidence has shown that Ca2+-dependent
123
Planta (2006) 225:183–191
protein kinases (CDPKs, EC 2.7.1.37) are involved in environmental stress and hormone signaling (Harmon et al. 2000, 2001; Ludwig et al. 2004; Harper et al. 2004). Also, some CDPK isoforms appear to regulate distinct signaling pathways (Harmon et al. 2000). In the present work, we studied the role of Ca2+ in the induction of enzymes involved in fructan synthesis mediated by sucrose in wheat.
Materials and methods Plant material Wheat seeds (Triticum aestivum L.) of winter type cv. Pincén (kindly provided by Ing. Horacio BariY from the INTA Balcarce Experimental Station, Balcarce, Argentina) were germinated and grown for 8 days in vermiculite, in a controlled environment at 27°C § 1°C, under 250 mol photons m¡2 s¡1 (PAR) and a day/night regime of 16/8 h, and watered daily with one half strength Hoagland solution. Chemical treatment of plant material Fully expanded primary wheat leaf blades from 8-dayold plants were excised and immediately put in a test tube, with their cut end immersed in diVerent solutions (500 l), and incubated for 24 h in darkness, at a constant temperature of 25°C and 50% relative humidity. In experiments with the addition of Ca2+ inhibitors (chelating agents or channel blockers), leaves were pretreated with the inhibitor alone for 2 h before adding sucrose (200 mM) to the incubation mixture. Chelating agents assayed include EDTA, EGTA (which preferentially chelates extracellular Ca2+) and bis-(oaminophenoxy)-N⬘,N⬘,N⬘,N⬘-tetraacetic acid (BAPTA, Sigma), which speciWcally chelates Ca2+. Channel blockers include lanthanum chloride (La3+, Sigma) and ruthenium red (RR, Sigma), which inhibit Ca2+ uptake from extra- and intra-cellular stores, respectively. Wheat leaves treated with distilled water were used as control. Immediately after harvesting, leaf blades were frozen in liquid nitrogen and anlyzed. Measurement of sucrose uptake Extraction of water-soluble carbohydrates and sucrose analysis was done as described in Simmen et al. (1993). The samples were cromatographed on a CarboPac PA100 anion exchange column, using a Dionex DX-300 gradient chromatography system (Dionex), coupled with pulse-amperometric detection.
Planta (2006) 225:183–191
Enzyme assays Protein extractions and measurement of fructosylsucrose-synthesizing activity (FSS, which included 1-SST and 6-SFT activities) were done as described by Puebla et al. (1999). Thus, wheat leaf blades were powdered in liquid nitrogen and ground with a pestle in a mortar. Homogenates were prepared by extracting the powder in an ice-cold buVer (1.5 ml per g FW) containing 100 mM Hepes-NaOH (pH 7.5), 1 mM EDTA, 1 mM EGTA, 0.01% Triton, 20 mM MgCl2, 20 mM -mercaptoethanol and 0.5 mM phenylmethylsulfonyl Xuoride. Extracts were centrifuged at 10,000 g for 10 min and supernatants was desalted with Sephadex G-25. The reaction mixture for FSS activity determination contained 100 mM sodium acetate (pH 5.2), 200 mM sucrose, and protein extract in a total volume of 50 l, and was incubated at 30°C for 2 h. Excess sucrose was eliminated by incubating with commercial sucrase (Megazyme International, Ireland), 0.23 U in 100 mM sodium maleate (pH 6.5), in a total volume of 400 l, for 1.5 h. The monosaccharides produced were further destroyed with 0.4 N NaOH at 100°C, and fructan formed were quantiWed with the thiobarbituric acid procedure. Protein extraction and measurement of CDPK activity was performed as described by Martín and Busconi (2001). Wheat leaf blades were powdered in liquid nitrogen, ground with a pestle in a mortar, and extracted in an ice-cold buVer (1.5 ml per g FW) containing 50 mM Tris-HCl (pH 8), 0.1 mM EDTA, 2 mM DTT, 5 mM NaF, 1 mM Na3VO4, 20 mM -glycerolphosphate, 1 mg ml¡1 leupeptin, 2 mg ml¡1 aprotinin. The procedure was continued as described above for the measurement of FSS activity. Assays for determination of CDPK activity were performed in a total volume of 30 l containing 20 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 10 mM -mercaptoethanol, 0.5 mM Na3VO4, 10 mM -glycerolphosphate, 2.5 mM NaF and 25 M syntide-2 in the presence of 1 mM CaCl2 or 5 mM EGTA, and protein extract. Reactions were initiated by the addition of 50 M [¡32P]ATP (100 cpm pmol¡1) and assay mixtures were incubated for 15 min at 30°C. Enzyme reaction was ended by spotting an aliquot (25 l) on P-81 Wlter paper. The Wlters were washed with 0.5% (v/v) orthophosphoric acid, dried and counted in a liquid scintillation counter. The kinase activity was measured in the absence (EGTA) or in the presence of calcium, and the calcium-dependent kinase activity was determined after subtracting the calcium-independent activity. All enzyme assays performed were linear with time and the amount of enzyme. Soluble protein determina-
185
tion was done according to the procedure of Bradford (1976) with BSA as standard. The results presented are means § SE of three diVerent experiments. Analysis of gene expression RNA was isolated from leaf tissue using the RNeasy Plant Mini kit (Qiagen). RNA extracts were treated with deoxyribonuclease I (MBI Fermentas), subjected to phenol/chloroform extraction and quantiWed spectrophotometrically. One g of RNA was used for cDNA synthesis with the Reverse Transcription System (Promega), which were used as templates for RTPCR and real time PCR reactions. For the analysis of 1-SST and 6-SFT gene expression, 1SST-RTFor (5⬘gtcgtcgattagactgatcact 3⬘), 1SST-RTRev (5⬘ acatca tagccctgtcatcaac 3⬘), 6SFT-RTFor (5⬘ ctctccaatatggacg atcact 3⬘) and 6SFT-RTRev (5⬘ gcaaaccacatcggttcactat 3⬘) primer pairs were used. DNA ampliWed fragments of predicted sizes (187 bp and 248 bp) corresponded to the speciWc ampliWed regions, respectively. Ubiquitin (Ubi) gene expression was used as internal standard for gene expression analysis (TaUbiFor 5⬘ ccgcg ttagtacgggata 3⬘ and TaUbiRev 5⬘ gcctgatgttgatctatgtcg 3⬘ primers were used for amplifying a 135 pb sequence). For conventional RT-PCR, cDNA were ampliWed with Taq polymerase (Promega) (2.5 U) in a reaction mixture of 10 mM Tris-HCl (pH 9) containing 10 ng of the template, 1.5 mM MgCl2, 250 M of each dNTP, 20 pmol of each primer in a total volume of 10 l. PCR parameters consisted of 30 s at 95°C for denaturing, 30 s at 55°C for annealing and 30 s at 72°C for extension for 30 cycles and a Wnal extension step of 7 min at 72°C. The PCR products were analyzed on 0.8% agarose gels and visualized with ethidium bromide. Real time PCR was performed with a Gene Amp 5700 Sequence Detection System (Applied Biosystems). The thermal proWle was, 1cycle 2 min at 50°C, 1 cycle 10 min at 95°C, 40 cycles 15 s at 95 °C, 58°C 15 s and 1 min at 60°C. A 25 l reaction volume consisted of 12.5 l SYBR Green PCR master mix (Applied Biosystems), 8.5 l water, 0.3 M gene speciWc forward primers, 0.3 M gene speciWc backward primers and 1 l of cDNA preparation diluted 1:5. Ubi transcript levels in the diVerent samples were used to normalize the amounts of 6-SFT. Detection of cytosolic calcium Intact wheat root tips (10–20 mm long) and leaf segments (50 mm) were incubated with a solution containing 20 M Ca2+-sensitive Xuorescent dye Fluo-3/AM
123
186
Results Evidence of a role for calcium in FSS induction The fact that several lines of evidence suggest that changes in Ca2+ concentration in the plant cell cytosol are involved in plant responses to diVerent signals, and that in wheat a calmodulin antagonist (W7) blocked FSS induction by sugars, led us to examine CDPK activity during early stages of the transduction pathway after feeding wheat leaves with exogenous sucrose. CDPK activity increased at short times of sucrose treatment, almost doubling control values at 1 h (Fig. 1a). The eVect of EDTA and EGTA, general chelating agents, was then investigated. The addition of the chelators at 5 mM reduced approximately 40% FSS activity of excised leaves fed with sucrose after 24 h treatment (Fig. 1b). SpeciWc calcium chelator BAPTA blocks FSS induction by sucrose in wheat To speciWcally study the participation of Ca2+ in FSS induction by sucrose, we added BAPTA to the medium where excised wheat leaves were immersed. Similarly, the transcript levels of 1-SST and 6-SFT were drastically reduced with the addition of BAPTA
123
CDPK Activity (%)
a 250 200 150 100 50 0
t0
H2O
Suc
b 100 80
FSS Activity (%)
ester (Sigma) at 4°C for 2 h in the dark (Zhang et al. 1998). The Fluo-3/AM ester was added from a 1 mM solution containing 1% (v/v) DMSO. Then, root and leaf tissues were incubated in dye free solution with water as a control or with 200 mM sucrose, for 30 min at 20°C in the dark. Fluorescence from roots and leaves loaded with Fluo-3 was detected using an epiXuorescence microscope (Nikon PIII) (1,500£). Imaging of root and leaf cells was achieved after exciting with 488 nm UV light and collecting emission signals above 515 nm. Semiquantitative estimation of free cytosolic Ca2+ from roots was carried out with a confocal laser scanning microscope LSM Pascal AxioplanII (Carl Zeiss, Germany) by using Zeiss LSM image browser. Root tips were loaded with Fluo-3/AM ester as decribed above and then incubated in a chamber with water as a control or with 200 mM sucrose or with mannitol 200 mM as osmoticum control during 30 min while they were observed on the confocal microscope. Images were taken every 5 min. The samples were excited at 488 nm and the emission signals were taken at 515 nm. Both experiments were conducted in duplicate.
Planta (2006) 225:183–191
60 40 20 0
Suc Addition
-
+ -
+ EDTA
+ EGTA
Fig. 1 EVect of sucrose on CDPK activity, measured in wheat leaves treated with water or 200 mM sucrose for 1 h in darkness (a) and eVect of calcium chelators on the sugar-induced FSS activity, measured in wheat leaves incubated with 200 mM sucrose, in the presence or absence of 5 mM EDTA or 5 mM EGTA for 24 h in darkness (b). Enzyme activities are expressed as a percentage of controls (t0 and sucrose in a and b, respectively). 100% CDPK activity corresponds to 30.1 § 10.7 nmol Pi (g FW)¡1 h¡1 and 100% FSS activity corresponds to 4.2 § 0.8 mol trisaccharide (g FW)¡1 h¡1. Data represent the mean § SE of three diVerent experiments
to the sucrose medium, as revealed by RT-PCR and real time PCR (Fig. 2a, b). Similarly, BAPTA blocked the increase in FSS activity by sucrose in a concentration-dependent manner, and at 20 mM BAPTA, FSS induction was reduced by approximately 85% (Fig. 2c). Extra-and intra-cellular calcium stores are required for FSS induction To test the participation of diVerent Ca2+ stores in the response to sucrose, we added to the sucrose solution either lanthanum chloride (La3+), a potent Ca2+ channel blocker that competes externally with Ca2+ for speciWc channels localized in the plasma membrane (Graziana et al. 1988; Knight et al. 1992), or ruthenium red (RR), an endomembrane Ca2+ channel blocker (Allen et al. 1995). The transcript levels of 1-SST and 6-SFT were reduced by La3+ and RR, as shown by RT-PCR and
Planta (2006) 225:183–191
187
a
a 120
+ Suc
Ta1-SST
Ta6-SFT
FSS Activity (%)
H2O Suc BA La3+ RR
100 80 60 40 20
TaUbi
b 25
La3+ (mM)
20
b 120
15 10 5 0
Water Suc BAPTA
FSS Activity (%)
La+
RR
120
FSS Activity (%)
6-SFT relative expression
30
c
0
0
0.1
1
10
0
0.5
5
50
100 80 60 40 20
100 80
0
60
RR (µM)
40 20 0
BAPTA (mM)
0
0.2
2
20
Fig. 2 Sucrose induction of FSS and its blockage by BAPTA and other speciWc Ca2+ inhibitors in wheat. Total RNA was isolated from wheat leaves treated with water or sucrose in presence or absence of diVerent inhibitors for 24 h in darkness. RNA was subjected to reverse transcription to produce cDNAs that were ampliWed with speciWc primers for 1-SST, 6-SFT and Ubi (control) by PCR (a) or the speciWc primers for 6-SFT and Ubi (control) in the real time PCR for quantitative analysis (b). In a PCR products were separated on agarose gels and stained with ethidium bromide. Two experiments were done with similar results. In b 6-SFT relative expression corresponds to 6-SFT copy number relative to Ubi copy number. c EVect of BAPTA treatment on the sugar-induced FSS activity. Wheat leaves were treated with 200 mM sucrose and diVerent concentrations of BAPTA for 24 h in darkness. FSS activity is expressed as a percentage of controls. 100% FSS activity corresponds to 4.2 § 0.8 mol trisaccharide (g FW)¡1 h¡1. Data represent the mean § SE of three diVerent experiments
real time PCR, whereby the eVect of La3+ was stronger than that of RR (Fig. 2a, b). These Ca2+ channel blockers also inhibited the sucrose induction of FSS activity by sucrose in a dose-dependent manner, and complete suppression of the sucrose eVect was found at 10 mM La3+ and 50 M RR (Fig. 3). The diVerent Ca2+ block-
Fig. 3 EVect of calcium channel inhibitors on the sucrose-induced FSS activity. Wheat leaves were treated with 200 mM sucrose and diVerent concentrations of lanthanum chloride (a) or ruthenium red (b) for 24 h in darkness. FSS activity is expressed as a percentage of controls. 100% FSS activity corresponds to 4.2 § 0.8 mol trisaccharide (g FW)¡1 h¡1. Data represent the mean § SE of three diVerent experiments
ers seemed not to aVect sucrose uptake to the tissue, since sucrose concentration did not vary between treatments with either sugar alone or with the addition of the inhibitors (4.78 § 0.98 g mg FW¡1). Sucrose increases cytosolic calcium in wheat leaves and roots Possible sucrose-induced changes in endogenous Ca2+ concentration were investigated using the dye Fluo-3 as an intracellular Ca2+ indicator, whose Xuorescence increases on binding Ca2+ (Zhang et al. 1998). Both wheat leaf and root segments treated with sucrose for 30 min presented more Xuorescence than tissues incubated with water (control) (Fig. 4). The Xuorescence pattern was more homogeneous in the root (Fig. 4d) than in the leaf tissues (Fig. 4e, f), probably due to the diYculty in permeating the cuticle of the latter.
123
188
Planta (2006) 225:183–191
Semiquantitative data were obtained from confocal laser images of wheat root tips loaded with Fluo-3/AM and then treated with either sucrose, water or mannitol. Sucrose caused a four to Wve fold increase in free cytosolic calcium over controls after 15 min of treatment, when maximum Xuorescence was observed (Fig. 5). It is noteworthy that root FSS activity is induced by sucrose feeding in the same manner than in leaf tissues but the induction is quite lower. The values of FSS activity for water and sucrose treatment in roots were 0.045 § 0.018 and 0.114 § 0.014 mol trisaccharide (g FW)¡1 h¡1, respectively.
Discussion The results presented here argue for a role of Ca2+ in the signaling process leading to the sucrose-mediated induction of fructan metabolism in wheat. Treatments with Ca2+ antagonists, including Ca2+ chelators (EDTA, EGTA and BAPTA) and Ca2+ channel blockers (La3+ and RR), reduced or suppressed the accumulation of 1-SST and 6-SFT transcripts by sucrose as well as sucrose-induced stimulation of FSS activity (Figs. 1– 3). Our data suggest that the inXux of Ca2+ from both extracellular and intracellular Ca2+ stores is required for eliciting this eVect. It is well known that the plant cell walls and the vacuole act as Ca2+ storage sites, and that both plasma membrane and tonoplast possess Ca2+ channels (Schroeder and Thuleau 1991; Trewavas and Gilroy 1991). Because EDTA, EGTA, BAPTA and La3+ are unlikely to enter the cell, they probably act by preventing the cell wall Ca2+ from entering the cytosol: the Wrst three by chelating the ion and the other by blocking the plasma membrane Ca2+ channels (Graziana et al. 1988; Knight et al. 1992). On the other hand, RR is known to block intracellular Ca2+ channels. The Wnding that both intracellular and extracellular channel blockers impaired the sucrose-mediated Fig. 4 Sucrose eVects on cytosolic calcium in wheat leaves and roots as shown by epiXuorescence microscopy. Wheat roots (a, d) and leaf segments were loaded with Fluo-3/AM ester solution as described in Materials and methods and then incubated with water (b, e) or 200 mM sucrose (c, f) for 30 min in darkness. a-c Light Weld; d-f Xuorescence Weld
123
induction process, suggests that a coordinated mechanism exists involving Ca2+ ions from both stores (White 2000). An increase in cytosolic Ca2+ levels was found in both leaf and root tissues shortly after feeding with sucrose (Figs. 4, 5). This is in agreement with a few reports on diVerent plant systems. Ohto et al. (1995) have reported that sucrose induces an increase in cytosolic Ca2+ concentration in leaf discs of tobacco, while recently Furuichi and Muto (2005) presented similar results from aequorin-transformed tobacco cell suspensions. Furuichi et al. (2001) have also found that sucrose induces an increase in Ca2+ cytosolic levels in Arabidopsis whole plants. Sugars may inXuence cytosolic concentration of the ion by modifying channels activities, since it has been shown that the sucrose/proton symport mechanism that depolarizes the plasma membrane induces the opening of voltage-dependent Ca2+ channels (Bush 1993; Chiou and Bush 1998; Lalonde et al. 1999; Furuichi et al. 2001). The activation of Ca2+-dependent protein kinases a short time after feeding with sucrose (Fig. 1a) may arise from a transient increase in cytosolic Ca2+ concentration. We have shown (Martínez Noël et al. 2001) that a staurosporine and W7-sensitive protein kinase(s) may play an important role in the sucrose-mediated accumulation of 6-SFT transcript and FSS activity stimulation. Thus, it is likely that the staurosporine and W7-sensitive protein kinase(s) may participate in sucrose-induced protein phosphorylation which, in turn, may cause the accumulation of 6-SFT and 1-SST transcripts. Ca2+ inXux followed by CDPKs activation are sequential events common in plant signaling of various environmental or endogenous stimuli (Ohto et al. 1995; Vitrac et al. 2000; Hwang and Lee 2001). Evidence linking CDPKs and sucrose signaling is so far restricted to a few reports: induction of sporamin and -amylase genes in sweet potato stems and leaves, and induction of tuberization in potato stolons, which may
Root H2O
Leaf Suc
H2O
Suc
a
b
c
d
e
f
Planta (2006) 225:183–191
189
H2O
Suc
50 µm
50 µm
200
Relative fluorescence
Mt
50 µ m
160 120 80 40 0
Water
Mt
Suc
Fig. 5 Sucrose eVects on cytosolic calcium in wheat roots as shown by confocal imaging of Fluo-3 Xuorescence. Wheat roots were loaded with Fluo-3/AM ester solution as described in Materials and methods and then incubated with either water, 200 mM sucrose or 200 mM mannitol during 30 min. Pictures shown correspond to cortical cells (30–60 m from the root surface) of the root apex and they were taken 15 min after beginning of treat-
ments, when maximum Xuorescence was observed. Relative Xuorescence was quantiWed from at least six roots under each treatment, using the Zeiss’s software for LSM Pascal v3.2. 100% relative Xuorescence corresponds to that of roots incubated with sucrose for 30 min. Pooled data from two independent experiments are included in the graph. Bars indicate standard deviation. Mt mannitol
involve CDPK activation and changes in CDPK expression, respectively (Ohto and Nakamura 1995; Iwata et al. 1998; Raíces et al. 2003). The nature and substrate of the CDPK involved in sugar signaling remain to be identiWed. A number of genes related to carbohydrate metabolism have been shown to be regulated by sucrose in diVerent plant species (Koch 1996; Lalonde et al. 1999; Sheen et al. 1999; Gibson 2000; Smeekens 2000; Rolland et al. 2002). For example, sucrose synthase and ADP-glucose pyrophosphorylase are upregulated by sucrose at the transcriptional and also at posttranscriptional levels to regulate the starch synthesis in growing potato tubers (Müller-Rober et al. 1990; Geigenberger 2003). Another well studied example is the induction of the de novo synthesis of fructan biosynthetic enzymes in detached leaves of cool temperate grasses, both after exogenous feeding with sucrose or illumination (Wagner et al. 1986; Müller et al. 2000; Nagaraj et al. 2001). In leaves of intact plants, fructan metabolism is induced when environmental conditions favor a photoassimilate ‘surplus’, such as during periods at low temperature. Under these conditions, sucrose utilization for growth processes is restricted, and it accumulates in the vacuoles of source leaves. It has been found
in Arabidopsis that lowering temperature induces two cytosolic Ca2+ peaks, the Wrst corresponding to inXux from external sources, and the second to Ca2+ release from vacuoles or other intracellular stores, probably mediated by inositol phosphate (Knight and Knight 2000). Calcium waves (Ca2+-induced Ca2+ release) are ubiquitously present in signal transduction processes, and have been suggested to play a role in coordinating cellular responses towards a behavioral objective (Sanders et al. 2002; Trewavas 2003). In view of our results and reports about membrane depolarization by the sucrose symport system (Bush 1993 and references therein), we hypothesize that sucrose may induce the inXux of Ca2+ from the apoplast, and possibly subsequently from internal stores into the cytosol. The parallelism between signaling pathways in cold- and sucrose-driven induction of fructan synthesis enzymes is further supported by the fact that the addition of Ca2+ blockers to the root medium in hydroponically grown cold-treated wheat seedlings completely impaired the induction process (Martínez-Noël, Tognetti and Pontis, unpublished). The involvement of Ca2+ and CDPK activity in gene induction by cold has been previously shown (Monroy et al. 1993; Monroy and Dhindsa 1995; Tähtiharju et al. 1997).
123
190
In conclusion, the evidence presented supports the hypothesis that calcium is a component of the sucrose signaling pathway that leads to fructan synthesis in wheat. Acknowledgments GMN is a Fellow of CONICET; JAT and HGP are Career investigators of CIC (Pcia. de Buenos Aires) and CONICET respectively. The authors are indebted to Dr. Graciela Salerno for her critical reading of the ms, to Dr. Marisa Otegui for kindly providing Fluo-3/AM dye, to Ramiro Verdun for his help with calcium detection experiments, and to María Jimena Ortega for her help with confocal determinations. This work is part of the PhD thesis of GMN at UNMP, Argentina. Supported by Agencia Nacional de Promoción CientíWca y Tecnológica (ANPCyT), Consejo Nacional de Investigaciones CientíWcas y Técnicas (CONICET), Universidad Nacional de Mar del Plata (UNMP), Fundación Antorchas, and Fundación para Investigaciones Biológicas Aplicadas (FIBA).
References Allen GJ, Muir SR, Sanders D (1995) Release of Ca2+ from individual plant vacuoles by both InsP3 and cyclic ADP-ribose. Science 268:735–737 Bradford MM (1976) A rapid a sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Bush DS (1993) Proton-coupled sugar and amino acid transporters in plants. Annu Rev Plant Physiol Plant Mol Biol 43:513– 542 Bush DS (1995) Calcium regulation in plant cells and its role in signaling. Annu Rev Plant Physiol Plant Mol Biol 46:95– 122 Chiou TJ, Bush DR (1998) Sucrose is a signal molecule in assimilate partitioning. Proc Natl Acad Sci USA 95:4784–4788 Crafts-Brandner SJ (2005) Fructans and freezing tolerance. New Phytol 166:708–709 Dijkwel PP, Huijser C, Weisbeek PJ, Chua NH, Smeekens SCN (1997) Sucrose control of phytochrome A signaling in Arabidopsis. Plant Cell 9:583–595 Duchateau N, Bortlik K, Simmen U, Wiemken A, Bancal P (1995) Sucrose:fructan 6-fructosyltransferase, a key enzyme for diverting carbon from sucrose to fructan in barley leaves. Plant Physiol 107:1249–1255 Furuichi T, Mori I, Takahashi K, Muto S (2001) Sugar-induced increase in cytosolic Ca2+ in Arabidopsis thaliana whole plant. Plant Cell Physiol 42:1149–1155 Furuichi T, Muto S (2005) H+-coupled sugar transporter, an initiator of sugar-induced Ca2+ signaling in plant cells. Z Naturforsch [C] 60:764–768 Geigenberger P (2003) Regulation of sucrose to starch conversion in growing potato tubers. J Exp Bot 54:457–465 Gibson SI (2000) Plant sugar-response pathway. Part of a complex regulatory web. Plant Physiol 124:1532–1539 Graziana A, Fosset M, Ranjeva R, Hetherington A, Lazdunski M (1998) Calcium channel inhibitors that bind to plant cell membranes block calcium entry into protoplasts. Biochemistry 27:764–768 Harmon AC, Gribskov M, Gubrium E, Harper JF (2001) The CDPK superfamily of protein kinases. New Phytol 151:175– 183 Harmon AC, Gribskov M, Harper JF (2000) CDPKs-a kinase for every Ca+2 signal? Trends Plant Sci 5:154–159
123
Planta (2006) 225:183–191 Harper JF, Breton G, Harmon A (2004) Decoding Ca+2 signals through plant protein kinases. Annu Rev Plant Biol 55:263– 288 Hwang JU, Lee Y (2001) Abscisic acid-induced actin reorganization in guard cells of dayXower is mediated by cytosolic calcium levels and by protein kinase and protein phosphatase activities. Plant Physiol 125:2120–2128 Iwata Y, Kuriyama M, Nakakita M, Kojima H, Ohto M, Nakamura K (1998) Characterization of a calcium-dependent protein kinase of tobacco leaves that is associated with the plasma membrane and is inducible by sucrose. Plant Cell Physiol 39:1176–1183 Knight H, Knight MR (2000) Imaging spatial and cellular characteristic of low temperature calcium signature after cold acclimation in Arabidopsis J Exp Bot 51:1679–1686 Knight M, Smith S, Trewavas A (1992) Wind-induced plant motion immediately increases cytosolic calcium. Proc Natl Acad Sci USA 89:4967–4971 Koch K (1996) Carbohydrate-modulated gene expression in plants. Annu Rev Plant Mol Biol 47:509–540 Lalonde S, Boles E, Hellmann H, Barker L, Patrick JW, Frommer WB, Ward JM (1999) The dual function of sugar carriers: transport and sugar sensing. Plant Cell 11:707–726 Livingston D, Premakumar R, Tallury SP (2005) Carbohydrate concentrations in crown fractions from winter oat during hardening at sub-zero temperatures. Ann Bot 96:331–335 Ludwig AA, Romeis T, Jones JDG (2004) CDPK-mediated signalling pathways: speciWcity and cross-talk. J Exp Bot 55:181–188 Martín M, Busconi L (2001) A rice membrane-bound calciumdependent protein kinase is activated in response to low temperature. Plant Physiol 125:1442–1449 Martínez Noël G, Tognetti JA, Pontis HG (2001) Protein kinase and phosphatase activities are involved in fructan synthesis initiation mediated by sugars. Planta 213:640–646 Monroy A, Sarhan F, Dhindsa R (1993) Cold-induced changes in freezing tolerance, protein phosphorylation, and gene expression. Plant Physiol 102:1227–1235 Monroy A, Dhindsa R (1995) Low-temperature signal transduction— induction of cold acclimation-speciWc genes of alfalfa by calcium at 25°C. Plant Cell 7:321–331 Müller J, Aeschbacher R, Springer N, Boller T, Wiemken A (2000) Disaccharide-mediated regulation of sucrose:fructan 6-fructosyltransferase, a key enzyme of fructan synthesis in barley leaves. Plant Physiol 123:136–146 Müller-Rober BT, Kossmann J, Hannah LC, Willmitzer L, Sommerwald U (1990) One of two diVerent ADP-glucose pyrophosphorylase genes from potato responds strongly to elevated levels of sucrose. Mol Gen Genet 224:136–146 Nagaraj VJ, Riedl R, Boller T, Wiemken A, Meyer AD (2001) Light and sugar regulation of the barley sucrose:fructan 6fructosyltransferase promoter. Plant Physiol 158:1601–1607 Ohto M, Hayashi K, Isobe M, Nakamura K (1995) Involvement of Ca2+ signaling in the sugar-inducible expression of genes coding for sporamin and -amylase of sweet potato. Plant J 7:297–307 Ohto M, Nakamura K (1995) Sugar-induced increase of calciumdependent protein kinases associated with the plasma membrane in leaf tissues of tobacco. Plant Physiol 109:973–981 Pandey S, Tiwari SB, Upadhyaya KC, Sopory SK (2000) Calcium signaling—linking environmental signals to cellular functions. CRC Crit Rev Plant Sci 19:291–318 Pontis HG (1989) Fructans and cold stress. J Plant Physiol 134:148–150 Puebla AF, Battaglia ME, Salerno GL, Pontis HG (1999) Sucrose-sucrose fructosyl transferase activity—a direct and
Planta (2006) 225:183–191 rapid colorimetric procedure for the assay of plant extracts. Plant Physiol Biochem 37:699–702 Raíces M, MacIntosh GC, Ulloa RM, Gargantini PR, Vozza NF, Téllez-Iñon MT (2003) Sucrose increases calcium-dependent protein kinase and phosphatase activities in potato plants. Cell Mol Biol 49:959–964 Reddy A (2001) Calcium: silver bullet in signaling. Plant Sci 160:381–404 Roberts DM, Harmon AC (1992) Calcium-modulated proteins: targets of intracellular calcium signals in higher plants. Annu Rev Plant Physiol Plant Mol Biol 43: 375–414 Roldan M, Gomez-Mena C, Ruiz-Garcia L, Salinas J, MartinezZapater JM (1999) Sucrose availability on the aerial part of the plant promotes morphogenesis and Xowering of Arabidopsis in the dark. Plant J 20:581–590 Rolland F, Moore B, Sheen J (2002) Sugar sensing and signalling in plants. Plant Cell 14:S185–S205 Rudd JJ, Franklin-Tung VE (1999) Calcium signaling in plants. Cell Mol Life Sci 55:214–232 Sanders D, Pelloux J, Brownlee C, Harper JF (2002) Calcium at the crossroads of signaling. Plant Cell 14:S401–S417 Scrase-Field SAMG, Knight MR (2003) Calcium: just a chemical switch? Curr Opin Plant Biol 6:1–7 Schroeder JI, Thuleau P (1991) Ca2+ channels in higher plant cells. Plant Cell 3:555–559 Sheen J, Zhou L, Jang JC (1999) Sugars as signaling molecules. Curr Opin Plant Biol 2:410–418
191 Simmen U, Obenland D, Boller T, Wiemken A (1993) Fructan synthesis in excised barley leaves. Plant Physiol 101:459–468 Smeekens S (2000) Sugar-induced signal transduction in plants. Annu Rev Plant Mol Biol 51:49–81 Tähtiharju S, Sangwan V, Monroy A, Dhindsa R, Borg M (1997) The induction of kin genes in cold-acclimating Arabidopsis.thaliana Evidence of a role for calcium. Planta 203:442–447 Trewavas AJ, Malhó R (1998) Ca2+ signaling in plant cells: the big network! Curr Opin Plant Biol 1:428–433 Trewavas A, Gilroy S (1991) Signal transduction in plant cells. Trends Genet 7:356–361 Trewavas A (2003) Aspects of plant intelligence. Ann Bot 92:1– 20 Vijn I, Smeekens S (1999) Fructan: more than a reserve carbohydrate? Plant Physiol 120:351–360 Vitrac X, Larronde F, Krisa S, Decendit A, DeYeux G, Mérillon JM (2000) Sugar sensing and Ca+2-calmodulin requirement in Vitis vinifera cells producing anthocyanins. Phytochemistry 53:659–665 Wagner W, Wiemken A, Matile P (1986) Regulation of fructan metabolism in leaves of barley (Hordeum vulgare L. Cv. Gerbe). Plant Physiol 81:444–447 White P (2000) Calcium channels in higher plants. Biochim Biophys Acta 1465:171–189 Zhang W, Rengel Z, Kuo J (1998) Determination of intracellular Ca+2 in cells of intact wheat roots—loading of acetoxymethyl ester of Fluo-3 under low temperature. Plant J 15:147–151
123
