Calcium-Sensing Receptor Expression Is ... - Wiley Online Library

JOURNAL OF BONE AND MINERAL RESEARCH Volume 24, Number 7, 2009 Published online on February 16, 2009; doi: 10.1359/JBMR.090211 Ó 2009 American Society for Bone and Mineral Research

Calcium-Sensing Receptor Expression Is Regulated by Glial Cells Missing-2 in Human Parathyroid Cells Masahide Mizobuchi,1,2 Cynthia S. Ritter,1 Irina Krits,1 Eduardo Slatopolsky,1 Gregorio Sicard,3 and Alex J. Brown1

ABSTRACT: Glial cells missing-2 (Gcm2) is the key regulating transcription factor for parathyroid gland development. The continued expression of high levels of Gcm2 in mature parathyroid glands suggests that it is required for maintenance of parathyroid cell differentiation. The role of Gcm2 in parathyroid cell physiology, however, has not been fully studied. In this study, we examined the effects of Gcm2 silencing on cultured human parathyroid cells. Collagenase-dispersed human parathyroid cells from patients with chronic kidney disease were placed in monolayer cultures and infected with lentivirus expressing shRNA for human Gcm2. Seventy-two hours after infection, mRNA was processed and analyzed for Gcm2, PTH, vitamin D receptor (VDR), calcium-sensing receptor (CaR), 25-hydroxyvitamin D3 1-a-hydroxylase (1-OHase), and proliferating cell nuclear antigen (PCNA) by real-time PCR (qPCR). Protein expression of affected genes was analyzed by immunoblot 72 h after infection. Gcm2 mRNA and protein were decreased by 74.2 ± 12.2% (SD; n = 3 experiments; p < 0.01) and 67.5 ± 15.7% (n = 2; p < 0.01), respectively. CaR mRNA and protein were reduced by 47.8 ± 21.1% (n = 3; p < 0.01) and 48.1 ± 4.3% (n = 3; p < 0.01), respectively. However, VDR, PTH, 1-OHase, and PCNA were not significantly affected by Gcm2 silencing. Further analysis of CaR mRNA indicated that transcripts containing exon 1B, derived by transcription from CaR promoter 2, were downregulated (58.8 ± 19.27%; n = 3; p < 0.05) by Gcm2 silencing. Exon 1A–containing transcripts from promoter 1 were expressed at very low levels in the cultures. These results indicate that one function of Gcm2 is to maintain high levels of CaR expression in parathyroid cells. J Bone Miner Res 2009;24:1173–1179. Published online on February 16, 2009; doi: 10.1359/JBMR.090211 Key words: parathyroid gland, calcium-sensing receptor, glial cells missing, vitamin D receptor, transcription factor Address correspondence to: Alex J. Brown, PhD, Renal Division, Washington University School of Medicine, Box 8126, 660 S. Euclid Street, St. Louis, MO 63110, USA, E-mail: [email protected]

INTRODUCTION

G

missing-1 (Gcm1) and glial cells missing-2 (Gcm2) are mammalian orthologs of the Drosophila Gcm (dGcm). Although dGcm is essential for glial cell formation in Drosophila,(1–3) Gcm1 and Gcm2 are not crucial for development of the central nervous systems. Gcm1 is expressed in the placenta and is involved in labyrinth formation, whereas Gcm2 expression seems to be confined to the parathyroid glands and is crucial for parathyroid development. Targeted deletion of the Gcm2 gene led to a selective loss of parathyroid gland formation with no evidence of cell fate transformation.(4) The lack of parathyroid glands resulted in early death from severe hypocalcemia in ;30% of the homozygous mice. Surprisingly, the survivors had detectable circulating PTH, which was attributed to PTH production by a small group of cells in the thymus that expressed PTH, Gcm1, and the calciumsensing receptor (CaR). These findings suggested that LIAL CELLS

The authors state that they have no conflicts of interest.

Gcm1 may be capable of partially compensating for the loss of Gcm2. Mutations in Gcm2 have been reported in patients. In one patient, a large deletion of Gcm2 exons 1–4 resulted in severe hypocalcemia and no detectable PTH, suggesting that an ectopic source of PTH cannot compensate in humans as it does in mice.(5) A second patient, homozygous for a point mutation leading to glycine substitution for a serine in the DNA binding domain, had very low, but detectable, levels of PTH that were calcium regulated.(6) Exogenous expression of the mutant Gcm2 showed normal protein turnover and DNA binding, but 20-fold lower transactivation of an artificial promoter than wildtype Gcm2. A unique feature of Gcm2 is its persistent expression in mature parathyroid glands. Expression of Gcm2 mRNA has been reported in adult human parathyroid glands,(7,8) but Gcm2 protein and activity were not determined. Drosophila Gcm is only transiently expressed during glial cell determination, and Gcm1 expression is extinguished once placental morphogenesis is complete. The continued expression of Gcm2 in mature parathyroid tissue suggests a

1

Renal Division, Washington University School of Medicine, St. Louis, Missouri, USA; 2Division of Nephrology, Showa University School of Medicine, Tokyo, Japan; 3Department of Surgery, Washington University School of Medicine, St. Louis, Missouri, USA.

1173

1174

MIZOBUCHI ET AL.

continuing role for Gcm2 in maintaining parathyroid cell function. Gcm proteins are transcription factors with a conserved DNA binding domain and transcription activation domains. Drosophila Gcm directs the transcription of several genes involved in gliogenesis.(9) Ectopic misexpression of Gcm in Drosophila embryos activated numerous transcription factors, consistent with its role as a master regulator of gliogenesis. Less is known about the genes regulated by mammalian Gcms. Gcm1 has thus far been shown to regulate expression of aromatase(10) and syncytin.(11) The presence of Gcm2 in adult parathyroid glands suggests a continued transcriptional function. In this study, we silenced Gcm2 expression in human parathyroid cells and analyzed genes critical to parathyroid gland function.

MATERIALS AND METHODS Cell culture Parathyroid tissue was obtained from chronic kidney disease patients undergoing parathyroidectomy with consent of the patients and approval of the Human Research Protection Office of Washington University School of Medicine. The parathyroid tissue was dispersed with collagenase as previously reported for bovine parathyroid tissue.(12) Briefly, parathyroid tissue was sliced to 0.5 mm thickness with a Stadie Riggs tissue slicer (Thomas Scientific) and placed in a mixture of DME:Ham’s F-12 medium (50:50) containing 0.5 mM calcium and collagenase (3000 U/ml of collagenase XI-S; Sigma-Aldrich). The suspension (10 ml media/g tissue) was agitated in a shaking water bath at 378C for 90–120 min. Periodic passage of the mixture through the tip of a 10-ml pipette assisted in the disaggregation. The digested tissue was washed with culture medium containing DME:Ham’s F-12 (50:50), 1 mM CaCl2, 15 mM HEPES, 100 IU/ml penicillin, 100 mg/ml streptomycin, 5 mg/ml insulin, 2 mM glutamine, 1% nonessential amino acids, and 4% newborn calf serum and plated at a concentration of ;4 3 104 cells/cm2. The human embryonic kidney cell line (HEK293FT) was obtained from Invitrogen.

Lentiviral shRNA Gcm2 silencing was performed using commercial lentiviral shRNA vectors (Mission shRNA, catalog SHGLYCTRCN0000004954; Sigma-Aldrich). Virus was produced per manufacturer’s instructions in HEK293FT cells by cotransfection with packaging vectors. Medium containing virus was collected after 72 h, concentrated ;80-fold with Amicon Ultra 15 centrifugal filter units (100,000 MW cutoff; Fisher Scientific), and titered using the RETROtek HIV-1 p24 antigen ELISA (ZeptoMax). A nontargeted shRNA was used as a control.

Gcm-responsive reporter To show that the endogenous Gcm2 protein in mature human parathyroid glands retains transcriptional activity, a GFP reporter driven by a minimal promoter with an enhancer containing four consensus response elements

identified for the Drosophila Gcm (ATGCGGGT) was constructed and introduced into cells using the lentiviral vector pTRH1-mCMV-dscGFP (System Biosciences). The enhancer was created by annealing the primers, 59-AATTC ATGCGGGTACTACTCGATGCTAATGCGGGTGTC ATGACACTGCAATGCGGGTTCAGTGACTCATC GATGCGGGTA-39 and 59-CTAGTACCCGCATCGAT GAGTCACTGAACCCGCATTGCAGTGTCATGACA CCCGCATTAGCATCGAGTAGTACCCGCATG-39. The duplex, with 59-overhangs for EcoRI and SpeI, was ligated in the EcoRI/SpeI site in pTRH1-mCMV-dscGFP. Virus expressing the Gcm reporter was prepared in HEK293FT cells as described above.

Lentiviral Gcm2 expression vector For Gcm2 overexpression, a full-length human Gcm2 cDNA was isolated by RT-PCR of human parathyroid gland RNA using the primers 59-GTACCGGTTTCAGA ACCCTGGGCGGAAAG-39 and 59-CCCTCGAGATTT CCCTGCCTCCTGCCTG-39 and cloned into pCR2.1-TO PO (Invitrogen). The insert was excised with BamHI and XhoI and subcloned into the BamHI/XhoI sites (flanking lacZ) of pLenti4/V5-GW/lacZ (Invitrogen). Virus expressing Gcm2 cDNA was prepared in HEK293FT cells as described above.

Gcm2 silencing Parathyroid cell monolayers, 24 h after plating, were treated with polybrene (6 mg/ml) and the lentivirus expressing the shRNA. The ratio of infectious virus particles to cells (i.e., multiplicity of infection [MOI]) was ;50. After 24 h, the cells were placed in serum-free medium (the medium described above with 5 mg/ml holo-transferrin and 0.1% BSA fraction V substituted for 4% serum) for an additional 48 h. The cells were processed for RNA for qPCR analysis and/or for total protein for immunoblot analysis.

qPCR Total RNA was isolated using RNAzol Bee (Cinna/ Biotecx). Reverse transcription was carried out with SuperScript II (Invitrogen) as directed. qPCR was performed using SYBR Green (Sigma) in a Perkin Elmer Applied Biosystems Gene Amp 5700 Sequence Detection System. The primers for qPCR for Gcm2 (QT 00035602), CaR (QT00055944), PTH (QT00008834), VDR (QT01010170), 1-OHase (QT01173214), and PCNA (QT00024633) were obtained from Qiagen (QuantiTect Primer Assays). Parallel amplifications were performed with primers for the housekeeping gene GAPDH (QT00073247). The CaR transcript-specific qPCR primers were obtained from Invitrogen (CaR exon 1A forward 59-TCTAGTGCTGTG ATGGGTG-39, reverse 59-CCTGTTGCACTTGGTCTA C-39; CaR exon 1B forward 59-CAGACGCGCCTCTCCA AG-39, reverse 59-CTCGCACAGAGGCAGCTC-39. For correction of the amount of mRNA, the ratio of Gcm2, CaR, VDR, PTH, 1-OHase, CaR exon 1A, and 1B to GAPDH mRNA was calculated in each sample. The amount of each mRNA in the Gcm2-silenced samples was normalized to the value of nontargeted shRNA samples.

GCM2 REGULATION OF CAR

1175

FIG. 1. Characterization of Gcm2 antibody in parathyroid tissue. (A) Immunoblot analysis of Gcm2 was performed in human parathyroid glands. Tissue extracts of parathyroid glands from patients with primary (18) or secondary hyperparathyroidism (28) were resolved on 12% polyacrylamide gels, transferred to PDVF membranes, and incubated with anti-Gcm2 antiserum or preimmune serum. A single band of the expected size (55 kDa) was detected. Immunohistochemical staining of Gcm2 was performed in serial sections of a normal rat parathyroid gland using (B) antiserum to Gcm2 and (C) preimmune IgG control serum. Magnification, 3100. Immunohistochemical staining in a parathyroid gland from a patient with uremic secondary hyperparathyroidism (D). Magnificant, 3200.

Immunoblot and immunohistochemical analyses For immunoblot analysis, equal concentrations of parathyroid tissue extracts (15 mg protein) were resolved on 12% PAGE gels and transferred to PDVF membranes. Protein-loading consistency was verified by ponceau red staining of the membranes. Immunoblot analysis for Gcm2 was performed using specific antibodies to human Gcm2. Rabbit polyclonal antibodies for Gcm2 were raised against the peptide sequence CDFTNKQHGWKPALGKPSLVE that correspond to amino acids 325–344 of the human Gcm2 protein (Bethyl Laboratories). This sequence was chosen for its high immunogenicity and its uniqueness as determined by protein blast search. This human sequence shares 70% homology to the mouse Gcm2. Immunoblot analysis for CaR was performed using a polyclonal antibody against a 23-amino acid peptide (ADDDYGRPGIE KFREEAEERDIC) contained in the extracellular domain of the CaR that is conserved in human, bovine, and rat was developed in rabbit (Research Genetics, Huntsville, AL, USA) as previously characterized.(13) Briefly, the membranes were blocked for 1 h with PBS containing 0.1% Tween-20 and 5% nonfat dry milk. The membranes were incubated overnight at 48C with primary antibody or preimmune IgG. The membranes were incubated with anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP) for 1 h and developed with a Phototope–HRP western detection kit (New England Biolabs). PBS containing 0.1% Tween-20 was used to wash the membranes after incubations with the first and second antibodies. Immunohistochemical staining of Gcm2 protein was performed on formalin-fixed, paraffin-embedded parathyroid glands using the Gcm2 antibody and a commercial immunohistochemical staining kit (Histostain-Plus; Invitrogen). Briefly, the tissue was deparaffinized, rehydrated, and microwaved at high intensity for 8 min in 10 mM citric acid, pH 6.0. Slides were cooled for 10 min, washed with PBS, and blocked with 10% preimmune goat serum. The slides were incubated with primary antibody or preimmune

IgG overnight at 48C. Biotinylated secondary antibody was applied followed by a streptavidin–HRP conjugate. The immune complexes were visualized with AEC substratechromagen.

Statistics At least three individual human parathyroid preparations (unless stated otherwise) were used for each analysis. The results were evaluated by unpaired t-test.

RESULTS Expression of Gcm2 in mature parathyroid glands Although previous studies have reported Gcm2 mRNA in adult parathyroid glands, evidence for Gcm2 protein was lacking. Figure 1A shows that immunoblot analysis of human parathyroid extracts using an antibody raised to a Gcm2 peptide showed a single protein band of the expected size of ;55 kDa. Gcm2 protein was detected in parathyroid glands from patients with both primary and secondary hyperparathyroidism. Gcm2 was also highly expressed in normal bovine parathyroid cells (data not shown). Strong, positive immunohistochemical staining for Gcm2 is seen in a normal rat parathyroid gland (Figs. 1B and 1C) and a parathyroid gland from a patient with uremic secondary hyperparathyroidism (Fig. 1C).

Functional activity of endogenously expressed Gcm2 in human parathyroid cells A GFP reporter driven by a minimal promoter with four consensus Gcm binding sites (GcmRE-GFP) was introduced by lentiviral vector into human parathyroid cells (which express endogenous Gcm2) and the HEK293FT human embryonic kidney cell line (which do not express Gcm2). Activation of the GcmRE-GFP response element was evident only in the parathyroid cells (Fig. 2A versus 2C), verifying that endogenous Gcm2 in human parathyroid glands is transcriptionally active and that the reporter

1176

MIZOBUCHI ET AL.

FIG. 2. Gcm2 is transcriptionally active in human parathyroid cells. A Gcm-responsive GFP reporter was introduced into primary monolayer cultures of human parathyroid cells and a human embryonic kidney cell line (HEK293FT). Activation of the reporter was observed in parathyroid cells, which express endogenous Gcm2, but not in HEK293FT cells, which do not express Gcm2 (A vs. C). Activation of the reporter was seen in HEK293FT cells only with overexpression of Gcm2 (D). The promoterless vector control (mCMV-GFP) and the empty vector control (LacZ) showed no activation (B and E, respectively). Representative images of three experiments. Magnification, 3200.

was not active in cells that do not express Gcm2. Activation of the GcmRE-GFP response element was seen in the HEK293FT cells only when Gcm2 was overexpressed in these cells (Fig. 2D). The promoterless vector control for the response element (pTRH1-mCMV-dscGFP) and the empty vector control for GCM overexpression (pLenti4/ V5-GW/lacZ) showed no activation (Figs. 2B and 2E, respectively). In addition, no activation was seen when the HEK293FT cells were infected with the pTRH1-mCMVdscGFP vector control.

Silencing of Gcm2 with lentiviral-shRNAs To identify genes regulated by Gcm2, we used a gene silencing approach that takes advantage of the high efficiency of lentiviral infection of human parathyroid cells. cDNAs coding for shRNAs directed against Gcm2 or a nontarget shRNA were introduced using a lentiviral vector. Figure 3 shows that the shRNAs were efficient in reducing Gcm2 mRNA levels by 74.2 ± 12.2% (p < 0.01), with a corresponding decrease in Gcm2 protein (67.5 ± 15.7%; p < 0.01).

Gcm2 silencing reduces CaR expression The RNA and protein extracts from Gcm2-silenced parathyroid cells were analyzed for the expression of several genes that are critical for parathyroid gland function. The CaR was significantly affected by Gcm2 silencing, showing a 47.8 ± 21.1% (p < 0.01) reduction in mRNA levels and a corresponding decrease of 48.1 ± 4.3% (p < 0.01) in protein (Fig. 4). The CaR gene is under the control of two promoters that yield transcripts with alternate first exons.(14–16) Exon 1A–containing transcripts from promoter 1 were expressed at very low levels and could not be evaluated even with qPCR. The exon 1b–containing transcripts were much more abundant, and accounted for the Gcm2-regulated CaR expression, with exon 1b–containing transcripts decreased by 58.8 ± 19.3% (p < 0.05, n = 3 experiments) in Gcm2-silenced cells (Fig. 5). PTH (10% increase), VDR (20% decrease), and 1-OHase mRNA

FIG. 3. Silencing of Gcm2 in human parathyroid cells. Lentiviral particles were used to introduce cDNAs coding for shRNAs directed against Gcm2 or a nontarget shRNA control into primary monolayer cultures of human parathyroid cells. After 72 h, Gcm2 mRNA and protein were measured by qPCR and immunoblot analysis. (A) Gcm2 mRNA was decreased by 74.2 ± 12.2% (p < 0.01, n = 3 experiments). (B) Representative immunoblot showing a corresponding decrease in Gcm2 protein (67.5 ± 15.7%; p < 0.01, n = 2 experiments).

levels were not altered significantly by the Gcm2 silencing (Fig. 6). Of note, PCNA expression (20% increase) was not changed significantly, suggesting no direct role of Gcm2 in

GCM2 REGULATION OF CAR

1177

FIG. 5. Gcm2 regulates exon 1b–containing transcripts of the CaR. RNA extracts from primary monolayer cultures of human parathyroid cells treated with lentiviral constructs expressing Gcm2 shRNA or nontarget shRNA were analyzed for exon 1B– containing transcripts for the CaR mRNA by qPCR. Exon 1B– containing transcripts for the CaR mRNA was decreased 58.8 ± 19.3% (p < 0.05, n = 3 experiments).

FIG. 4. Gcm2 silencing decreases CaR gene expression. RNA and protein extracts from primary monolayer cultures of human parathyroid cells treated with lentiviral constructs expressing Gcm2 shRNA or nontarget shRNA were analyzed for CaR mRNA and protein by qPCR and immunoblot analysis, respectively. (A) CaR mRNA was reduced by 47.8 ± 21.1% (p < 0.01; n = 3 experiments). (B) Representative immunoblot showing a corresponding decrease in CaR protein (48.1 ± 4.3%; p < 0.01, n = 3 experiments).

cell proliferation. Gcm2 ablation in mice leads to apoptotic involution of the parathyroid primordium at E12.5,(17) but no alteration of cell phenotype or cell density was observed by microscopic evaluation in the Gcm2-silenced mature parathyroid cells (data not shown).

DISCUSSION Gcm2 is critical for parathyroid gland development, but details of its actions at the molecular level are lacking. Gcm2 is a member of the Gcm family of transcription factors. The Drosophila Gcm gene product is the primary controller of glial cell determination.(1–3) In embryos with mutant Gcm, the presumptive glial cells become neurons, whereas ectopic overexpression of Gcm promotes differentiation of presumptive neurons to glial cells. The Gcm

gene codes for a nuclear factor that binds to a consensus octameric DNA sequence found in many glial-specific genes.(18–21) During Drosophila development, Gcm is only transiently expressed and therefore is thought to only initiate glial cell development. The downstream genes complete and maintain glial cell differentiation. The mammalian Gcm proteins have a decidedly different role. During embryogenesis in the mouse, Gcm1 first appears at day 7.5 after conception in trophoblasts of the chorionic plate. After fusion of the embryonic mesoderm with the chorionic plate to form the labyrinth, Gcm1 is found in trophoblasts in areas of active branching of fetal blood vessels.(3) When placental morphogenesis is complete, Gcm1 expression is turned off. Gcm1 ablation leads to defective labyrinth formation and embryonic death at E9.5–E10.0.(22–24) Gcm2 was initially reported to be expressed primarily in the developing parathyroid glands.(25) Targeted deletion of the Gcm2 gene leads to a selective loss of parathyroid gland formation with no evidence of cell fate transformation,(4,17) because thymus development in the third pharyngeal pouch is normal. Studies of Gcm2 knockout mice showed that the parathyroid primordium never expresses PTH, has greatly reduced CaR levels, and undergoes apoptosis at E12.5.(17) The data presented here indicate that Gcm2 continues to be expressed and is active in mature parathyroid glands and cultured parathyroid cells. Silencing of Gcm2 in cultured human parathyroid cells leads to downregulation of the CaR, the first documented gene target for Gcm2. This observation likely explains the very high level of CaR expression in the parathyroid glands, compared with other cell types. Furthermore, our data indicate that the major transcript for CaR in cultured parathyroid cells contains exon 1B derived from promoter 2. During preparation of this manuscript, Gcm2 expression in HEK293 cells was reported by Canaff et al. to transactivate both CaR

1178

MIZOBUCHI ET AL.

FIG. 6. Lack of significant effect of Gcm2 silencing on PTH, VDR, 1-OHase, and PCNA. RNA extracts from primary monolayer cultures of human parathyroid cells treated with lentiviral constructs expressing Gcm2 shRNA or nontarget shRNA were analyzed for PTH, VDR, 1-OHase, and PCNA by qPCR (n = 3 experiments each). Although slight increases in PCNA and PTH mRNAs and a slight decrease in VDR mRNA were seen with Gcm2 silencing, these changes were not significant.

promoters,(26) in agreement with our findings of Gcm2 regulation of the endogenous CaR promoter in parathyroid cells. Although these studies were carried out in pathological parathyroid cells, the results likely hold true for normal parathyroid cells, although this has not been directly tested. However, the aforementioned study of Canaff et al. showed that regulation of CaR promoter activity is not limited to abnormal (hyperplastic) parathyroid cells. Interestingly, mRNAs for PTH (10% increase) and the VDR (20% decrease) did not seem to be significantly affected by Gcm2 silencing. In vivo studies indicated that dietary calcium, presumably acting through the CaR, can regulate VDR levels in rat parathyroid glands(27,28); thus, reduced CaR expression would be expected to decrease VDR expression. Our results suggest that Gcm2 may be exerting an opposing CaR-independent action on the VDR. Similarly, CaR activation regulates PTH mRNA levels by stimulating transcript degradation,(29,30) and Gcm2 silencing would be expected to increase PTH. Because PTH mRNA was unaltered, Gcm2 may exert a direct stimulation of PTH expression that is masked by its effects on the CaR. Further studies will be needed to clarify this potentially complex regulation. In conclusion, we showed that the parathyroid cell CaR is a target gene for the developmental transcription factor Gcm2. The stimulatory effect of Gcm2 on CaR gene expression likely is responsible, at least in part, for the high levels of CaR in the parathyroid glands. Studies are underway to identify additional target genes for Gcm2 to define the roles of this transcription factor in the developing and mature parathyroid glands.

ACKNOWLEDGMENTS This work was supported in part by the Center for Dreceptor Activation Research (CeDAR), Research in Renal Diseases Washington University, Washington University Center for Kidney Disease Research O’Brian Center

(5P30DK07933), Diabetes Research Training Center (DRTC; DK-20579), and The Kidney Foundation, Japan (JKFB08-9).

REFERENCES 1. Hosoya T, Takizawa K, Nitta K, Hotta Y 1995 Glial cells missing: A binary switch between neuronal and glial determination in Drosophila. Cell 82:1025–1036. 2. Jones BW, Fetter RD, Tear G, Goodman CS 1995 Glial cells missing: A genetic switch that controls glial versus neuronal fate. Cell 82:1013–1023. 3. Vincent S, Vonesch JL, Giangrande A 1996 Glide directs glial fate commitment and cell fate switch between neurones and glia. Development 122:131–139. 4. Gunther T, Chen ZF, Kim J, Priemel M, Rueger JM, Amling M, Moseley JM, Martin TJ, Anderson DJ, Karsenty G 2000 Genetic ablation of parathyroid glands reveals another source of parathyroid hormone. Nature 406:199–203. 5. Ding C, Buckingham B, Levine MA 2001 Familial isolated hypoparathyroidism caused by a mutation in the gene for the transcription factor GCMB. J Clin Invest 108:1215–1220. 6. Thomee C, Schubert SW, Parma J, Le PQ, Hashemolhosseini S, Wegner M, Abramowicz MJ 2005 GCMB mutation in familial isolated hypoparathyroidism with residual secretion of parathyroid hormone. J Clin Endocrinol Metab 90:2487–2492. 7. Correa P, Akerstrom G, Westin G 2002 Underexpression of Gcm2, a master regulatory gene of parathyroid gland development, in adenomas of primary hyperparathyroidism. Clin Endocrinol (Oxf) 57:501–505. 8. Kebebew E, Peng M, Wong MG, Ginzinger D, Duh QY, Clark OH 2004 GCMB gene, a master regulator of parathyroid gland development, expression, and regulation in hyperparathyroidism. Surgery 136:1261–1266. 9. Egger B, Leemans R, Loop T, Kammermeier L, Fan Y, Radimerski T, Strahm MC, Certa U, Reichert H 2002 Gliogenesis in Drosophila: genome-wide analysis of downstream genes of glial cells missing in the embryonic nervous system. Development 129:3295–3309. 10. Yamada K, Ogawa H, Honda S, Harada N, Okazaki T 1999 A GCM motif protein is involved in placenta-specific expression of human aromatase gene. J Biol Chem 274:32279–32286. 11. Yu C, Shen K, Lin M, Chen P, Lin C, Chang GD, Chen H 2002 GCMa regulates the syncytin-mediated trophoblastic fusion. J Biol Chem 277:50062–50068.

GCM2 REGULATION OF CAR 12. Ritter CS, Slatopolsky E, Santoro S, Brown AJ 2004 Parathyroid cells cultured in collagen matrix retain calcium responsiveness: importance of three-dimensional tissue architecture. J Bone Miner Res 19:491–498. 13. Brown AJ, Ritter CS, Finch JL, Slatopolsky EA 1999 Decreased calcium-sensing receptor expression in hyperplastic parathyroid glands of uremic rats: Role of dietary phosphate. Kidney Int 55:1284–1292. 14. Garrett JE, Capuano IV, Hammerland LG, Hung BC, Brown EM, Hebert SC, Nemeth EF, Fuller F 1995 Molecular cloning and functional expression of human parathyroid calcium receptor cDNAs. J Biol Chem 270:12919–12925. 15. Chikatsu N, Fukumoto S, Takeuchi Y, Suzawa M, Obara T, Matsumoto T, Fujita T 2000 Cloning and characterization of two promoters for the human calcium-sensing receptor (CaSR) and changes of CaSR expression in parathyroid adenomas. J Biol Chem 275:7553–7557. 16. Canaff L, Hendy GN 2002 Human calcium-sensing receptor gene. Vitamin D response elements in promoters P1 and P2 confer transcriptional responsiveness to 1,25-dihydroxyvitamin D. J Biol Chem 277:30337–30350. 17. Liu Z, Yu S, Manley NR 2007 Gcm2 is required for the differentiation and survival of parathyroid precursor cells in the parathyroid/thymus primordia. Dev Biol 305:333–346. 18. Akiyama Y, Hosoya T, Poole AM, Hotta Y 1996 The gcmmotif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc Natl Acad Sci USA 93:14912–14916. 19. Schreiber J, Sock E, Wegner M 1997 The regulator of early gliogenesis glial cells missing is a transcription factor with a novel type of DNA-binding domain. Proc Natl Acad Sci USA 94:4739–4744. 20. Miller AA, Bernardoni R, Giangrande A 1998 Positive autoregulation of the glial promoting factor glide/gcm. EMBO J 17:6316–6326. 21. Granderath S, Bunse I, Klambt C 2000 gcm and pointed synergistically control glial transcription of the Drosophila gene loco. Mech Dev 91:197–208. 22. Anson-Cartwright L, Dawson K, Holmyard D, Fisher SJ, Lazzarini RA, Cross JC 2000 The glial cells missing-1 protein

1179

23.

24. 25.

26.

27.

28.

29.

30.

is essential for branching morphogenesis in the chorioallantoic placenta. Nat Genet 25:311–314. Schreiber J, Riethmacher-Sonnenberg E, Riethmacher D, Tuerk EE, Enderich J, Bosl MR, Wegner M 2000 Placental failure in mice lacking the mammalian homolog of glial cells missing, GCMa. Mol Cell Biol 20:2466–2474. Rinkenberger J, Werb Z 2000 The labyrinthine placenta. Nat Genet 25:248–250. Kim J, Jones BW, Zock C, Chen Z, Wang H, Goodman CS, Anderson DJ 1998 Isolation and characterization of mammalian homologs of the Drosophila gene glial cells missing. Proc Natl Acad Sci USA 95:12364–12369. Canaff L, Zhou X, Mosesova I, Cole DE, Hendy GN 2008 Glial cells missing-2 (GCM2) transactivates the calciumsensing receptor gene: Effect of a dominant-negative GCM2 mutant associated with autosomal dominant hypoparathyroidism. Human Mutat 30:85–92. Russell J, Bar A, Sherwood LM, Hurwitz S 1993 Interaction between calcium and 1,25-dihydroxyvitamin D3 in the regulation of preproparathyroid hormone and vitamin D receptor messenger ribonucleic acid in avian parathyroids. Endocrinology 132:2639–2644. Brown AJ, Zhong M, Finch J, Ritter C, Slatopolsky E 1995 The roles of calcium and 1,25-dihydroxyvitamin D3 in the regulation of vitamin D receptor expression by rat parathyroid glands. Endocrinology 136:1419–1425. Moallem E, Kilav R, Silver J, Naveh-Many T 1998 RNAProtein binding and post-transcriptional regulation of parathyroid hormone gene expression by calcium and phosphate. J Biol Chem 273:5253–5259. Ritter CS, Pande S, Krits I, Slatopolsky E, Brown AJ 2008 Destabilization of parathyroid hormone mRNA by extracellular Ca2+ and the calcimimetic R-568 in parathyroid cells: Role of cytosolic Ca and requirement for gene transcription. J Mol Endocrinol 40:13–21.

Received in original form September 22, 2008; revised form December 23, 2008; accepted February 11, 2009.