Jun 11, 1997 - Department of Poultry Science and Alabama Agricultural Experiment Station, Auburn Unk~ersity ... Auburn University. .... borate-EDTA buffer at 80 V for 40 min. ..... United States. ... In: Nachamkin, I., Blazer, M.J., Tompkins.
veterinary microbiology Veterinary
Microbiology
58 (1997) 61-71
Campylobacter fetus by PCR targeting variable regions of the 16s rDNA O.A. Oyarzabal a, T.V. Wesley b, KM. Harmon b, L. Schroeder-Tucker ‘, J.M. Barbaree d, L.H. Lauerman ‘, S. Backert d, D.E. Conner a,* ’ Department of Poultry Science and Alabama Agricultural Experiment Station, Auburn Unk~ersity Auburn, AL 36849. USA b Enteric Diseases and Food Safe@ Research Unit. National Animal Disease Center. USDA Agricultural Research Service. Ames, IA 50010, USA National Veterinay Services Laboratory, USDA - APHIS. Ames, IA 50011, USA * Department of Botany and Microbiology. Auburn University. Auburn, AL 36849, USA ’ C.S. Roberts Veterinary Diagnostic Laboratory Auburn, AL 36831. USA Received 22 January
1997; accepted
11June 1997
Abstract Campylobacter fetus is recognized as a human and animal pathogen. The isolation and differentiation of C. fetus in diagnostic laboratories is hindered by its relatively slow growth and lack of distinguishing biochemical characteristics. We developed a fast. reliable PCR assay that specifically amplifies a 554-bp segment of the 16s rDNA from C. fetus. Fifty-two ATCC reference strains and 255 bacterial field isolates comprising the genera Campylobacter, Arcohacter, Helicobacter, Escherichia, Listeria, Salmonella, and Wolinella were evaluated using this PCR protocol. Only C. fetus strains were amplified. Sequence analysis of amplicons from ATCC and field strains of C. fetus confirmed the presence of the target DNA fragment. The detection limit of the technique was 5.9 X 10’ CFU/ml. This PCR assay can yield reliable detection of C. ,fetus within 3 h after isolation of presumptive colonies on agar plates. 0 1997 Elsevier Science B.V. Keywords:
Campylobacterfetus;
* Corresponding auburn.edu
author.
Tel.:
PCR; 16s rRNA; Diagnosis-bacteria
+ 1-334-844-2639;
fax:
+ l-334-8442641;
0378-l 135/97/$17.00 0 1997 Elsevier Science B.V. All rights reserved PIf s0378-1135(97)00148-x
e-mail:
dconner@acesag.
62
O.A. Oyurzabal et al./ Veterinary Microbiology 58 (19971 61-71
1. Introduction The genus Campylobacter is composed of curved to spiral Gram-negative bacteria with a characteristic darting motility when grown under microaerophilic conditions (Nachamkin, 1995). This genus encompasses bacteria of significance in both veterinary and human medicine (Garcia et al., 1983; Mishu et al., 1992). C. fetus is divided into two subspecies on the basis of mechanisms of transmission and clinical presentation in livestock (Garcia et al., 1983; Mishu et al., 1992; Roop et al., 19841. C. fetus subsp. fetus is transmitted orally and induces abortion mainly in sheep but also in cattle. In humans, C. fetus subsp. fetus has been implicated in outbreaks and sporadic cases of human campylobacteriosis, primarily in the immunocompromised patient (Blaser et al., 1987, 1988; Carbone et al., 1985; Devlin and McIntyre, 1983; Garcia et al., 1983; Morrison et al., 1990). Although infrequent, human foodbome outbreaks of C. fetus subsp. fetus have resulted from the consumption of raw beef, raw milk and cottage cheese (Mishu et al., 1992). In a 2-year surveillance study, from 1987 to 1989, the Centers for Disease Control and Prevention (CDC) reported 122 human cases of C. ,fetus subsp. fetus infections (Mishu et al., 1992). C. fetus subsp. venerealis is regarded exclusively as a venereal pathogen of cattle that interferes with placentation with consequent infertility (Garcia et al., 1983). There is no confirmed report of human infection due to C. fetus subsp. venerealis (Roop et al., 1984; Mishu et al., 1992; Nachamkin, 1995). Since certain national trade regulations prohibit the export of cattle carrying C. fetus subsp uenerealis (Eaglesome et al., 19951, differentiation of C. fetus from nonpathogenic commensals, such as C. sputorum bv. bubulus, is critical. In livestock, recovery of Campylobacter-like organisms from cervical mucus, preputial washings or intestinal contents of aborted fetuses is suggestive of C. fetus; although, commensal Campylobacter spp. can also be recovered from semen and preputial samples. For laboratory identification, growth at 25°C in a microaerobic atmosphere (5% 02, 10% CO,, 85% N?), inability to grow at 42”C, production of H,S detected by lead acetate paper, and susceptibility to cephalothin distinguish C. fetus from other Campylobacter species (Edmonds et al., 1985). However, atypical C. fetus strains that grow at 42°C do not produce H, S detectable by lead acetate paper, and are resistant to cephalothin as have been reported (Edmonds et al., 1985; Mishu et al., 1992). Thus, a test that provides unambiguous identification of this organism is needed. Nucleic acid-based methods have offered an adjunct to the biochemical testing of Campylobacter spp. (On, 1996). Based on analysis of the gene encoding 16s rRNA, Wesley et al. (1991) designed an oligonucleotide probe specific for C. fetus. The probe differentiated C. fetus from C. hyointestinalis, two species that share a 98% sequence homology in the 16s rDNA. Later, PCR amplification of Campylobacter specific 16s rDNA sequences followed by dot blot hybridization of the resulting product with the C. fetus probe was also shown to be specific for C. fetus (Blom et al., 1995). Amplification of a 283-bp fragment of 16s rRNA sequences common to Campylobacter, Helicobacter, and Arcobacter by PCR with subsequent restriction enzyme digestion of the amplicon has also been used to differentiate several Campylobacter-like organisms.
O.A. Oyarzabal et al. / Veterinary+ Microbiology
58 (1997) 61-71
63
including C. fetus (Cardarelli-Leite et al., 1996). In that study, discrimination of C. fetus from C. hyointestinalis required the digestion of the PCR product with at least three restriction enzymes (Ava I, Xho I, Hue II), thus increasing the time needed for species identification. In another study, PCR amplification of a 362-bp hypervariable region of 16s rDNA of C. ,fetus amplified C. fetus and other Campylobacter species. Thus, to identify C. ,fetus, restriction endonuclease digestion of the PCR product was required (Eaglesome et al., 1995). Bastyns et al. (1994) designed a specific PCR assay for C. fetus that targets the 23s rDNA, but which appeared to require purified DNA as the template in order to avoid false negative results. Although these nucleic-acid methods are useful diagnostic tools, they require multiple steps. Therefore. the objective of the current study was to develop a rapid, efficient and reliable PCR assay utilizing primers derived from the 16s rDNA for specific and direct identification of C. ,fetus.
2. Materials 2.1. Bacterial
and methods strains and DNA extraction
The bacterial ATCC reference strains used in this study are listed in Table 1. The field strains of C. fetus evaluated in the study were recovered from livestock and humans. These strains were identified to the species level by the submitting laboratory on the basis of morphology, motility, oxidase and catalase activity and failure to generate H,S in triple sugar iron (TSI) slants. Fifty-seven of these field isolates have been previously confirmed as C. fetus by hybridization with a probe targeting the 16s RNA (Wesley et al., 1991). Table 2 shows the bacterial held strains tested in this study. All bacterial strains were cultured on brain heart infusion with 1% agar (Difco Laboratories, Detroit, MI, USA), tryptic soy agar (Difco) or Mueller-Hinton agar (Difco) supplemented with 510% defibrinated bovine or horse blood (Unipath, Ballingstroke, UK) and 0.6% yeast extract (Difco). Listeria monocytogenes was cultured on modified Oxford medium (Difco) at 37°C for 48 h. DNA was purified by cesium chloride centrifugation (Wesley and Bryner. 1989) or extracted from bacterial suspensions by boiling (Blom et al., 1995). 2.2. PCR protocol 2.2.1. Primers The alignment and comparison of the 16s rRNA gene sequences from Campylobacter and Arcobacter spp. were done with PC/Gene (IntelliGenetics, Mountain View, CA). Sequences were electronically retrieved from GenBank. Short sequences of hypervariable regions within the genes were selected for the generation of a set of specific primers for C. fetus (Fig. 1). Species included in the analysis and their accession number are: A. skirrowii (L14627), C. coli (LO4312, M.590731, C. .fetus (LO43 141, C. fetus subsp. fetus (M650121, C. fetus subsp. venerealis CM6501 l), C. hyointestinalis (M65009, M65010), C. jejuni (LO43 15, L14630, M59298). C. lari (LO43 161, and C. sputorum (LO43 19). Primers were synthesized by Life Technologies (Grand Island. NY).
O.A. Oyarzabal et al. / Veterinary Microbiology 58 (1997) 61-71
64 Table 1 Specificity
of the C. fetus PCR assay for ATCC strains as determined
by the generation
Species
ATCC” No.
Amplification
C. fetus subsp. fetus
27374 33246 33241 33248 33249 33293 19438 33561 33559 43473 43484 33231 35224 33709 51209 51729 51798 35217 33560 35918 35920 35922 49349 35221 35222 35223 43675 43264 43265 49354 33238 51146 33562 43954 49815 49616 49615 43158 51132 51399 51400 33236 33387 35684 43112 43504 43629 43579 49503
+ + + + + + + + _ _ _ _ _ _ -
C. fetus subsp. rlenerealis C. coli
C. concisus C. curuus C. fecaiis C. helceticus C. hyoilei C. hyointestinalis C. jejuni
C. lari
C. mucosalis
C. rectus
C. showae C. sputorum subsp. bubulus C. upsaliensis Arcobacter butzleri A. cryoaerophila A. skirrowii
Bacteroides gracilis B. ureolyticus Helicobacferfennelliae H. mustelae H. pylori
-
-
of a 554-bp product
with C. fetus primersb
O.A. Oyarzabal et al. / Veterinay
Microbiology
b5
58 (1997) 61-71
Table 1 (continued) Species Wolinella succinogenes E. coli Listeria monocytogenes
ATCC” No.
Amplification
29543 15144 15313
_ _ _
“American Type Culture Collection. ‘The plus sign (+) means amplification conditions.
and the minus
sign (-)
with C. ferus primersb
means
no amplification
under
PCR
2.2.2. Mix The PCR mix consisted of 5 ~1 of GeneAmp PCR 10 X buffer, 2.5 U of Tuq DNA polymerase (Perk&Elmer Cetus, Norwalk, CT), 150 PM (each) of deoxyribonucleotides (dATP, dTTP, dCTP, dGTP), 1 mM of M&l,, 50 ng of each primer, and 5 ~1 of the appropriate DNA sample. Negative controls consisted of all reagents except DNA template (Kwok and Higuchi, 1989). PCR amplification was performed in 50 ~1 aliquots. Samples were incubated in a DNA thermal cycler (Perkin Elmer Cetus, Norwalk. CT) for 2 min at 94°C to denature DNA, then cycled 25 times at 94°C for 30 s. 55°C for 30 s, and 72°C for 30 s. Final extension was performed at 72°C for 5 min. 2.2.3. Detection of amplified products Amplified products were detected by electrophoresis in 1.3% borate-EDTA buffer at 80 V for 40 min. The gels were stained and visualization achieved by photographing or by the use of (Gel-Dot System) with a Molecular Analyst computer program Hercules, CA).
agarose in 0.5 X Triswith ethidium bromide a UV transilluminator (Bio-Rad Laboratories,
2.2.4. Sequencing of amplfied products The amplicons from strains C. fetus spp. fetus ATCC 27374, NADC 3755 and NADC 5077, and C. fetus spp. r~erzerealis ATCC 19438 were sequenced (Scott Ritchey Table 2 Reactivity
of bacterial
field strains with the C. fetus PCR assay
Species
Number of strains
Source”
Amplification with C. fetus primersb
Cwnpylobucter fetus (fetus / renerealis) C. coli C. jejuni C. hyointestinalis C. lari C. spurorum subsp. bubulus Arrobncter burden’ A. .skirrow~ii E. coli Sulmonella spp. Lisreria monocytogenes
92 5 18 64 12 15 22 12 6 3 6
NADC NADC NADC NADC NADC NVSL NADC NADC FML FML FML
+ _ _ _ _ _ _
“NADC, USDA-ARS National Animal Disease Center: NVSL, USDA-APHIS, National Veterinary Services Laboratory; FML, Food Microbiology Laboratory, Poultry Science Department. ‘The plus sign ( + ) means amplification and the minus ( -) sign means no amplification with PCR.
66
O.A. Ovarzabal et al./ Veterinaq Microbiology 58 (IY97) 61-71 A (5,-X’)
43% Cfetus
(fetushenerealis)
469
TTTPTACCTAA
C.hvointestinalis
C.jeiuni. Ccoli and u
G.....................C.. . ..c.........
..TTC.............
C.sputomm
CT.T........TA..........A...
A.skirrowii
TA..TAAG.AG.TA.........TTAT.
B (5’-3’) 969
998 C.fetus (fehhenerealis)
GAGAATAGAGAGATTCTCTAATCAACCTATATAG
C.hvointestinalis
T..............AC...A.T.......
C.ieiuni. Chi
T........AT..C..GA.T.......
c.coli
A.........T..C..GA.T.......
c.s!Jutonml
..AG........CTA....A...T......
A.skirrowii
..C.TAGT..GAA..T.TC.AG.GAGA...
Fig. 1. Alignment and comparison of sequences encoding 16s rDNA of Campdobacter and Arcobacrer spp. Nucleotides that differ from C. fetus are the only ones indicated. Underlined sequences indicate the position of primers (A: forward primer. B: reverse primer).
Research Center, Auburn University) using internal primers and a non-radioactive, fluorescent dye terminator (ddNTP) nucleotide sequencer (Applied Biosystems Division, Perkin Elmer, Foster City, CA). The internal primers were: CFU (5’-TAA TGC GTG AAA GCG TGG G-3’) and CFD (5’-TTT AGG GCG TGG ACT ACC AGG G-3’). Results were compared with sequences from GenBank. 2.2.5. Sensitiuit?, qf the PCR assay Serial ten-fold dilutions of a 72-h broth culture of C. fetus spp. fetus (NADC 3755) were made. An aliquot (100 ~1) from each dilution was boiled for DNA extraction and PCR performed as described. Tryptic soy agar supplemented with 5% defibrinated horse blood was inoculated with 0.1 ml in triplicate from each dilution. After incubation (72 h, 37”C), colonies were enumerated.
3. Results Alignment of published 16s rDNA sequences of C. fetus with other Campylobacterlike organisms indicated a region of mismatches which would be suitable for specific
O.A. 0mr:abul
rf al. / Veterinag
Microbiology
58 ( IY97161-71
67
PCR amplification of C. fetus. As a result, two primers were designed. The forward primer CF441 (T-GTT AGG GAA GAA CAA TGA CGG-3’) corresponded to nucleotide 441 through 461 and the reverse primer, CF995 (T-TTA TCT CTA AGA GAT TAG TTG G-3’), corresponded to bases 974 through 995. The forward primer presented only one base difference between C. fetus and C. hyointestinalis, while the reverse primer had a four-base discrepancy (Fig. 1). Campylobacter species that are more distantly related phylogenetically to C. fetus have multiple base pair discrepancies (Fig. 1). PCR amplification of C. fetus subsp. fetus strains ATCC 27374, NADC 3755, NADC 5077 and C. fetus subsp. venerealis ATCC 19438 with primers CF441 and CF995 yielded amplicons of the predicted 554-bp size. The PCR products were sequenced and compared with the following 16s rDNA accessions from GenBank: C. fetus (LO4314), C. fetus subsp. fetus (M65012), C. fetus subsp. venerealis (M6501 I), C. hyointestinalis (M65009, M65010), C. jejuni (LO43 15, L14630, M59298). C. lari (LO43 16), and C. sputorum (LO43 19). Sequencing of the 554-bp products revealed 100% homology with C. fetus (LO43 14), C. fetus subsp. fetus (M650121, C. fetus subsp. rlenerealis (M6501 I), thus confirming the PCR product as specific for C. fetus. Following confirmation by sequencing that the amplicon was unique to C. fetus, the specificity of the PCR assay was further assessed by screening ATCC reference strains of Campylobacter, including C. fetus subsp. venereal& C. fetus subsp. fetus, C. l~~ointestinalis, and C. sputorum bv. bubulus, Arcobacter, and Helicobacter (Table 1). Specificity of the PCR assay was also determined by screening the laboratory strains of Arcobacter, Helicobacter, Escherichia, Salmonella, and Listeria (Table 2). The PCR assay amplified reference ATCC and laboratory strains of C. fetus subsp. clenerealis and C. ~fetus subsp. fetus, but none of the other strains tested. To evaluate the suitability of the PCR assay for diagnostic purposes, we examined field isolates which had been biochemically identified as C. fetus by other laboratories. A number of these strains had been previously sent to us for confirmation with the probes specific for C. fetus and C. hyointestinalis previously described (Wesley et al.. 1991). All but six of the strains designated as C. fetus by the initiating laboratory
bp
600 t 300 ’ 100 ’ Fig. 2. Agarose gel electrophoresisof PCR products from Cumpylobacfer
and Arcobacrer spp, M: 100.bp marker; l-4: ATCC and field isolates of C. ferus: 5: C. /z~oinrestidis; 6: C. sputorum; 7: C. jejwzi 8: C. ~di; 9: A. burz,kri; 10: A. skirrowii.
68
O.A. Oyzrzabal
et al. / Veterinaq
Microbiology
58 (19971 61-71
Fig. 3. (A-B) PCR amplification of field isolates of C. fetus.The assay equally amplified C. fetus subsp. fetus and C. fetus subsp. L*enerealis. The molecular weight marker VI (Boehringer-Mannhemim. Indianapolis, IN) was used for bp size comparisons.
generated the 554-bp fragment characteristic of C. fetus. Typical electrophoretic results indicating the 554-bp fragment of C. fetus subsp. fetus and C. fetus subsp. uenerealis are shown in Figs. 2 and 3. No amplicon was observed when strains identified as other Cumpylobacter species were used as the template. The six field strains originally identified as C. fetus that failed to amplify with our technique were subsequently reexamined by our laboratory and identified biochemically as C. hyointestinalis (n = l), C. jejuni (n = 3), C. coli (n = l), and C. mucosalis (n = 1). Thus, amplification occurred only with C. fetus. PCR amplification of C. fetus was achieved using cesium chloride-purified DNA and DNA extracted by boiling bacterial suspensions freshly harvested from either blood agar or from frozen bacterial stock cultures. The PCR assay detection limit was 5.9 X lo3 CFLJ/ml or 29 CFU per 5 ~1 of the PCR template prior to amplification.
O.A. Oyarzabal et al./ Veterinary Microbiology
58 (1997161-71
69
4. Discussion The present report describes PCR primers that specifically target a 554-bp segment of the 16s rRNA gene of C. fetus. Verification that the PCR assay was specific for C. fetus was determined by nucleic acid sequencing of the 554-bp product and comparison with GenBank accessions. Sequences of the 554-bp amplicons from C. fetus subsp. fetus ATCC 27374, C. fetus subsp. venerealis ATCC 19438 and two field isolates of C. fetus (NADC 3755, NADC 5077) were identical only to the hypervariable region of the 16s rRNA gene of C. fetus subsp. fetus and C. fetus subsp. uenerealis. The specificity of our technique was assessed by screening reference ATCC and field strains of Campylobacter species, including C. fetus, C. hyointestinalis, C. sputorum bv. bubulus, C. jejuni, and C. coli. Of the 106 strains submitted to us as C. fetus (ATCC and field isolates), 94% (100 out of 106) yielded the 554-bp amplicon characteristic of C. fetus. The six strains that did not amplify were characterized biochemically as C. hyointestinalis, C. jejuni, C. coli, and C. mucosalis. All strains of C. fetus subsp. fetus and C. fetus subsp. r!enerealis were equally amplified. Thus, amplification occurred with all field strains of C. fetus. No amplification was seen with any other species of Cumpylobacter, Arcobacter, Helicobacter, Escherichia, Salmonella, or Listeria. The availability of 16s rDNA sequences from C’umpylobacter spp. has prompted a search for nucleic acid based methods to complement biochemical testing for species identification (On, 1996). Probes targeting the 16s rRNA gene have been reported for C. fetus and C. hyointestinalis (Wesley et al., 1991). In addition, PCR assays amplifying the 16s rRNA gene have been described for Cumpylobacter spp. (Blom et al., 1995; Cardarelli-Leite et al., 1996; Giesendorf et al., 1992; Stonnet and Guesdon, 1993; Uyttendaele et al., 1994). For the specific identification of C. fetus, amplification of a 600-bp segment within the 16s rRNA gene common to Campylobacter spp. followed by hybridization with the C. fetus probe was described by Blom et al. (1995). Amplification of 16s rDNA sequences followed by restriction endonuclease digestion of the PCR product has been also shown as a method to identify C. fetus (Eaglesome et al., 1995; Cardarelli-Leite et al., 1996). Alignment of the hypervariable region of the 16s rDNA has indicated that a single base mismatch (position 811) differentiates C. fetus subsp. fetus from C. fetus subsp. uenerealis (Wesley et al., 1991). Therefore, no attempt was made in this study to design PCR primers to differentiate the two subspecies. Instead, efforts were made rather to develop an assay to clearly differentiate C. fetus from other Campylobacter-like organisms. The Campylobacter hyointestinalis has been isolated from the intestine of pigs, cattle and other mammals (Gebhart et al., 1985; Grau, 1988), but not from the reproductive tract. DNA hybridization (Roop et al., 1984; Edmonds et al.. 1985) and sequence comparison of 16s rRNA gene have shown that C. fetus is most closely related to C. hyointestinalis, with which it shares a 98% homology (Wesley et al., 1991). However, despite this extensive DNA homology, the C. fetus PCR assay did not amplify any of the C. hyointestinalis isolates examined in this study. Campylobacter sputorum bv. bubulus is a commensal of the bovine genital tract and is morphologically indistinguishable by dark-field microscopy from C. fetus. In certain
70
O.A. Oyarzabal et al./ Veterinary Microbiology
58 (1997) 61-71
countries (like Canada), trade restrictions ban the importation of bulls or semen harboring C. fetus (Eaglesome et al., 199.5). Thus, any assay which is specific for C. fetus must not cross react with C. sputorum bv. bubulus. Our C. fetus PCR assay failed to amplify the C. sputorum bv. bubulus isolates examined in this survey. Typical Campylobacter-like morphology under dark-field and lack of production of H,S in TSI are useful in identifying C. fetus (Barrett et al., 1988; Garcia et al., 1983). However, these tests are cumbersome, time consuming and subject to ambiguities. The PCR assay described herein specifically targets a 554-bp segment of the 16s rRNA gene of C. fetus and does not require hybridization or endonuclease digestion of the amplicon.
Acknowledgements We thank Sharon Franklin for her technical assistance in DNA extraction and maintenance of the cultures. and Allison Paulk for her assistance with the PCR tests.
References Barrett, T.J., Patton, C.M., Morris, G.K., 1988. Differentiation of Campylobacter species using phenotypic characterization. Lab. Med. 19, 96- 102. Bastyns, K.. Chapelle, S., Vandamme, P., Goossens. H., De Wachter, R., 1994. Species-specific detection of campylobacters important in veterinary medicine by PCR amplification of 23s rDNA areas. Syst. Appl. Microbial. 17, 563-568. Blaser, M.J., Smith, P.F., Hopkins, J.A., Heinzer, I.. Bryner, J.H., Wang, W.-L.L.. 1987. Pathogenesis of Cumpylobacter fetus infections: serum resistance associated with high-molecular-weight surface proteins, J. Infect. Dis. 155, 696-706. Blaser, M.J., Smith, P.F., Repine, J.E.. Joiner, K.A., 1988. Pathogenesis of Campdobncterfetus infections. I. Clin. Invest. 81, 1434-1444. Blom, K., Patton, C.M., Nicholson, M.A., Swaminathan, B., 1995. Identification of Campylobacter fetus by PCR-DNA probe method. J. Clin. Microbial. 33, 1360-1362. Carbone, K.M., Heinrich, M.C., Quinn. T.C., 1985. Thrombophlebitis and cellulitis due to Campylobacter fetus ssp. fetus. Medicine 64, 244-250. Cardarelli-Leite, P., Blom, K., Patton. C.M., Nicholson, M.A., Steigerwalt, A.G., Hunter. S.B., Brenner. D.J., Barrett, T.J., Swaminathan, B., 1996. Rapid identification of Campylobacter species by restriction fragment length polymorphism analysis of a PCR-amplified fragment of the gene coding for 16s rRNA. J. Clin. Microbial. 34, 62-67. Devlin, H.R.. McIntyre, L., 1983. Campylobacterfetus subsp. fetus in homosexual males. J. Clin. Microbial. 18, 999-1000. Eaglesome, M.D.. Sampath, M.I., Garcia, M.M., 1995. A detection assay for Campylobacterfetns in bovine semen by restriction analysis of PCR amplified DNA. Vet. Res. Commmun. 19, 253-263. Edmonds, P.. Patton, C.M., Barrett, T.J., Morris, G.K., Steigerwalt, A.G., Brenner, D.J., 1985. Biochemical and genetic characteristics of atypical Campylobacter fetus subsp. fetus isolated from humans in the United States. J. Clin. Microbial. 21, 936-940. Garcia. M.M., Eaglesome, M.D., Rigby, C., 1983. Campylobacters important in veterinary medicine. Vet. Bull. 53, 793-818. Gebhart, Cl., Edmonds, P.. Ward, G.E., Kurtz, J., Brenner, D.J., 1985. A Campdobacrer hyointestinalis sp. nov: a new species of Campylobacter found in the intestines of pigs and other animals. J. Clin. Microbial. 21, 715-7820.
O.A. q\ar,-ahal
et al./ Veterinary Microbiology
58 (IYY7I 61-71
71
Ciesendorf, B.A.J., Quint. W.G.V., Henkens, M.H.C., Stegeman. H., Huf, F.A., Niesters. H.G.M.. 1997. Rapid and sensitive detection of Cumyylobacter spp, in chicken products by using the polymerase chain reaction. Appl. Environ. Microbial. 58, 3804-3808. Grau. F.H.. 1988. Campylohacter jejuni and Camp$obacter hyointestinalis in the intestinal tract and on the carcasses of calves and cattle. J. Food Prot. 5 1, 857-861. Kwok, S., Higuchi, R., 1989. Avoiding false positives with PCR. Nature 339, 237-338. Mishu. B., Patton, C.M., Tauxe, R.V.. 1992. Clinical and epidemiologic features of non-jejuni, non-coli Carnpylobacter species. In: Nachamkin, I., Blazer, M.J., Tompkins. L.S. (Eds.1, Campdobacter ,jejuni: Current Status and Future Trends. American Society for Microbiology, Washington, DC, pp. 3 l-4 1. Morrison, V.A.. Lloyd, B.K.. Chia, J.K.S., Tuazon, C.U.. 1990. Cardiovascular and bacteremic manifestations of Carnpylobacter fetus infection: case report and review. Rev. infect, Dis. 12. 387-392. Nachamkin. I., 1995. Campylobacter and Arcobacter In: Murray, P.R.. Baron. E.J.. Pfaller. M.A., Tenover, F.C., Yolken. R.H. (Eds.1. Manual of Clinical Microbiology, 6th edn. American Society for Microbiology, Washington, DC, pp. 483-491. On, S.L.W.. 1996. Identification methods for campylobacters, helicobacters and related organisms. Clin. Microbial. Rev. 9. 405-422. Roop, R.M.. Smibert. R.M.. Johnson, J.L., Krieg. N.R., 1984. Differential characteristics of catalase-positive campylobacters correlated with DNA homology groups. Can. J. Microbial. 30, 938-95 I Stonnet. V., Guesdon, J.-L.. 1993. Campdobacterjejwzi: Specific oligonucleotides and DNA probes for use in polymerase chain reaction-based diagnosis. FEMS Immunol. Med. Microbial. 7. 337-344. Uyttendaele, M.. Schukkink, R.. van-Gemen. B.. Debevere, J., 1994. Identification of Carnpylobacter jejtrni. Campylobacter co/i and Campylobacter lari by the nucleic acid amplification system NASBAR. J. Appl. Bacterial. 77, 694-701. Wesley, I.V., Bryner. J.H., 1989. Antigenic and restriction enzyme analysis of isolates of C~zmnp~/obacter,frtll.s subsp. wnerealis recovered from persistently infected cattle. Am. J. Vet. Rea. 50, 807-8 13. Wesley, I.V.. Wesley, R.D., Cardella, M.. Dewhirst, F.E.. Paster, N.J., 1991. Oligodeoxynucleotide probes for Canlp~lobac,ter,ferus and Campylobacter hpoinfestirzalis based on 16s rRNA sequences. J. Clin. Microbial. 29, 1813-1817.
