Cancer Microsatellite Instability and Loss of ...

Microsatellite Instability and Loss of Heterozygosity in Breast Cancer Cindy J. Yee, Nady Roodi, Carmel S. Verrier, et al. Cancer Res 1994;54:1641-1644. Published online April 1, 1994.

Updated Version

Citing Articles

E-mail alerts Reprints and Subscriptions Permissions

Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/54/7/1641

This article has been cited by 15 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/54/7/1641#related-urls

Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected].

Downloaded from cancerres.aacrjournals.org on July 12, 2011 Copyright © 1994 American Association for Cancer Research

[CANCER RESEARCH 54. I641-1M4.

April 1. IW4)

Advances in Brief

Microsatellite

Instability and Loss of Heterozygosity

in Breast Cancer1

Cindy J. Yee, Nady Rood!, Carmel S. Verrier, and Fritz F. Pari2 Department of Pathologv, Vanderbilt University: Nashville, Tennessee 37232

Abstract Microsatellite instability (MSI) has been described in colorectal and other cancers. The purpose of this study was to determine the presence of MSI in breast cancer and to correlate its occurrence with clinicopathological parameters. For microsatellite markers we examined mono-, di-, tri-, and tetranucleotide repeats that, due to their polymorphic nature, may also be used to investigate loss of heterozygosity. In 20 paired breast cancer-peripheral blood DNA samples we identified four tumors (20%) with somatic MSI. All four tumors were estrogen receptor positive. To study MSI we also examined paired DNA samples contralateral breast cancers, as well as

stage I or II, grade 1 or 2, and in relation to tumor progression from two ipsilateral and three two matched tumor-metastatic

Materials and Methods

lymph node specimens. None of these seven cases showed MSI, but two of the contralateral tumors revealed allelic loss of polymorphic repeats. These data suggest that MSI is an early event in mammary tumorigenesis while loss of heterozygosity may occur at a later stage.

Patients. The study is based on 26 women with primary invasive breast cancer who were treated at Vanderhill University Medical Center between 1983 and 1991. All patients had tumors of sufficient size (2:1 cm) to allow multipoint hormone-binding analyses of steroid hormone receptors and extrac tion of DNA in addition to routine histopathological studies. Demographic and clinical data were obtained from patients' records with follow-up information

Introduction Extensive studies of colorectal cancer suggest that tumorigenesis proceeds through a series of genetic alterations involving both protooncogenes and tumor suppressor genes (1). Most of these genetic alterations are in the form of point mutations providing evidence for substitution mutagenesis as the major mechanism of damage to these genes. Recently, a second, distinct type of genetic alteration based on misalignment mutagenesis has been documented in colorectal cancer (2-4). This type of mutagenesis involves genomic DNA sequences termed "microsatellites," in which one- to six-nucleotide motifs are tandemly repeated numerous times. For example, the microsatellite (CA)n constitutes one of the most abundant classes of repetitive DNA families in humans. An estimated 1()(),()()()(CA)n repeats are scattered throughout the human genome and many exhibit length polymor phisms. Thibodeau et al. (3) examined colorectal tumor DNA for somatic instability of (CA)â€žrepeats. In 25 of 90 cancers (28%) they detected differences in the repeat length "n" between tumor and normal DNA from the same colon specimen. The differences varied from a gain or loss of 2 base pairs in some tumors to larger changes in length in others. The MSI1 was correlated significantly with tumor location in the ascending colon and with increased patient survival. A second study also reported instability of dinucleotide repeats in 13% of sporadic and 79% of familial colorectal cancers (2). Finally, a third study observed contractions and expansions of mononucleotide re peats in 12% of sporadic colorectal cancers (4). The combined evi dence of these studies suggests a generalized defect in DNA replica tion or repair in both sporadic and familial colorectal cancer. Recently, a defect in the DNA mismatch repair gene MSH2 on chromosome 2p22-21 has been implicated as the cause of the most Received 1/5/94; accepted 2/21/94. The cost of publication of the article were defrayed in part by the payment of page charges. This article must therefore he hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ' Supported in part by American Cancer Sociely Grant EDT-26A to F. F. P. 2 To whom requests for reprints should be addressed, ut Department of Pathology, TVC 4918; Vanderbilt University, Nashville. TN 37232-5310. 'The abbreviations used are: MSI, microsatellile instability; LOU. loss of heterozy gosity; PCR, polymerase chain reaction.

common form of inherited colorectal cancer, hereditary nonpolyposis colorectal cancer (5, 6). In this study, we investigated the frequency and types of MSI in 20 primary breast cancers and correlated the findings with clinicopathological parameters. To determine the stage during tumor development when MSI may occur, we also analyzed two ipsilateral and three contralateral breast cancers as well as two matched primary tumormetastatic lymph node specimens. Finally, we made use of the highly polymorphic nature of microsatellites to assess the allelic loss of heterozygosity in all tumor samples.

provided by the Vanderbilt Tumor Registry. Disease stage was determined using the tumor-nodes-metastasis classification and tumor types were evalu ated according to WHO criteria (7). All patients were treated by modified radical mastectomy. Tissue and DNA Samples. All breast cancer biopsies were examined in the Surgical Pathology Laboratory of Vanderbilt University Medical Center. After establishing the diagnosis of infiltrating breast cancer on frozen tissue sections, a portion of tumor tissue was fixed in formalin and embedded in paraffin for routine histopathological examination. The remainder of the tumor tissue was stripped of adherent fat and frozen at -70Â°C for steroid receptor studies. The frozen tumor specimens were pulverized in liquid nitrogen: the resulting fine powder was suspended in low salt buffer (50 mM Tris, pH 7.4-1 mM EDTA-10% glycerol-1 mM monothioglycerol) and centrifuged for 30 min at 1()(),()0() X g and 4Â°C.The supernatant cytosol was used for estrogen and progesterone receptor assays while the pellet was used to extract DNA by standard methods (8). In total, the genomic tumor DNA was compared with matched DNA from peripheral blood leukocytes (20 patients), axillary lymph node mÃ©tastases(2 patients), ipsilateral tumors (2 patients), and contralateral tumors (3 patients). In one of the latter patients, we compared DNA from both tumors and peripheral blood. DNA Analysis. The DNA samples were examined for genetic alterations at seven different microsatellites by PCR amplification. The microsatellites were selected to include mono-, di-, tri-, and tetranucleotides and to represent different chromosomes, some of which have been involved in LOH or linked to familial breast cancer (9). In brief, a (GAAA)n repeat at Ip32 (10) (5'ATCGTGCCACTGAACCGTAGCCT; 5 ' -TCCTGGACTCAAGCGATCCACTT), a (GT)n repeat at D9S63 (11) (5'-TTATAATGCCGGTCAACCTT; 5'-CCGGAAGTTACTCTAGTCTA), a (TG)n repeat on chromosome 15ql 1 in intron 4 of the cardiac muscle actin gene (12) (5'-TTGACCTGAATGCACTGTGA; 5'-TTCCATACCTGGGAACGAGT), a (CA)â€žrepeat at D17S807(\3) (5'-GCTTAGAAGGAAAATCATAACCT;5'-AGATATGTACACTCACTCCTAC), a (CA)n repeat at D18S34 (14) (5'-CAGAAAATTCTCTCTGGCTA: 5'-CTCATGTTCCTGGCAAGAAT), a (CAG)â€žrepeat in the coding region of the androgen receptor gene at Xql 1-12 (15) (5'-GTGCGCGAAGTGATCCAGAA; 5'-TCTGGGACGCAACCTCTCTC), and a (T)n repeat within Alu sequences (4) (5'- GAGGCCCAGCAATCTGCACT; 5'-AAATCAGTATAAGAAAGGAA) were amplified using the listed primers. Approximately 0.25-0.6 p.g of DNA was amplified in each 100-/A! PCR reaction consisting of 10 mM Tris-HCI (pH 8.3), 50 mM KC1, 1.5 mM MgCI, (4 mM MgCI, for Alu), 200 mM of each deoxynucleotide triphosphate, 1 JAM

1641


MK'ROSATEl-UTE

Table l Microsalelliie

INSTABILITY

IN BREAST CANCER

instability and loss of heierozygositv in breast cancer

Patient1234567891011121314151617IS1920212223242526Age(yr)7149677432505065495565575770585677457562648866825865SlageMIIIIIIIIIIIIIIIIIIIIIIVIIIIIIIInHniniiininTypeDuctalDuctalDuctalDuctalDuctalDu LOHBlood-tumorBlood-tumorBlood-tumorBlixid-tumorBlood-tumorBlood-tumorBlood-tumor samples MSI

1Blood-tumor 15ql l^)/7.V/Â«S.?-/:Xql

D17S807Blood-tumor ISqll: XqllBlood-tumorBlood-tumor.contralateraltumorsTumor-lymph

nodeIpsilateraltumorsTumor-lymph nodeIpsilateraltumorsC'ontralatcraltumors 1Contralateraltumors

15ql l;Xql 15qll

ER, estrogen receptor (fmol/mg): PR, progesterone receptor (fmol/mg); NA, not applicable: ND. not done.

concentrations

of each primer, and 2.5 units of Taq DNA polymerase (Pro-

mega, Madison. Wl). Prior to the PCR reaction, each sense primer was end-labeled with [-y-"P]ATP (1(1 mCi/ml: DuPont New England Nuclear. Boston, MA) using 1 unit T4 polynucleotide kinase/reaction. The PCR con ditions consisted of an initial denaturation step followed by 30 cycles of 95Â°C for 30 s, 55Â°Cfor 30 s, and 72Â°Cfor 30 s. A 4-/J.1aliquot of each PCR reaction was diluted 1:1 with loading buffer [95% (v/v) formamide, 10 mM EDTA (pH 8.0), 0.1% (w/v) bromophcnol blue, and 0.1% (w/v) xylene cyanol FF], heat denatured, and clectrophoresed on 6% polyacrylamide-8 M urea gels at 60 W for 1.5-3 h depending on the fragment size. The gels were dried and exposed to Kodak X-omat-AR film (Eastman Kodak Co.. Rochester, NY) at -80Â°C with intensifying screens. As defined in Refs. 2-4. MSI is characterized shift and/or gain of clectrophoretic a loss of bands.

by a

bands. In contrast. LOH is characterized by

Results Four of the 20 breast cancers (20%) showed evidence of MSI (Table 1). A comparison of the electrophoretic mobility of nucleotide

repeats from paired normal and tumor tissue DNA samples showed a shift in the latter indicating an alteration in microsatellitc size (Fig. 1). The shift in electrophoretic mobility was reproducible in replicate experiments. In three of the four tumors two or more loci were affected with contraction or expansion of dinucleotide (CA)n or trinucleotidc (CAG)n repeats (Fig. 1). The fourth tumor showed an instability of mononuclcotide repeats (T)n within Alu sequences. All four patients were 50 years or older and had no family history of breast cancer. Three of the patients had stage I tumors and were alive and well 3â€”5years after mastectomy. The fourth patient had a stage II tumor and died of breast cancer 18 months after mastectomy. Two tumors were moderately well differentiated ductal carcinomas; the others were classified as lobular and tubular cancers. All four tumors were positive for estrogen and progesterone receptors. Using the same set of microsatellite markers, we identified two tumors with LOH affecting one alÃ-eleof the androgen receptor gene at the Xqll locus. Both patients were less than 50 years old (Table 1). 13

12

14

Fig. 1. Examples (if MSI in breast cancer. Genomic DNA samples from paired normal (W; peripheral blood leukocytes) and tumor (7") tissues were subjected to PC'R amplification, elcctrophoresis on 6% polyacrylamide gels containing 8 M urea, and autoradiography. Four sets of PCR primers were used to locali/.e nucleotide repeats at the fol lowing loci: (a) (TG)â€žat ISqll: (b) (CA)n at D1HS34; (c) (CAG),, at Xi/11; and (d) (T)n in Alu sequence. Arrows, alterations in electrophoretic mobility of PCR products from tumor compared to normal tissue DNA indicating somatic microsatellile instability. The numbering of the patients is the same as that used in Table 1.

N

T

1642


N

T

N

T

MICROSATELLm:

24

23

LN

TI

INSTABILITY

25 TO

TR

TL

If Fig. 2. Example of LOU in hrcasl cancer. Gcnomic DNA samples from three palienls were subjected to PC'R amplification of(TG)n repeal at I Still followed by denaturing gel clcctrophoresis and autoradiography. Patient 23, tumor (7") IÃ•T.VH.V lymph node (LN) metastasis; patient 24. ipsilateral tumor ( TI. inner quadrant: TO. outer quadrant): patient 25. contralaleral tumor (TR, right breast; TL. left breast). Arrow, absent polymorphic repeat indicating LOH in the contralateral tumor of patient 25. The numbering of the patients is the same as that used in Table I.

To study MSI in relation to tumor progression we examined paired DNA samples from two ipsilateral and three contralateral cancers as well as two matched primary tumor - metastatic lymph node speci mens. None of these seven cases showed MSI, but two of the contralateral tumors revealed allclic loss of polymorphic repeats at the ISqll and Xqll loci (Fig. 2; Table 1). Discussion

IN BREAST CAM I K

to 29 units in normal individuals (15). In this study we detected instability of the (CAG)n repeat in two breast cancers. The androgen receptor gene has been shown to be expressed in some breast cancers although the functional role of the receptor in mammary tumors is unknown (21). Thus, it is uncertain whether the MSI of the androgen receptor gene has any functional importance. Because LOH is such a frequent event in breast cancer (9), we investigated its relationship to the genetic instability of microsatellites. None of the four tumors exhibiting MSI showed evidence of LOH. This finding is similar to the result reported by Thibodeau el al. (3), who observed an inverse correlation between MSI and LOH in colorectal cancer. We extended our exploration to a group of seven more advanced tumors including ipsilateral and contralateral cancers as well as lymph node mÃ©tastases.While we found two additional cases with LOH among the seven tumors we did not observe any MSI. Overall, these data suggest that MSI may be an early event in mammary tumorigenesis whereas LOH occurs at a later stage. The latter is consistent with a recent study of 86 breast cancers in which LOH was shown to represent a relatively late event in tumor pro gression (22). With regard to the role of MSI in tumorigenesis, it is interesting to note that MSI in urinary bladder cancer occurs in low stage tumors (11) and in colorectal cancer is associated with a good prognosis (3). Further studies on a larger population of breast cancer patients will be important to verify these initial observations and to determine if these DNA changes are independent prognosticindicators. References

Colorectal cancer was the first type of human malignancy in which MSI was described (2-4). The reported genomic instabilities involved mono-, di-, and trinucleotide repeats and occurred in hereditary nonpolyposis as well as sporadic colorectal cancer. Subsequently, MSI was described in endometrial, pancreatic, gastric, and urinary bladder cancers (11, 16, 17). In this study, we identified MSI in four primary invasive breast cancers. The types of instability were similar to those described in the other malignancies; i.e., they affected mono-, di-, and trinucleotide repeats and, in three of the four tumors, involved two or more loci suggesting a more widespread genomic instability in this subset of breast cancers. The hereditary nonpolyposis colorectal cancer syndrome is charac terized by a familial predisposition to colorectal carcinoma and extracolonic cancers of the gastrointestinal, urologica!, and female re productive tract (18). Recently, a germline detect in the DNA mismatch repair gene MSH2 on chromosome 2p22-21 has been implicated as cause of the hereditary syndrome and the associated MSI (5, 6). It is likely that the MSH2 gene is also victim to somatic defects since MSI is present not only in heritable but also in various sporadic tumors such as endometrial, pancreatic, gastric, and urinary bladder cancers (2-4, 11, 16, 17). Thus, germline transmission of a mutant alÃ-eleof the MSH2 gene would predispose to the hereditary nonpolyposis colorectal cancer syndrome, whereas a somatic mutation would contribute to the development of sporadic carcinomas. Alternatively, the genomic instability of sporadic cancers might be due to other defective "mutator genes" that are involved in DNA replication

Fcaron. E. R.. and Vogelstein, 'â€¢ 6ÃŒ:759-767. 1990. ,

B. A genetic model for colorectal tumorigenesis. Cell,

Aaltonen, L. A., PeltomÃ¤ki. P., Leach, F. S., Sistonen, P.. PylkkÃ¤nen, L., Mecklin. J. P.. Jarvinen. H., Powell. S. M., Jen. J.. Hamilton. S. R., Petersen. G. M., Kin/ler, K. W., Vogelstein. B., and de la Chapelle. A. Clues to the palhogenesis of familial colorectal cancer. Science (Washington DC). 2M>: 812-816, 1993. 3 Thibodeau. S. N., Bren. G., and Schaid. D. Microsatellite instability in cancer of the proximal colon. Science (Washington DC). 2nd: 816-819. 1993. lonov. Y.. Peinado, M. A.. Malkhosyan. S.. Shibata. D.. and Perucho. M. Ubiquitous somatic mutations in simple repeated sequences reveal a new mechanism for colonie carcinogenesis. Nature (Lond.). 363: 558-561, 1993. 5- Fishcl, R.. Lcscoe. M. K., Rao. M. R. S., Copeland, N. G., Jenkins, N. A., Garber, J.. Kane. M.. and Kolodner. R. The human mutator gene homolog MS1ÃŒ2 and its association with hereditary nonpolyposis colon cancer. Cell. 75: 1027-1(138. 1993. 6. Leach, F. S., Nicolaides. N. C.. Papadopoulos. N.. Liu. B.. Jen. J.. Parsons. R., PeltomÃ¤ki. P., Sistonen. P., Aaltonen, L. A.. Nystrom-I^ihti. M., Guan, X. Y., Zhang. J.. Meltzer. P. S., Yu. J. W.. Kao, F. T., Chen, D. J.. Cerosaletti, K. M., Fournier. R. E. K.. Todd. S.. Lewis. T., Leach, R. J., Naylor, S. L., Weissenbach. J.. Mecklin. J. P.. Jarvinen, H., Petersen. G. M.. Hamilton. S. R.. Green, J., Jass, J., Watson, P.. Lynch, H. T., Trent. J. M., de la Chapelle, A.. Kinzler. K. W.. and Vogelstein. B. Mutations of a MtitS homolog in hereditary nonpolyposis colorectal cancer. Cell. 75: 1215-1225. 1993. 7- Page. D. L.. and Anderson, T. J. Diagnostic Histopathology of the Breast. New York: Churchill-Livingstone, 1988. 8 Yaich. L.. Dupont. W. D., Cavener. D. R., and Pari, F. F. Analysis of the Prull restriction fragment-length polymorphism and exon structure of the estrogen receptor gene in breast cancer and peripheral blood. Cancer Res., 52: 77-83, 1992. Devilee. P., and Cornelisse. C. J. The genetics of human breast cancer. Cancer Surv.. 9: 6(15-630, 1991. i.Maekelae, T. P., Hellsten, E., Vesa. J., Alitalo, K., and Peltonen, L. An Mil variable polyA repeat polymorphism upstream of L-mvr at Ip32. Hum. Mol. Genet., /: 217, 1992. n. Gonzalcz-Zulueta. M.. Ruppert. J. M.. Tokino. K., Tsai. Y. C., Spruck. C. H., Miyao. N.. Nichols. P. W., Hermann. G. G.. Horn. T.. Steven, K.. Summerhaycs, I. C., Sidransky. D.. and Jones. P. A. Microsatellite instability in bladder cancer. Cancer Res., 53: 5620-5623, 1993. 12. Lit!. M.. and Luty, J. A. A hvpervariable microsatellite revealed by in vitro amplifi cation of a dinucleotide repeat within the cardiac actin gene. Am. J. Hum. Genet.. 44: 397-401, 1989. 13 Weissenbach. J.. Gyapay, G., Dib, C.. Vignai. A.. Morissettc. P., Vaysseix, G., and Lathrop. M. A second-generation linkage map of the human genome. Nature (Lond.). 359: 794-801, 1992. Weber. J. L., and May. P. E. Abundant class of human DNA polymorphisms which can be typed using the polymerasc chain reaction. Am. J. Hum. Genet.. 44: 388-396. 1989. 15. Trapman. J.. and Brinkmann, A. (). Mutations Â¡nthe androgen receptor. Ann. NY Acad. Sci., 684: 85-93. 1993. 16. Risingcr. J. l... Berchuck, A.. Kohler. M. F., Watson, P., Lynch, H. T., and Boyd, J.

or mismatch repair (19, 20). The precise mechanism through which MSI contributes to tumor igenesis is unknown. Microsatcllites are scattered throughout the genome including noncoding and coding regions of various genes. It is conceivable that MSI adversely affects the functional activity of such genes. One example of a gene with a microsatellite in its coding sequence is the androgen receptor gene at Xql l-ql2 which contains a trinucleotide repeat, (CAG)n, in the NH2-terminal domain of the coding region. This microsatellite is polymorphic and varies from 19 1643


MICROSATELLITE

INSTABILITY

Genetic instability of microsatellitcs in endometrial carcinoma. Cancer Res., 53: 5100-5103, 1993. 17. Han, H. J., Yanagisawa, A.. Kato, Y., Park, J. G., and Nakamura. Y. Genetic instability in pancreatic cancer and poorly differentiated type of gastric cancer. Cancer Res., 53: 5087-5089. 1993. 18. Lynch, H. T., Smyrk, T. C., Watson, P., Lanspa, S. J., Lynch, J. F., Lynch, P. M., Cavalieri, R. J., and Boland, C. R. Genetics, natural history, tumor spectrum, and pathology of hereditary nonpolyposis colorÃ©ela!cancer: an updated review. Castroenterology. 104: 1535-1549, 1993.

IN BREAST CANCER

19. Kunkel. T. A.: Slippery DNA and diseases. Nature (Lond.), .ÃŽ65:207-208, 1993. 20. Strand, M., Frolla, T. A., Liskay, R. M., and PelÃ©s,T. D. Destabilizalion of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature (Lond.). 365: 274-276, 1993. 21. Lea, O. A., Kvinnsland, S.. and Thorsen, T. Improved measurement of androgen receptors in human breast cancer. Cancer Res.. 49: 7162-7167, 1989. 22. Cornelisse, C. J., Kuipers-Dijkshoorn, N., van Vliet, M., Hermans, J., and Devilee, P. Fractional allelic imbalance in human breast cancer increases with tetraploidi/ation and chromosome loss. Int. J. Cancer. 50: 544-548, 1992.

1644
