Cancer predisposition caused by elevated mitotic ... - Nature

article

© 2000 Nature America Inc. • http://genetics.nature.com

Cancer predisposition caused by elevated mitotic recombination in Bloom mice Guangbin Luo1,5*, Irma M. Santoro1*, Lisa D. McDaniel4, Ichiko Nishijima1, Michael Mills1, Hagop Youssoufian1, Hannes Vogel2, Roger A. Schultz4 & Allan Bradley1,3,6 *These authors contributed equally to this work.

Bloom syndrome is a disorder associated with genomic instability that causes affected people to be prone to cancer. Bloom cell lines show increased sister chromatid exchange, yet are proficient in the repair of various DNA lesions. The underlying cause of this disease are mutations in a gene encoding a RECQ DNA helicase. Using embryonic stem cell technology, we have generated viable Bloom mice that are prone to a wide variety of cancers. Cell lines from these mice show elevations in the rates of mitotic recombination. We demonstrate that the increased © 2000 Nature America Inc. • http://genetics.nature.com

rate of loss of heterozygosity (LOH) resulting from mitotic recombination in vivo constitutes the underlying mechanism causing tumour susceptibility in these mice.

Introduction Bloom syndrome is a recessive genetic disorder associated with genomic instability1. Although many human cancer-prone syndromes are caused by defects in aspects of the cellular DNA repair machinery, cells from Bloom syndrome patients are proficient in the repair of many types of DNA lesions2. The genomic instability in this syndrome is unique in that it is characterized by an increased tendency of sister chromatids to exchange DNA strands1. Moreover, in most human cancer-prone syndromes caused by DNA repair defects, certain types of cancers tend to predominate. In contrast, Bloom syndrome predisposes patients to a wide variety of malignancies1, which implies that the BLM helicase is required for maintaining genomic stability in many cell types. The human Bloom syndrome gene (BLM) encodes a homologue of the Escherichia coli RecQ DNA helicase3. DNA helicase unwinds double-stranded DNA molecules, a process required for various aspects of DNA metabolism, including transcription, DNA repair and replication. RecQ DNA helicases have been associated with recombination pathways in E. coli (RecQ; refs 4,5), Saccharomyces cerevisiae (Sgs1; refs 6,7) and Saccharomyces pombe (Rqh1; refs 8,9). Five RECQ DNA helicase homologues (encoded by the genes RECQL (refs 10,11), WRN (ref. 12), BLM (ref. 3), RECQL4 (ref. 13) and RECQL5 (ref. 13)) have been identified in the human genome. Mutations in BLM, WRN and RECQL4 cause three distinct syndromes: Bloom1,3, Werner12,14 and Rothmund-Thompson15. These syndromes are all associated with genomic instability and cancer predisposition2. Thus, in humans, members of the RECQ helicase family have acquired non-redundant functions while maintaining certain conserved features. We report here the functional analysis of the mouse homologue of the human Bloom syndrome gene using embryonic stem (ES) cell technology. This study reveals that the fundamental underlying mechanism for the genomic instability and cancer

predisposition phenotype in Bloom syndrome is an elevation in the frequency of somatic recombination.

Results Mutation of the mouse Blm locus We used ES cell technology to generate several mutant alleles of the mouse homologue of human BLM. We designed a targeting vector to replace exon 2 (the first coding exon of the mouse gene Blm) with a loxP-PGKneo cassette (Fig. 1a,b), so that an allele could be generated by Cre-loxP excision16 without the potential complication of the effects of PGKneo on neighbouring genes17–20. Using Cre, the targeting vector could also be recycled to generate double-targeted ES cells after removal of the neo cassette16. We identified targeted clones by Southern-blot hybridization. The correctly targeted mutated allele was designated Blmtm1Brd (hereafter Blmm1; Fig. 1a,f). This allele was predicted to be a null allele because the resulting transcript lacks the appropriate in-frame translation start site. One of the targeted clones resulted from a complex insertional targeting event. In this clone, three copies of the targeting vector were introduced into the Blm locus by an insertion event. This mutated Blm allele, designated Blmtm2Brd (hereafter Blmm2), should lead to the production of an aberrant transcript with 4 copies of exon 3. This transcript contains premature termination codons in all three possible ORFs, and the in-frame translation product is predicted to yield a truncated polypeptide of 296 amino acids (Fig. 1a–c, and data not shown). Thus, the Blmm2 allele is also likely to be null. The vector sequences and PGKneo cassettes were removed from this allele by Cre-loxP–mediated deletion, generating the Blmtm3Brd (Blmm3) allele (Fig. 1a,d,e). This allele retains an extra copy of exon 3, which causes a frameshift and truncates the protein at the same position as the Blmm2 allele (Fig. 1a). Sequence analysis of the RT–PCR prod-

1Department of Molecular and Human Genetics, 2Department of Pathology, Baylor College of Medicine, Houston, Texas, USA. 3Howard Hughes Medical Institute; 4McDermott Center for Human Growth and Development, The University of Texas Southwestern Medical Center at Dallas, Dallas, Texas, USA. 5Present address: Department of Genetics and the Ireland Cancer Center, Case Western Reserve University School of Medicine, University Hospital of Cleveland, Cleveland, Ohio, USA. 6Present address: The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK. Correspondence should be addressed to A.B. (e-mail: [email protected]).

424

nature genetics • volume 26 • december 2000

article


Fig. 1 Gene targeting at the mouse Blm locus. a, Gene-targeting strategy and the B B 6.8 B 1 kb Blm alleles. Blm, the 5´ portion of the Blm 23 1 wild-type mouse Blm allele. Blm-TV1, the 3P gene-targeting vector. The targeting vecBlm-TV1 8.0 B N B tor is a replacement vector with 5-kb 5´ homology and 2.8-kb 3´ homology. Blm tm1Brd N 3 1 replacement Gene-targeting events replace a 5.8-kb insertion 3P genomic fragment with a loxP/PGKneo targeting targeting cassette, deleting exon 2 (the first coding tm1Brd allele is the exon). The Blm 8.3 8.3 8.0 B B B B B B B B B expected product of a targeting event using this replacement targeting vector Blm tm2Brd N N N 23 3 3 3 1 which lacks the original in-frame transla3P tm2Brd Cre tion start site in exon 2. The Blm allele is the result of a complex insertion B B B B 6.0 B targeting event. It contains three intact copies of the targeting vector from an Blmtm3Brd 23 3 1 insertional recombination event. This 3P allele contains 4 copies of exon 3, 3 transcription copies of the PGKneo cassette and three copies of the BSSK backbone. The Blmtm3Brd allele is a derivative of the 1 2 3 3 4 Blmtm2Brd allele after the removal of the sequences between the two distal loxP sites. It contains 2 copies of exon 3. A 3´ external probe (3P) identifies these 4 different alleles as BamHI fragments of dif8.3 8.3 ferent sizes (wild-type Blm, 6.8 kb; 8.0 8.0 8.0 8.0 8.0 tm1Brd tm2Brd , 8.0 kb; Blm , 8.0 kb; and Blm 6.8 tm3Brd 6.8 6.8 , 6.0 kb, respectively). The three Blm 6.0 6.0 BamHI fragments in the BlmBrdm2 allele, 2.5 2.5 which can be detected by the neo probe, are also indicated. The predicted struc3P Neo 3P Neo 3P ture of the mRNA from the Blmtm3Brd allele is shown. Note that exon 3 is duplicated. b–f, Identification and characterization of the different Blm alleles by Southern-blot analyses. Genomic DNA was restricted with BamHI. Membranes containing the fractionated restricted DNA were hybridized first with the 3´ external probe (3P) then a neo probe (Neo). The sizes of the fragments are indicated. The 2.5-kb BamHI fragments detected by the neo probe are from the endogenous neo in the AB2.2 ES cells. N, PGKneo cassette; dashed line, BSSK plasmid backbone; open triangles, loxP sites. wt, wild-type ES cells; +/m1, Blm+/tm1Brd ES cells; +/m2, Blm+/tm2Brd ES cells; +/m3, Blm+/tm3Brd ES cells; and m1/m3, Blmtm1Brd/tm3Brd ES cells.


ucts from the Blmm3 allele confirmed that it gave rise to the predicted aberrant message. The predicted translation product of the Blmm3 allele is similar to many of the nonsense and frameshift mutations identified in Bloom syndrome patients3. Finally, Blm+/m3 ES cells were re-targeted with the same targeting vector to generate double-targeted (Blmm1/m3) ES cells (Fig. 1f, and data not shown). A mouse model for Bloom syndrome We generated mutant mice carrying the Blmm2 and Blmm3 alleles. Heterozygous mutant mice carrying either the Blmm2 or the Blmm3 allele were viable and fertile. Compound heterozygous mice (Blmm2/m3) were also viable and fertile; however, crosses between the compound heterozygous mice produced progeny of only two of the three expected genotypes (Fig. 2a,b). Mice with the Blmm2/m2 genotype did not develop to term. Western-blot analysis using polyclonal antibodies specific for the N-terminal 430 amino acids of the human BLM protein21 revealed that both the Blmm2 and the Blmm3 alleles were null alleles (Fig. 2c). These studies also confirmed that the Blmm1/m3 double-targeted ES cells were Blm deficient (data not shown). Given the fact that BLM is not essential for viability in humans and that the Blmm3/m3 and Blmm2/m3 mice are viable, the lethality of the Blmm2/m2 mice is not caused solely by the absence of Blm protein. The major clinical manifestations of human Bloom syndrome are growth retardation, immune deficiency, genomic instability and predisposition to a wide variety of cancers1. The Blmm3/m3 mice in the F2 and N2 genetic backgrounds of C57BL/6×129S5 were normal in size. Extensive flow cytometric analysis did not reveal any abnormalities in the development of the haematopoietic lineages. ELISA analysis detected a marginal (10%) reduction in serum IgM in the mutant mice. nature genetics • volume 26 • december 2000

w t +/ m +/ 2 m 3

w t +/ m +/ 2 m 3

w t +/ m 2

w t +/ m 2

b

+/ m m 3 1/ +/ m3 m 1

a

The hallmark cellular phenotype of Bloom syndrome is increased sister chromatid exchange (SCE) in somatic cells1. The number of SCEs in metaphase chromosome spreads from Blmm1/m3 ES cells was about tenfold higher than that in wild-type ES cells (Fig. 3). Elevated frequencies of SCE were also found in mutant embryonic fibroblasts (MEFs) and mutant lymphocytes (data not shown). Thus, Blm-deficient cells have an increased rate of SCE, similar to that observed in cells from Bloom syndrome patients. 3 3 3 3 3 3 3 m /m /m /m /m /m 3/m 3 2 2 2 2 m m m m m m

2/

m

a

m2 m3

segregation of the m2 and m3 alleles

b

m2 / m2

m2 / m3

m3 / m3

0

43

20

wt

c

3

m

+/

3

3

m

m

3/

m

2/

m

kD 200

97.4

69 46

Fig. 2 Characterization of the Blmm2 and Blmm3 mutant alleles. a, Identification of the Blmm2 and Blmm3 alleles in a litter of mice using the 3P probe on a Southern blot of tail DNA. b, Segregation of the Blmtm2Brd and Blmtm3Brd alleles in the progeny of (Blmm2/m3×Blmm2/m3) crosses. Blmm2/m2 animals were not recovered. c, Western-blot analysis of Blm expression. The Blm protein was detected in extracts from both the wild-type (wt) and Blm+/m3 mouse testis (arrow), but was not detected in extracts from either Blmm2/m3 mutants or Blmm3/m3 mutants. Unknown crossreactive proteins with similar intensities are observed.

425

article


Blm +/+

Blm

Table 1 • Tumours found in Blm-deficient mice

m1/m3

Numbera

Type and site of tumour

Fig. 3 The effect of Blm deficiency on SCE. Visualization of SCE events on metaphase chromosomes of both wild-type and Blmm1/m3 ES cells. The two sister chromatids were differentially labelled by BrdU and are shown as images with light and dark intensities, respectively. There are many more SCEs per metaphase spread in the mutant background.

Age (weeks)b

Lymphoma thymic disseminated

2 10

29 64

Sarcoma uterus subcutaneous

1 1

79 52

1 1 1 1

87 55 74 70

1

68

Carcinoma adenocarcinoma liver breast lung intestine squamous carcinoma face Total

19 (29%)

total of 65 mice were monitored for 20 months. bMean ages for lymphoma. Note that 3% developed tumours before the age of one year.


aA

A cohort of 65 Blmm3/m3 mice were aged and monitored for tumour development. Tumours rarely developed in these mutant mice before 1 year of age; 2 of 65 animals (3%) developed tumours. By 20 months of age, 29% of the Blm-deficient mice had developed tumours (Table 1). The tumours found included 12 lymphomas, 2 sarcomas and 5 carcinomas (including 4 adenocarcinomas and 1 squamous cell carcinoma). The seven non-lymphoma tumours had diverse tissues of origins (Table 1 and Fig. 4). In addition to these 19 malignant neoplasms, we observed 6 benign tumours, including 3 gastroduodenous polyps, 2 haemangiomas and 1 skin papilloma. In contrast, none of the 25 wild-type controls developed tumours, consistent with our previous observations that wild-type mice of this genetic background were largely tumour-free before the age of 20 months22. These data demonstrate that Blm-deficient mice are susceptible to a wide spectrum of cancer, as observed in Bloom syndrome patients. Mitotic and meiotic recombination The observations of increased SCE in somatic cells and the reduced fertility in Bloom syndrome patients prompted us to investigate the effect of Blm deficiency on homologous recombination during both meiotic recombination in germ cells and mitotic recombination in somatic cells. We examined the proficiency of the meiotic recombination by scoring the frequency of meiotic crossover of SSLP markers on several chromosomal regions in the mouse genome. Contrary to expectations, our results showed that Blm deficiency in Blmm3/m3 mice did not affect the frequency of meiotic crossover during male or female meiosis (data not shown). To determine whether mitotic recombination was affected, we examined gene-targeting frequencies in the double-targeted (Blmm1/m3) ES cells. First, the gene-targeting frequency at an ectopic single-copy PGK-Hprt cassette targeted to the Gdf9 locus23 was measured using a selection strategy (Fig. 5a). Gene targeting of the ectopic PGK-Hprt locus was five times more effiFig. 4 Tumours in Blmm3/m3 mice. a, Infiltrating malignant lymphoma involving the renal cortex, showing entrapped tubules (t) and glomeruli (g). b, Uterine stromal sarcoma, with focal necrosis (arrow) and haphazard arrangement of tumour spindle cells. c, Cutaneous squamous cell carcinoma arising in the face, showing nodular growth pattern and prominent mitotic figures (arrow). d, Comedo carcinoma of the mammary gland, showing characteristic central necrosis (n) of intraductal carcinoma (ic). e, Well-differentiated adenocarcinoma of the lung reminiscent of the bronchoalveolar type. f, Adenocarcinoma (ac) of the small bowel, with invasion into the smooth muscle (sm). Section were stained with haematoxylin and eosin. Scale bar, 50 µm.

426

cient in Blmm1/m3 ES cells than in wild-type ES cells (Fig. 5b). The gene-targeting frequency at a different locus (Rad50) was also examined by Southern-blot screens. In this case, a gene-targeting frequency of 44% (65/149) was obtained in the Blm-deficient ES cells, which is 3.5-fold higher than that obtained in wild-type ES cells24. Thus, the gene-targeting frequency increased in the absence of Blm. This observation accounts for the mechanism of elevation in SCE and is consistent with observations that SCE in vertebrates is mediated by homologous recombination25. In contrast, illegitimate recombination rates (random integration) were similar in mutant and wild-type cells (Fig. 5b). An increased frequency of somatic recombination is expected to result in an elevated rate of LOH. We determined the effect of Blm deficiency on the rate of loss of the ectopic PGK-Hprt cassette at the Gdf9 locus using 6-thioguanine (6TG) selection (Fig. 6a). The rates of LOH, determined by Luria-Delbruck fluctuation analysis26, were 2.3×10–5 events per cell per generation in wild-type ES cells, and 4.2×10–4 events per cell per generation in mutant ES cells (Fig. 6b). Thus, Blm deficiency led to an 18-fold increase in the rate of somatic LOH. Blm deficiency leads to an elevation in mitotic recombination, whereas meiotic recombination is unaffected. The elevation of mitotic recombination rates in the mutant cells leads to an increased rate of somatic LOH.

a

b

c

d

e

f



a

PGKHprt 5’H 3’H 5’H

Puro

Gdf9/PGKHprt locus 3’H

targeting vector

targeted integration

random integration

Puro ,r 6TG s

Fig. 5 The effect of Blm deficiency on gene targeting. a, A selection-based strategy for measuring gene-targeting frequency. In this strategy, a PGK-Hprt gene was introduced into the Gdf9 locus by gene targeting to confer HAT resistance to AB2.2 ES cells, which are HAT sensitive. A targeted clone was then transfected with another vector in which the PGK-Hprt gene was interrupted by a puromycin resistance gene. If this targeting vector integrates into the genome at random, the ES cells will be puromycin resistant and remain HAT resistant (6TG sensitive); however, if the vector targets the ectopic PGK-Hprt gene, the gene will be inactivated and the ES cells will be resistant to both puromycin and 6TG. b, The results of the gene targeting experiments. Ten million ES cell were transfected in each experiment. The combined results of two independent experiments are shown.

Puro r, 6TG r

b gene targeting at the Gdf9/ Hprt locus genotype Puror & 6TG r Puro r targeting


article

Blm +/+

14

1532

0.9%

Blm m1/m3

61

1392

4.4%

Elevated mitotic recombination leads to tumorigenicity in vivo Somatic LOH is one of the mechanisms leading to the complete loss of function of tumour-suppressor genes in human cancer. To examine the effect of Blm-deficiency on the rate of LOH in vivo, the tumour susceptibility of ApcMin mice27 was examined in a Blmdeficient background. In heterozygous ApcMin mice, loss of the remaining intact copy of the Apc allele in the epithelial cells of the small intestine leads to the development of adenomatus polyps in the intestine28. In Apcmin mice, changes in tumour susceptibility can be easily assessed by determining the number of polyps per small intestine29. At 3 months of age, Apcmin/+Blmm3/+ mice in a C57BL/6J×129S5 hybrid background had an average of 27 polyps larger than 1 mm in diameter per small intestine, which is consistent with previous studies27. In contrast, Apcmin/+Blmm3/m3 mice developed an average of 107 polyps larger than 1 mm in diameter, as well as many smaller ones that were not counted (Fig. 7a,b). Thus Blm deficiency increased the number of tumours formed in ApcMin mice, presumably as the result of an increased rate of somatic LOH in the absence of Blm function. It has been shown that the remaining wild-type Apc allele is lost by a LOH event in greater than 95% of the polyps studied28. Fig. 6 The effect of Blm deficiency on LOH in ES cells. a, LOH analysis in ES cells. In this strategy, the loss of a functional PGKHprt gene at the Gdf9 locus was monitored. Several possible causes for the loss are indicated. They can be divided into three categories: (i) the loss of the entire chromosome carrying the PGKHprt gene with (2, isodisomic) or without (1, monosomic) duplication of the homologous chromosome; (ii) the loss of a segment of chromosome carrying the PKG-Hprt gene due to a deletion event (3); a recombination event between two homologous chromosomes (4), and a recombination event between two non-homologous chromosomes (translocation) (5); and (iii) the loss of function of the PGK-Hprt gene due to a point mutation. Monosomy 11 is not viable in mouse ES cells and point mutations occur at very low frequencies. Thus, factors 2, 3, 4 and 5 are the major contributors to the loss of the activity of the PGK-Hprt gene. b, The raw data for a Luria-Delbruck fluctuation analysis and the computed rates of Hprt allele loss. We tested 24 cell lines for each genetic background and the data are shown in their original random order. The numbers of the horizontal axis are the original cell line number of individual clones of each genotype. The vertical axis is a log scale. The rates of LOH are 2.3×10–5 and 4.2×10–4 (events/cell/generation) for wild-type and mutant ES cells, respectively.


The finding that Blm-deficient cells have elevated rates of recombination and LOH led to the hypothesis that the major mechanism of LOH leading to loss of the Apc+ allele in Blm-deficient Apcmin mice is mediated by mitotic recombination. To assess the mechanism for loss of the Apc+ allele, we established both Blm-proficient and Blm-deficient mice with polymorphic microsatellite alleles along chromosome 18. The status of these alleles in intestinal tumours from these mice was determined by PCR with DNA from microdissected tumour samples. The results showed that in a Blm-proficient background, the Apc+ allele, along with all other alleles on the same chromosome, was lost (Fig. 7e), which is consistent with previous findings28. On the contrary, in a Blm-deficient background, while the Apc+ allele was consistently lost, other alleles on the same chromosome showed both loss and retention (Fig. 7d). These results confirmed the hypothesis that the major mechanism of LOH leading to the loss of the Apc+ allele in Blm-deficient Apcmin mice is mediated by mitotic recombination.

Discussion We have described the generation of mice carrying two different mutant Blm alleles, Blmm2 and Blmm3. Blmm2/m2 mice did not survive to term. A similar embryonic lethal phenotype has been reported for another Blm-mutant allele30. Yet the Blmm3 allele, derived from the Blmm2 allele by removing the PGKneo and vector sequences, gave rise to viable homozygous mutant mice that closely recapitulated the phenotype of Bloom syndrome in humans: increased SCE in somatic cells and predisposition to cancer. Thus, Blmm3/m3 mice represent a valid model for Bloom syndrome. It is still unclear why Blmm2 and the other Blm allele30 cause embryonic lethality. It is worth noting, however, that both of these alleles contained the PGKneo cassette in the Blm locus. Because this cassette is known to have effects over a long distance17–20, it is likely that the embryonic lethality of our Blmm3 allele is caused by the effect of

a

b

427

article Blmm3/+

b

Blm m3/m3

no. of polyps/small intestine

a

c



Fig. 7 The effect of Blm deficiency on tumour susceptibility in ApcMin mice. a,b, Polyps in the small intestines of three-month Apcmin mice in a heterozygous (a) or homozygous (b) Blm mutant background. Pictures were taken from the same region of the small intestines of two siblings stained with 0.1% methylene blue. Polyps larger than 1 mm in diameter are indicated by white arrows. Scale bar, 1 mm. c, Tumour incidence in the small intestines of Apcmin mice. We analysed 14 siblings (8 Blm+/– and 6 Blm–/–) from 3 independent crosses. The average number of polyps per small intestine for each genotype is indicated by a bar and a number. d,e, Allelic loss of heterozygosity in intestinal tissue samples from three-month Apcmin mice in Blmdeficient (d) or Blm-proficient (e) backgrounds. Seven tumour samples (T1–T7) and 2 normal samples (N1 and N2) from 2 different mice (shown by black bar) were analysed at the various polymorphic SSLP marker sequences by PCR. Allelic loss at the Apcmin locus was analysed by direct heterozygote sequencing of amplified products surrounding the Apcmin mutation or cloning tumour amplified products and sequencing 8 clones from each tumour sample. We hypothesize that tumour sample T3 in (d) was contaminated by Apc+ cells because the sample retained both alleles at all markers tested, and when sequenced did not show LOH at the Apc locus.

d

e 150

107

100

50

27 10

Blm+/m3 Blmm3/m3

PGKneo on a neighbouring gene. However, an allele similar to the published lethal allele30, but with the PGKneo spequences removed, also causes embryonic lethality (P. Leder, pers. comm.). Further experiments are required to fully explain this complexity. This Bloom mouse model provides a means to study the underlying mechanism leading to genomic instability and cancer predisposition in Bloom syndrome. Our studies show that, in the absence of Blm function, mouse ES cells have an increased frequency of gene targeting, indicative of an increased frequency of homologous recombination. This is consistent with the high SCE rate and with observations that SCE in vertebrate cells is mediated by homologous recombination25. These findings are also consistent with the major functional role of RecQ-type DNA helicase homologues in E. coli and yeast. The elevated recombination process leads to an increase in the rate of LOH and an elevation in the incidence of intestinal tumours in Apcmin mice. In addition, it changes the primary mechanism of LOH from whole-chromosome loss to segmental loss. On the basis of these results, we conclude that the increase in somatic recombination, and consequently the increase in the rate of somatic LOH, is the underlying mechanism leading to cancer predisposition in Bloom syndrome. The Blmm3 allele described here may be valuable for genetic studies. The Blm-deficient ES cells have increased frequencies of vectorchromosome homologous recombination. Thus, these ES cells may be an especially permissive genetic background for gene targeting. Moreover, one of the challenges in loss-of-function studies in mammals is to overcome the diploid nature of the genome to establish the phenotypic consequences of recessive mutations. In this context, the availability of a mouse model with an increased rate of somatic LOH may enhance our ability to identify recessive mutations associated with specific phenotypes through somatic genetics, both in cultured cells and in vivo. For example, using such a mouse model, the effectiveness of identifying recessive mutations that can 428

cause cancer may be enhanced. In this context, the observation that the tumour incidence in the Blmm3/m3 mice is quite low (3%) before the age of one year makes them well suited for such an application.

Methods Construction of the Blm targeting vector and gene targeting in ES cells. We isolated a genomic DNA fragment from a mouse 129SvEv λ phage genomic library using a cDNA fragment corresponding to the human BLM cDNA. We confirmed the identity of the clone by sequencing and chromosomal localization using a radiation-hybrid mapping panel from The Jackson Laboratory. The intron/exon boundaries around exon 2 and exon 3 were defined by sequencing. The targeting vector was designed to replace a 5.8-kb BglII fragment that contains exon 2, the first coding exon. A loxP-PGKneo cassette was used as the positive selection marker with the intention to eventually remove the PGKneo cassette by Cre-loxP–mediated deletion. The vector contains a 7kb region of homology to Blm (5 kb for the left arm and 2.8 kb for the right arm, respectively). The 2.8-kb right arm also contains exon 3 of Blm. Gene targeting experiments and the subsequent removal of the loxP-PGKneo cassette from the targeted clones were carried out as described16,31, except we used AB2.2 ES cells, in which the endogenous Hprt is mutated32. Targeting of Gdf9 and Rad50 loci has been described24,25. Genotyping by Southern-blot analysis and PCR. We identified targeted clones by Southern-blot hybridization as described31. A 1.6-kb BglII fragment was used as an external probe to identify targeting events within the homology of the right arm. This probe detects a 6.8-kb BamHI fragment in the wild-type Blm allele and a 8.0-kb BamHI fragment in the expected targeted allele. The neo cassette was then used as an internal probe to establish the structure of the targeted allele. Genotyping for the targeted Gdf9 allele and the Rad50Brdc1 allele has been described24,25. The Apc and ApcMin alleles were distinguished by a PCR-based strategy as described33. Western-blot analysis. We carried out western-blot analysis for Blm expression using polyclonal antibodies raised against the N-terminal 432 aa of human BLM as described21. Total protein extracts were prepared



from testes of 8-week mice of appropriate genotypes. An antibody specific for topisomerase II was used as loading control. SCE analysis. We carried out sister chromatid analyses in MEF cells and lymphocytes using a classical BrdU-labelling protocol34. The protocol was modified for use with ES cells: the dosage of BrdU was reduced to 3 mg/ml. Metaphase chromosome spreads were stained with 0.1 mg/ml Acridine orange and SCE events were directly visualized under a fluorescent microscope with a green filter. Images were captured using a black-and-white digital camera and pseudocoloured.


Pathological analysis of tumour biopsy. After visual examination, the corpses of mice with tumours were fixed in phosphate buffered formalin. Histological and pathological analyses were performed according to standard procedures. For the tumour susceptibility study in ApcMin mice, small intestines were dissected out of fixed animals and cleaned with 70% ethanol. Each small intestine was then divided into 2-cm segments, cut open and spread as a sheet between two glass slides. Polyps larger than 1 mm in diameter were then scored using a Leica Wild M8 inverted dissection microscope. Tumour microdissection and DNA preparation. Genomic DNA was isolated from several polyps in the small intestines by microdissection from formalin fixed, paraffin-embedded sections (10 µm). Tissue was scraped from the slides with a new needle for each sample. The region of each section with the least amount of histologically normal epithelial cells was collected. For each intestine, normal tissue control was also collected. DNA was extracted in buffer containing Tris-HCl (10 mM, pH 8.4), KCl (50 mM), MgCl (2.5 mM), 0.45% Tween-20 and proteinase K (0.1 mg/ml) at 55 °C overnight. Samples were boiled for 10 min, diluted 1:10 with dH2O and 2 µl used for each PCR reaction. PCR of SSLP markers, PCR and sequencing of the Apc locus. SSLP markers D18Mit172, D18Mit69, D18Mit227, D18Mit123 and D18Mit189 were found to be polymorphic by measuring allele sizes in B6 and 129 mouse strains. For each set of SSLP markers, PCR was carried out as follows. Each

1. 2.

3. 4. 5.

6.

7.

8.

9.

10.

11.

12. 13.

14.

15. 16. 17.

German, J. Bloom syndrome: a Mendelian prototype of somatic mutational disease. Medicine 72, 393–406 (1993). Chakraverty, R.K. & Hickson, I.D. Defending genome integrity during DNA replication: a proposed role for RecQ family helicases. Bioessays 21, 286–294 (1999). Ellis, N.A. et al. The Bloom’s syndrome gene product is homologous to RecQ helicases. Cell 83, 655–666 (1995). Kowalczykowski, S.C. & Eggleston, A.K. Homologous pairing and DNA strandexchange proteins. Annu. Rev. Biochem. 63, 991–1043 (1994). Harmon, F.G. & Kowalczykowski, S.C. RecQ helicase, in concert with RecA and SSB protein, initiates and disrupts DNA recombination. Genes Dev. 12, 1134–1144 (1998). Gangloff, S., McDonald, J.P., Bendixen, C., Arthur, L. & Rothstein, R. The yeast type I topoisomerase Top3 interacts with Sgs1, a DNA helicase homolog: a potential eukaryotic reverse gyrase. Mol. Cell. Biol. 14, 8391–8398 (1994). Watt, P.M., Hickson, I.D., Borts, R.H. & Louis, E.J. SGS1, a homologue of the Bloom’s and Werner’s syndrome genes, is required for maintenance of genome stability in Saccharomyces cerevisiae. Genetics 144, 935–945 (1996). Stewart, E., Chapman, C.R., Al-Khodairy, F., Carr, A.M. & Enoch, T. rqh1+, a fission yeast gene related to the Bloom’s and Werner’s syndrome genes, is required for reversible S phase arrest. EMBO J. 16, 2682–2692 (1997). Davey, S. et al. Fission yeast rad12+ regulates cell cycle checkpoint control and is homologous to the Bloom’s syndrome disease gene. Mol. Cell. Biol. 18, 2721–2728 (1998). Puranam, K.L. & Blackshear, P.J. Cloning and characterization of RECQL, a potential human homologue of the Escherichia coli DNA helicase RecQ. J. Biol. Chem. 269, 29838–29845 (1994). Seki, M. et al. Molecular cloning of cDNA encoding human DNA helicase Q1 which has homology to Escherichia coli RecQ helicase and localization of the gene at chromosome 12p12. Nucleic Acids Res. 22, 4566–4573 (1994). Yu, C.-E. et al. Positional cloning of the Werner’s syndrome gene. Science 272, 258–262 (1996). Kitao, S. et al. Cloning of two new human helicase genes of the RecQ family: biological significance of multiple species in higher eukaryotes. Genomics 54, 443–452 (1998). Epstein, C.J., Martin, G.M., Schultz, A.L. & Motulsky, A.G. Werner’s syndrome: a review of its symptomatology, natural history, pathologic features, genetics, and relationship to the natural aging process. Medicine 45, 177–221 (1966). Kitao, S. et al. Mutation in RECQL4 cause a subset of cases of Rothmund-Thomson syndrome. Nature Genet. 22, 82–84 (1999). Abuin, A. & Bradley, A. Recycling selectable markers in mouse embryonic stem cells. Mol. Cell. Biol. 16, 1851–1856 (1996). Olson, E.N., Arnold, H.H., Rigby, P.W. & Wold, P.J. Know your neighbors: three phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell 85, 1–4 (1996).


article

DNA sample (2 µl) was amplified in a 20 µl reaction containing 0.25 µM of each primer, 200 µM concentrations of each dNTP, AmpliTaq Gold (0.5 U; PE Biosystems) and GeneAmp 10×PCR buffer (2 µl). The reactions were amplified in a Stratagene Robocycler under the following conditions: 1 cycle at 94 °C for 9 min followed by 40 cycles at 94 °C for 30 s, 53 °C for 1 min, 72 °C for 2 min, followed by 1 cycle at 72 °C for 10 min. Products were separated using agarose gel electrophoresis. The Apcmin locus was amplified using PCR primers surrounding the Apcmin mutation (forward (F), 5´–TACTACGGTATTGCCCAGCTC–3´; reverse (R), 5´–CTGTTGTTGGATGGTAAGCAC–3´). Each tumour DNA sample (2 µl) was amplified in a 30 µl reaction containing 0.5 µM of each primer, 200 µM of each dNTP, AmpliTaq Gold (0.5 U; PE Biosystems) and GeneAmp 10×PCR buffer (3 µl). The reactions were amplified in a Robocycler (Stratagene) under the following conditions: 1 cycle at 94 °C for 9 min followed by 40 cycles at 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min and 30 s, followed by 1 cycle at 72 for 10 min. Amplified products were either cloned by TA cloning or sequenced directly. PCR products or cloned PCR products were sequenced using the BigDye terminator sequencing kit (PE Biosystems) on an ABI 3700 DNA analyzer. Selection for 6TG-resistant colonies and Luria-Delbruck fluctuation analysis. We seeded ES cells at clonal density to obtain single-cell clones. These clones were then expanded to 1 well per clone in 6-well feeder plates (about 106 cells). The cells were desegregated, counted and seeded at 2.5×105 cells on a 100-mm feeder plate to avoid the cross-killing effect of 6TG. Twelve hours after plating, 6TG selection [10–5M] was applied. The number of 6TG-resistant colonies was scored 11 days after plating. The raw data were then tabulated and analysed29. Acknowledgements

We thank P. Biggs for comments on the manuscript. A.B. acknowledges support from the National Cancer Institute.

Received 7 December 1999; accepted 22 August 2000.

18. Meyers, E.N., Lewandoski, M. & Martin, G.R. An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nature Genet. 18, 136–141 (1998). 19. Colledge, W.H. et al. Generation and characterization of a δ F508 cystic fibrosis mouse model. Nature Genet. 10, 445–452 (1995). 20. Van der Hoeven, F., Zakany, J. & Duboule, D. Gene transpositions in the HoxD complex reveal a hierarchy of regulatory controls. Cell 85, 1025–1035 (1996). 21. Gharibyan, V. & Youssoufian, H. Localization of the Bloom’s syndrome helicase to punctate nuclear structures and the nuclear matrix and regulation during the cell cycle: comparison with the Werner’s syndrome helicase. Mol. Carcinog. 26, 261–273 (1999). 22. Jones, S.N. et al. The tumorigenetic potential and cell growth characteristics of p53-deficient cells are equivalent in the presence or absence of Mdm2. Proc. Natl Acad. Sci. USA 93, 14106–14111 (1996). 23. Dong, J. et al. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 383, 531–535 (1996). 24. Luo, G. et al. Disruption of mRad50 causes embryonic stem cell lethality, abnormal embryonic development, and sensitivity to ionizing radiation. Proc. Natl Acad. Sci. USA 96, 7376–7381(1999). 25. Sonoda, E. et al. Sister chromatid exchanges are mediated by homologous recombination in vertebrate cells. Mol. Cell. Biol. 19, 5166–5169 (1999). 26. Luria, S.E. & Delbruck, M. Mutation of bacteria from virus sensitivity to virus resistance. Genetics 28, 491–510 (1943). 27. Bilger, A., Shoemaker, A.R., Gould, K.A. & Dove, W.F. Manipulation of the mouse germline in the study of Min-induced neoplasia. Semin. Cancer Biol. 7, 249–260 (1996). 28. Luongo, C., Moser, A.R., Gledhill, S. & Dove, W.F. Loss of Apc+ in intestinal adenomas from Min mice. Cancer Res. 54, 5947–5952 (1994). 29. Dietrich, W.F. et al. Genetic identification of Mom-1, a major modifier locus affecting Min-induced intestinal neoplasia in the mouse. Cell 75, 631–639 (1993). 30. Chester, N., Kuo, F., Kozak, C., O’Hara, C.D. & Leder, P. Stage-specific apoptosis, developmental delay, and embryonic lethality in mice homozygous for a targeted disruption in the murine Bloom’s syndrome gene. Genes Dev. 12, 3382–3393 (1998). 31. Ramirez-Solis, R., Davis, A. & Bradley, A. Gene targeting in embryonic stem cells. Methods Enzymol. 225, 855–878 (1993). 32. Hasty, P., Rivera-Perez, J., Chang, C. & Bradley, A. Target frequency and integration pattern for insertion and replacement vectors in embryonic stem cells. Mol. Cell. Biol. 11, 4509–4517 (1991). 33. Jacoby, R.F. et al. Chemoprevention of spontaneous intestinal adenomas in the Apc Min mouse model by the nonsteroidal anti-inflammatory drug piroxicam. Cancer Res. 56, 710–714 (1996). 34. German, J. & Alhadeff, B. Sister chromatic exchange (SCE) analysis. in Current Protocols in Human Genetics (eds Dracopoli, N.C. et al.) 8.6.1–8.6.10 (John Wiley & Sons, New York, 1994).

429