Candida tropicalis Expresses Two Mitochondrial 2-Enoyl Thioester ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 278, No. 42, Issue of October 17, pp. 41213–41220, 2003 Printed in U.S.A.

Candida tropicalis Expresses Two Mitochondrial 2-Enoyl Thioester Reductases That Are Able to Form Both Homodimers and Heterodimers* Received for publication, July 16, 2003 Published, JBC Papers in Press, July 30, 2003, DOI 10.1074/jbc.M307664200

Juha M. Torkko‡, Kari T. Koivuranta‡§, Alexander J. Kastaniotis‡, Tomi T. Airenne‡, Tuomo Glumoff‡, Mika Ilves¶, Andreas Hartig储, Aner Gurvitz储, and J. Kalervo Hiltunen‡** From the ‡Biocenter Oulu, Department of Biochemistry and the ¶Department of Physiology, FIN-90014 University of Oulu, Finland, §VTT Biotechnology, P.O.Box 1500, FIN-02044 VTT, Finland, and the 储Max F. Perutz Laboratories, University Departments at the Vienna Biocenter, Department of Biochemistry and Molecular Cell Biology, University of Vienna, Dr. Bohr-Gasse 9, A-1030 Vienna, Austria

Here we report on the cloning of a Candida tropicalis gene, ETR2, that is closely related to ETR1. Both genes encode enzymatically active 2-enoyl thioester reductases involved in mitochondrial synthesis of fatty acids (fatty acid synthesis type II) and respiratory competence. The 5ⴕ- and 3ⴕ-flanking (coding) regions of ETR2 and ETR1 are about 90% (97%) identical, indicating that the genes have evolved via gene duplication. The gene products differ in three amino acid residues: Ile67 (Val), Ala92 (Thr), and Lys251 (Arg) in Etr2p (Etr1p). Quantitative PCR analysis and reverse transcriptase-PCR indicated that both genes were expressed about equally in fermenting and ETR1 predominantly respiring yeast cells. Like the situation with ETR1, expression of ETR2 in respiration-deficient Saccharomyces cerevisiae mutant cells devoid of Ybr026p/Etr1p was able to restore growth on glycerol. Triclosan that is used as an antibacterial agent against fatty acid synthesis type II 2-enoyl thioester reductases inhibited growth of FabI overexpressing mutant yeast cells but was not able to inhibit respiratory growth of the ETR2- or ETR1-complemented mutant yeast cells. Resolving of crystal structures obtained via Etr2p and Etr1p co-crystallization indicated that all possible dimer variants occur in the same asymmetric unit, suggesting that similar dimer formation also takes place in vivo.

Candida tropicalis is an asporogenic diploid yeast that is specialized for growth on lipid-rich media. When n-alkanes or fatty acids are available as a carbon and energy source, C. tropicalis cells enhance expression of several lipid-metabolizing enzymes (1, 2). In this organism, alternative transcripts

* This work was supported by the European Community Access to Research Infrastructure action of the Improving Human Potential Program and by grants from the Sigrid Juse´lius Foundation and the Academy of Finland. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) U94996. The atomic coordinates and structure factors (code IN96) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/). ** To whom correspondence should be addressed: Dept. of Biochemistry and Biocenter Oulu, P.O. Box 3000, University of Oulu, Oulu FIN-90014, Finland. Tel.: 358-8-553-1150; Fax: 358-8-553-1141; E-mail: [email protected]. This paper is available on line at http://www.jbc.org

of a single gene or copies of transcripts arising from closely related but separate genes occur frequently (3–5). Consequently, these enzymes are present as an array of isoforms, each of which can be targeted to different subcellular locations and may serve either identical or different metabolic functions. This genetic redundancy might be used as a back-up system to sustain central cellular needs (6, 7). For example, peroxisomal acyl-coenzyme A (CoA)1 oxidase (Pox) is a key enzyme of ␤-oxidation that is present as multiple forms in C. tropicalis (1, 8, 9). At least three POX genes are present in the C. tropicalis genome. The closely related POX4 and POX5 have been shown to be differentially expressed depending on what lipids are available for growth (1). Recently, we reported on the identification of a novel mitochondrial 2-enoyl thioester reductase Etr1p from C. tropicalis (10) and also demonstrated that a homologous Saccharomyces cerevisiae protein Ybr026p involved in mitochondrial respiratory function (11) exhibits the same activity. Disruption of the corresponding nuclear gene in S. cerevisiae results in a respiratory-deficient strain unable to grow on nonfermentable carbon sources (11). S. cerevisiae Etr1p was suggested to link the assembly of the respiratory complexes with prokaryotic type fatty acid synthesis (type II) in fungal mitochondria (10, 12–16). In the present study we describe a further C. tropicalis mitochondrial 2-enoyl thioester reductase, Etr2p, that is closely related to Etr1p and compare the function of the two enzymes. Quantitative PCR was used to determine the expression pattern of the two reductase genes in C. tropicalis. The ability of ETR2 to rescue the respiratory-deficient phenotype of the ybr026c⌬ strain from S. cerevisiae was also studied. Crystallization experiments on a mixture of purified Etr2p and Etr1p was undertaken to see whether homo- and heterodimeric variants were possible. The results are discussed in terms of genetic redundancy in lipid metabolism and its significance for the maintaining mitochondrial respiratory function. EXPERIMENTAL PROCEDURES

Cloning of ETR2 and ETR1—The primers used in this study are described in Table I. The CTGEN1 genomic fragment revealing the sequence for ETR1 and other genomic fragments, among them CTPVU25 and CTHAE10 (see Fig. 1A), were obtained by PCR, ligationmediated PCR, and screening of a C. tropicalis genomic DNA library as described (10). The sequences of the partially overlapping genomic fragments (CTPVU25, CT55PCR, CTPVUB10, and CTHAE10; see Fig. 1 The abbreviations used are: CoA, coenzyme A; ETR, 2-enoyl thioester reductase; ORF, open reading frame; RST, random sequenced tag; RACE, rapid amplification of cDNA ends.

41213

41214

C. tropicalis Mitochondrial 2-Enoyl Reductase Genes TABLE I Primers used in this study

Primer

Sequence (5⬘ 3 3⬘)

CTRED18 CTRED19 CTRED2R Val67IleForw Val67IleRev Thr92AlaForw Thr92AlaRev Arg251LysForw Arg251LysRev ETR1sense ETR1antisense ETR2sense ETR2antisense ETR1fluoro ETR2fluoro 18Ssense 18Santisense 18Sfluoro

CTGCGGAGTTATCCTGTATCTGG AGAACCCAACATCGACCCAGGTC GGCCAAGTTGTCGTCATCAATCTCA CATTGGGCTCCCCAATCAACCCT CGGAAGGGTTGATTGGGGAGCCCAATG CTGGGTTTGGCACAGCCGAACCTGCAGC GCTGCAGGTTCGGCTGTGCCAAACCCAG GACCAGAACAACTCAAAGGAATTTGGCCCTACC GGTAGGGCCAAATTCCTTTGAGTTGTTCTGGTC GTCCGGCGGTGAAGCC CAACTTTCTGGCGATACCGGT TCTACCCATCGAAACCGGC TTACCGCAAGGTGCTGCAG Fam-CCCTCAACTGTGTCGGTGGTAAGAGCTC-Tamra Fam-AAGACTACTGGGTTTGGCACAGCCGAA-Tamra TGGTCGCTTGGCTGAAACTTAAAG AGTCAAATTAAGCCGCAGGC Vic-CCTGGTGGTGCCCTTCCGTCA-Tamra

1A) were highly similar but not identical in all regions. Primers CTRED18 and CTRED19 corresponding to the 5⬘-flanking and reverse 3⬘-flanking sequences of CTPVU25 and CTHAE10, respectively, were used in PCR with genomic DNA as template. A DNA fragment of 3 kb was obtained (CTGEN2; see Fig. 1A), cloned into pUC18, and sequenced, revealing the sequence for ETR2. Pulsed Field Gel Electrophoresis—Preparation of C. tropicalis chromosomal DNA and pulsed field gel electrophoresis were carried out according to the Bio-Rad instruction manual for CHEF-DR pulsed field electrophoresis systems (Rev. B, Bulletin # 9086), available on the Bio-Rad Website (www.Bio-Rad.com) and the protocol for the preparation of agarose-embedded yeast DNA. The correct amount of cells required for the procedure was estimated by spinning down the cells to obtain a wet pellet corresponding to a volume of 50 ␮l (17). Chromosomes were separated on a 0.8% agarose gel in TAE (40 mM Tris, 20 mM acetate, and 2 mM EDTA, pH 8.5), for 24 h at 150 V and 200 s of switch time at 13 °C, followed by 48 h at 100 V and 700 s of switch time at 10 °C. After electrophoresis, the DNA was blotted onto a Hybond-N⫹ nylon transfer membrane (Amersham Biosciences) following the BioRad instruction manual procedure for Megabase blotting. The 32Plabeled probe used to detect ETR2 and ETR1 was generated using the Roche Random primed DNA labeling kit (Roche Applied Science). The template for probe generation was a 553-bp PstI-SacI fragment from the ETR1 coding region. Hybridization was carried out overnight at 65 °C as described (18). Analysis of Gene Expression by 5⬘-RACE and Quantitative PCR— C. tropicalis pK233 cells (American Type Culture Collection, Rockville, MD) propagated overnight in YPD (1% yeast extract, 2% peptone, and 2% D-glucose) were transferred at an A600 of 0.1 to YP medium containing 2% glucose or 0.2% oleic acid as a sole carbon source and grown for 7 h at 30 °C. The cells were frozen in liquid nitrogen and stored at ⫺70 °C until required. RNA was extracted with a QuickPrep total RNA extraction kit (Amersham Biosciences). The PCR amplification of the 5⬘-RACE fragments included the primers CTRED2R (Table I) corresponding to a sequence of the reductase and AP1 corresponding to the ligated adaptor (Marathon cDNA amplification kit, Clontech Laboratories, Inc., Palo Alto, CA). PCR fragments were ligated into pUC18, transformed into Escherichia coli DH5␣ cells, and screened with 32Plabeled CTRED2R. The positive colonies were isolated and sequenced. Moloney murine leukemia virus reverse transcriptase and random hexamer primers (MBI Fermentas, St. Leon-Rot, Germany) were used for the first strand cDNA synthesis. The synthesis product was used for the PCR performed with ABI PRISM® 7700 sequence detection system (Applied Biosystems, Foster City, CA) using TaqMan chemistry and a pair of sense and antisense primers specific to ETR2 or ETR1. The products of the quantitative PCR were detected using bifunctional fluorogenic probes ETR2fluoro and ETR1fluoro, respectively. The results were normalized to 18 S RNA quantified from the same samples. The probe 18Sfluoro was used for the 18 S amplicon detection. The p values were determined as described (19). Protein Overexpression and Purification—pYE352::ETR2 was generated by site-directed mutagenesis (Stratagene, La Jolla, CA) using pYE352::ETR1 (10) as a template DNA and three pairs of different forward and reverse primers in stepwise PCR amplifications. The resulting pYE352::ETR2 was used to transform the BJ1991-based S.

TABLE II Data collection and refinement statistics for the reductase structure Etr1p-Etr1p, Etr1p-Etr2p, and Etr2p-Etr2p

Space group Unit cell: a, b, c (Å) ␣, ␤, ␥(°) Monomers/asymmetric unit Matthew’s number (Å3/Da) Solvent content (%) Resolution range (Å) Rmerge (%)(last shell) Completeness (%) (last shell) I/␴ (last shell) Reflections (working set) Reflections (test set) Rcryst (%)a Rfree (%)a Ramachandran plot Most favoured region (%) Additionally allowed region (%) Protein atomsb Water atomsb Sulfate (SO42⫺) atomsb NADPH atomsb Average B-factor (Å2) Main chain atoms Side chain atoms Water atoms Sulfate (SO42⫺) atoms NADPH atoms Residual mean standard deviation Bond lengths (Å) Bond angles (°)

C2 229.453, 95.501, 164.229 90.00, 124.714, 90.00 6 3.13 60.7 19.43–1.98 5.1 (34.8) 97.5 (95.2) 17.45 (3.90) 202400 10494 19.53 23.48 92.6 7.4 16862 1530 35 144 27.3 31.6 40.5 49.4 33.6 0.013 1.46

兺兩Fobs ⫺ Fcalc兩兺兩Fobs兩 b Nonhydrogen atoms. a

Rcryst/free ⫽

cerevisiae ybr026c⌬ strain for Etr2p overexpression (10, 20). Etr2p was purified in a manner similar to that described for Etr1p (10). Soluble protein extracts were analyzed on SDS-PAGE (21) and on a Jasco J715 spectropolarimeter (Great Dunmow, Essex, UK). Reductase activities were determined as described (10), in addition to which, the reaction mixture was supplemented with 50 ␮g/ml of essentially fatty acid free albumin (Sigma-Aldrich). Mass Spectrometry—Purified Etr2p or Etr1p at a concentration of 5 mg/ml was diluted 1:40 in 40% acetonitrile, 0.1% trifluoroacetic acid and mixed with an equal volume of ␣-cyano-4-hydroxy cinnamic acid matrix, prepared as saturated solution in 40% acetonitrile, 0.1% trifluoroacetic acid (v/v). Mass measurements were carried out on an Applied Biosystems Voyager-DETM STR Biospectrometry work station operating in linear mode. The mass spectra were calibrated with bovine serum albumin as an external standard. Crystallization of Etr2p and Etr1p, Data Collection, and Structure Determination—Crystals containing the dimers Etr1p-Etr1p, Etr1pEtr2p, and Etr2p-Etr2p were obtained with the hanging drop method (22) using 20 mg/ml mixture of Etr1p:Etr2p in a 1:1 ratio and 1.8 M (NH4)2SO4, 0.1 M N-(2-acetamido)-2-iminodiacetic acid/NaOH (pH 7.0) as a precipitant. Crystallization drops were also supplemented with 5 mM NADPH and 1 mM octanoyl-CoA. The data for the crystal structure were collected at the beam line I711 of the MAX-lab synchrotron (Lund, Sweden). The structure was solved with molecular replacement using the program AMoRe (CCP4 suite). Analysis of Etr1p apoenzyme crystal structure without bound NADPH has been reported previously (23) and was used as a starting model in the calculations. Refinement of the structure was initiated by one cycle of simulated annealing using CNS (24) and continued with Refmac_5.1.12 (CCP4 suite) employing TLS (25). Waters were added by Arp/Warp (26) in cycles of 600 molecules followed by successive refinement runs and rebuilding in the program O (27). The ligand could be reliably built into the structure only after all waters were assigned at the final stage of the refinement, when only small gaps were present in the ligand density and with clear density for the phosphates and the ring structures. The crystal characteristics and refinement statistics are shown in Table II. The geometries of the structures were analyzed with the programs O, WHAT IF (28), and PROCHECK (29). All of the structure drawings were created with Swiss-PDBViewer (30) and edited with Adobe Photoshop 7.0. Respiratory Growth Analysis—To examine growth on nonferment-

C. tropicalis Mitochondrial 2-Enoyl Reductase Genes able carbon sources, S. cerevisiae BJ1991 ybr026c⌬ cells or those transformed with plasmid DNA for overexpression of Ybr026p, enoyl-ACP reductase (FabI) from E. coli, catalase (Cta1p), Etr2p, or Etr1p (10) were cultured on synthetic complete medium supplemented with 3% glycerol. Glycerol medium plus 0.125, 0.5, or 1.0 ␮g/ml of triclosan was prepared to examine the effect of the drug on the reductase function and viability of respiring yeast cells. After autoclaving the culture medium, triclosan was added from a 10 mg/ml (ethanol) stock solution. Triclosan was a gift from Louis Widmer (Dermatologica Widmer, Helsinki, Finland). RESULTS

C. tropicalis Genomic DNA Contains a Novel Gene ETR2 Related to ETR1—Sequencing of a C. tropicalis genomic fragment (CTGEN2; see “Experimental Procedures”) revealed an open reading frame (ORF) of 1158 nucleotides, encoding a polypeptide of 386 amino acid residues that was termed Etr2p (Fig. 1A). CTGEN2 included 958 and 828 bp of the 5⬘- and 3⬘-flanking sequences from ETR2, respectively. The nucleotide sequences of the ETR2 and ETR1 (10) were compared and found to be 96.8% identical. Differences between Etr2p and Etr1p were seen in three residues: Ile67 in Etr2p is replaced by Val, Ala92 is replaced by Thr, and Lys251 is replaced by Arg in Etr1p. The ETR2 nucleotide sequence and the respective product Etr2p in comparison with Etr1p is shown in Fig. 2. The flanking regions of ETR2 and ETR1 revealed identities of 90.2% (664 bp) and 89.2% (814 bp) on the 5⬘ and 3⬘ sequences, respectively. Southern blot analysis of genomic DNA from C. tropicalis using a 32P-labeled fragment consisting of ETR1 (CTGEN1; see “Experimental Procedures”) as a probe yielded two hybridizing fragments in each of the genomic DNA samples, which had been digested and/or double-digested with EcoRI, HindIII, and BamHI, as shown in Fig. 1B. Because the probe did not contain any of these restriction sites, the data suggested that CTGEN2 and CTGEN1 are at different loci in the genome. Subsequently, pulsed field gel electrophoresis was applied to separate chromosomal DNA followed by Southern blotting. As shown in Fig. 1C, eight chromosomal bands were separated on the gel. When compared with previously reported data, the chromosomal pattern we obtained correlated well with results of Kamiryo et al. (31) but differed slightly from the data reported by Doi et al. (32). Our probe hybridized with bands VI and VII (Fig. 1C), indicating that ETR2 and ETR1 reside on separate chromosomes in the genome of C. tropicalis. Both ETR2 and ETR1 Are Expressed in C. tropicalis under Various Growth Conditions—5⬘-RACE was carried out with total RNAs of 2% glucose and 0.2% oleic acid-grown C. tropicalis cells. Twenty five (twenty) 5⬘-RACE clones were obtained from glucose (oleic acid) grown yeast cells, the longest amplified fragments extending to the ⫺33 (⫺19) position in the 5⬘-untranslated region. The 5⬘-RACE analysis showed that thirteen (six) amplified fragments presented ETR2 and twelve (fourteen) fragments presented ETR1 among the 5⬘-RACE clones from glucose (oleic acid)-grown yeast cells. To quantify ETR2 and ETR1 expression on different media quantitative PCR was carried out. Total RNA was extracted from cells grown on media containing glucose or oleic acid as sole carbon source. RNA was reverse transcribed to cDNA and amplified by PCR for quantification with ETR2- and ETR1specific primers (see “Experimental Procedures”). Relative values for the amount of ETR2 RNA were 1.00 on glucose and 2.17 on oleic acid grown cells and for the amount of ETR1 RNA 1.31 on glucose and 2.95 on oleic acid, indicating that both genes were more strongly expressed on oleic acid than on glucose as a carbon source (Table III). The ETR2 Gene Product Encodes an Etr1p-like 2-Enoyl Thioester Reductase with a Preference for Short and Medium Chain

41215

over Long Chain Enoyl Thioesters—To analyze the function of Etr2p as a 2-enoyl thioester reductase and to characterize its substrate specificity, it was overexpressed in S. cerevisiae and chromatographically purified to apparent homogeneity. As a comparison, Etr1p was also examined. When the purified proteins were analyzed by circular dichroism spectroscopy, the overall spectra of Etr2p and Etr1p were identical, signifying preservation of the secondary structure elements. Mass spectrometry analysis gave molecular masses which corresponded to theoretical values of 39.34 and 39.39 kDa for Etr2p and Etr1p, respectively, excluding the mitochondrial targeting signals, not present in the mature proteins (10). The mass difference was attributed to the difference in three amino acid residues deduced from cDNA sequence (Fig. 2). The specific reductase activities were determined using trans-2-hexenoylCoA (C6), trans-2-decenoyl-CoA (C10), and trans-2-hexadecenoyl-CoA (C16) as substrates. The respective values obtained for Etr2p and Etr1p were 17.3 and 18.0 ␮mol/min/mg of protein with trans-2-hexenoyl-CoA, 13.6 and 11.7 ␮mol/min/mg of protein with trans-2-decenoyl-CoA, and 4.3 and 5.8 ␮mol/min/mg of protein with trans-2-hexadecenoyl-CoA. Hence, both proteins showed a similar preference toward short and medium chain 2-enoyl thioesters. Gas chromatographic analysis of the reaction end products demonstrated that, like Etr1p (10), also Etr2p was able to carry out the reduction of the trans-2 double bond both in monounsaturated trans-2- and conjugated trans2,trans-4-enoyl thioesters. Similarly to Etr1p, Etr2p was specific for NADPH and could not utilize NADH as hydrogen donor in the catalysis. Etr2p-Etr1p Heterodimerization Enables Generation of Various Native Forms of the Enzyme—The present results indicated that C. tropicalis simultaneously expresses two highly similar enoyl thioester reductases. Because previous data using purified Etr1p indicated that it functions as a dimer (23), this raised the issue of whether the two reductases may form a heterodimer. Purified Etr2p and Etr1p were mixed, and crystals were grown that diffracted at 1.98 Å resolution. Determination of the crystal structure allowed the identification of the locations of Ile67 (Val), Ala92 (Thr), and Lys251 (Arg) in Etr2p (Etr1p). Detection of these different amino acids in the asymmetric unit in the crystal revealed the existence of all possible dimer variants, Etr1p-Etr1p, Etr1p-Etr2p, and Etr2p-Etr2p (Fig. 3, A and B). Fragmented electron density for the NADPH co-factor could be seen in three of six polypeptide chains in the asymmetric unit. Each type of dimer was liganded with one NADPH, and in the heterodimer Etr1p binds the co-factor in this crystal (Fig. 3A). Thus, the structure contains both Etr2p and Etr1p in liganded and unliganded form. Electron density for the octanoyl-CoA, present in the crystallization mixture, was not observed. When comparing the apo-Etr1p component in the heterodimeric crystal to the structures of Etr1p with and without the bound ligand (Ref. 23; 1GUF and 1GU7 in the Protein Data Bank, respectively), it is noted that apo-structures show identical conformation and the conformational change from the apo- to holoenzyme form upon binding of NADPH (Fig. 3, C and D) is similar for the two proteins. It is also worth noting that despite this dynamics in the molecule, the apo- and holoenzymes are sufficiently similar as crystallizable species such that they can be incorporated into the same crystal lattice. The three amino acids distinguishing Etr2p and Etr1p were neither involved in crystal contacts nor restricted dimer formation. Of the differing amino acids Ala92 (Thr) and Lys251 (Arg) are located on the protein surface facing the solvent; the former in the middle of a large loop between helix ␣2 and strand ␤4 and the latter in the beginning of helix ␣E (the nomenclature of

41216

C. tropicalis Mitochondrial 2-Enoyl Reductase Genes secondary structures according to Airenne et al. (23)). Ile67 (Val) at the end of strand ␤3, on the other hand, is located deep inside the nucleotide- and substrate-binding pocket but spatially separated from the catalytic Tyr79 by an intervening helix ␣2 (Fig. 3B). Thus, the differing residues are not in the near vicinity of the active site. Etr2p Is Able to Restore Respiration to the ybr026c⌬ Strain from S. cerevisiae, a Function Not Restricted by the Anti-bacterial Agent Triclosan—Etr2p was overexpressed in the respiratory-deficient ybr026c⌬ strain from S. cerevisiae. Immunoelectron microscopy with anti-Etr1p antibodies indicated mitochondrial localization of Etr2p (data not shown) similar to Etr1p (10). Like the situation with mitochondrial Etr1p, overexpression of Etr2p was able to restore growth of the deletion strain on glycerol in the complementation experiment (Fig. 4). Etr1p and Etr2p represent members of the medium chain dehydrogenase/reductase superfamily of proteins (10), structurally different from prokaryotic reductases belonging to the short chain dehydrogenase/reductase superfamily (23, 33–36). Triclosan is an anti-bacterial agent used in toothpaste, soaps, and other consumer products. Its action is transmitted via its ability to inhibit fatty acid synthesis type II 2-enoyl thioester reductases either by forming noncovalent, high affinity ternary complexes with the enzyme and NAD(P)⫹, as with FabI from E. coli, or by reversibly inhibiting the enzyme, as with FabL from Bacillus subtilis (37–39). Introduction of triclosan into the culture plates at concentrations that are inhibitory against bacteria (37, 38) did not prevent the growth of the ybr026c⌬ cells transformed with plasmids encoding Etr1p, Etr2p, and Ybr026p. However, the ybr026c⌬ strain expressing a mitochondrially targeted FabI (10) showed retarded growth on the triclosan containing medium in a concentration-dependent manner (Fig. 4). Triclosan was not inhibitory for the growth of yeast cells on rich glucose (data not shown). DISCUSSION

This work reports on the characterization of a novel gene ETR2, whose product functions as a mitochondrial 2-enoyl thioester reductase. In the process of cloning ETR1 (10), genomic fragments were isolated that contained an ORF (ETR2) very similar to that of ETR1. The ORFs were 96.8% identical at the nucleotide level, encoding proteins differing in three amino acid residues only. Differences in the 5⬘ and 3⬘

FIG. 1. ETR2 and ETR1 in the genome of C. tropicalis. A, organization of the genomic fragments of ETR1 and ETR2. CTGEN1, and CTPVU25, CTPVUB10 and CTHAE10 were obtained by ligation-medi-

ated PCR. CTGEN2 was obtained by PCR amplification from genomic DNA. The positions of the oligonucleotides CTRED18 and CTRED19 are indicated by arrowheads, and ORFs are shown as boxes. CTGEN2 included an additional ORF (ORF3) ending 202 bp upstream from the ORF-ETR2 start codon. CTGEN1 also contained another ORF (ORF2) downstream from ORF-ETR1, encoding a putative polypeptide of 163 amino acids with a similarity of 66% to the N-terminal 134 amino acids of allantoinase from S. cerevisiae (accession number S48489). The triplets for initiation (ATG) and stop codons (TAG or TGA) are indicated. B, ETR genes as revealed by Southern blot analysis. Yeast genomic DNA (10 ␮g) was digested with EcoRI (1), HindIII (2), BamHI (3), EcoRI⫹HindIII (4), EcoRI⫹BamHI (5), or HindIII⫹BamHI (6) and loaded onto an agarose gel. After electrophoretic fractionation and blotting, the nitrocellulose filter was hybridized with 32P-labeled CTGEN2. The sizes (kb) of marker fragments are indicated on the left. C, chromosomal localization of ETR1 and ETR2 by pulsed field gel electrophoresis. C. tropicalis and Hansenula wingei (DNA size marker) chromosomal DNA were separated on 0.8% TEAE for 24 h at 150 V and 200 s of switch time at 13 °C, followed by 48 h at 100 V and 700 s of switch time at 10 °C (ethidium bromide stain is shown on the right). A total of eight chromosomal bands (I–VIII) were observed. Separated DNA was probed with a 553-bp ETR1 PstI/SacI fragment of ETR1 (blot shown on the left). The sizes in megabase pairs of the observed H. wingei chromosomal DNA fragments (3.13, 2.70, 2.35, 1.81, 1.66, 1.37, and 1.05) agreed with those reported previously (3.5, 3.1, 2.8, 2.6, 2.3, 2.1, 1.38, and 1.02 and 2.8, 2.6, 2.4, 2.2, 2.1, 1.3, 1.2, and 1.0 (31, 32), respectively).

C. tropicalis Mitochondrial 2-Enoyl Reductase Genes

41217

FIG. 2. The sequence of the coding region of ETR2. Nucleotides in the ETR2 sequence are numbered from the first nucleotide of the triplet for initiation methionine as ⫹1. Nucleotides that differ between ETR1 and ETR2 are shown in bold type. The deduced amino acid residues in the predicted mitochondrial targeting signal preceding the mature Etr2p and Etr1p are italicized. Underlined letters indicate the differences in the nucleotide sequences between Etr2p and Etr1p responsible for the exchange in the amino acid residues. Serine residues 114 and 336 encoded by nonuniversal usage of the leucine (CUG) codon (52) are double underlined. The region corresponding to the amino acid chain termination site on the mRNA is shown by an asterisk. The wavy line indicates the polyadenylation signal.

TABLE III Expression of ETR1 and ETR2 under glucose and oleic acid as a sole carbon source The simultaneously measured values of the quantitative RT-PCR analysis were normalized to the amount of 18 S ribosomal RNA, and the values are the means ⫾ S.D. (n ⫽ 8). The PCR amplification of the 5⬘-RACE fragments were carried with total RNA isolated from cells grown with either glucose or oleic acid. The amplified fragments were transformed in E. coli, and the frequencies of positive colonies are given. Gene

RT-PCR ETR1 ETR2 5⬘-RACE ETR1 ETR2

Glucose

Oleic acid

1.31 ⫾ 0.19 1.00 ⫾ 0.12

2.95 ⫾ 1.24 2.17 ⫾ 1.04

48% 52%

70% 30%

p ⬍ 0.01 p ⬍ 0.01

regions of the two ORFs were more pronounced (90.2 and 89.2%, respectively). Purified Etr2p contained enoyl-CoA reductase activity, and expression of Etr2p in the respirationdeficient S. cerevisiae ybr026c⌬ strain (11) was able to restore

growth to the disruption strain on glycerol. These data demonstrated that C. tropicalis contained at least two functional 2-enoyl thioester reductases. The phenomenon of genetic redundancy and the presence of different protein isoforms is widespread. In addition to being a fuel for evolvement of protein families, the presence of more than one functional copy of a gene can be seen as advantageous, if genes perform more than one specific function or are functioning under different conditions (6). Redundancy is common for all species and can be found even in the most simple genomes such as that of the parasitic Mycoplasma genitalium and extending to more complex multicellular eukaryotic genomes that may rely on redundant genes during development (6). Although the random sequenced tags (RSTs) available at the Genole´vures data base, the data bank of RSTs of a group of hemiascomycetous yeasts, at present cover only about 20% of the genome of C. tropicalis, genomic exploration of sequences as well as combining the data in the literature demonstrate

41218


FIG. 4. Effects of triclosan on the growth of the yeast cells. The respiration-dependent growth of different yeast transformants was examined on glycerol with or without the addition of the drug triclosan (0.125, 0.5, and 1.0 ␮g/ml) in the growth medium. The strains examined are BJ1991 ybr026c⌬ (1), BJ1991 ybr026c⌬ transformed with pYE352::MRF1 (2), pYE352::ETR1 (3), pYE352::ETR2 (4), pYE352::FABI (5), or pYE352::CTA1 (6). The plates were incubated for 5 days at 30 °C.

that a number of fatty acid metabolism (Table IV) enzymes encoded by single genes in S. cerevisiae have more than one copy of the corresponding genes in C. tropicalis (7, 40). The data base search and the literature revealed that ⌬3,5-⌬2,4-dienoylCoA isomerases, ⌬3-⌬2-enoyl-CoA isomerases, multifunctional enzymes type-2, acetoacetyl-CoA thiolases, carnitine acetyltransferases, and acyl-CoA oxidase (1, 8, 41– 43) together with Etr1p and Etr2p, belong to this category (Table III). Because the percentage of coverage of the C. tropicalis genome is still small and many of genes from S. cerevisiae wait for an identification of their orthologs in C. tropicalis, the number of genes in the group presenting genetic redundancy is likely to increase in the future. Comparison of the amount of RNA between glucose- and oleic acid-grown cells indicated that both ETR2 and ETR1 were simultaneously present under both conditions. Both gene products were present in equal amounts in cells grown on glucose, but their expression levels are increased upon a shift of cells from fermentable (glucose) to nonfermentable (oleic acid) carbon source in a way that ETR1 was the more predominantly expressed form. Aerobic organisms have evolved sensory systems to monitor oxygen availability, and, for instance in S. cerevisiae, there is a subset of genes of which transcription involves sensing oxygen and hypoxia (44). However, no changes were shown in the expression of ETR2 and ETR1 when cells were shifted to grow from respiration to anoxia (data not shown). The increased expression of both ETR2 and ETR1 on nonfermentable carbon source, oleic acid, suggests that the gene products are linked to cellular respiration. Assays for the enzymatic activity of Etr2p and Etr1p indicated that both proteins were capable of catalyzing with almost identical specific activities the reduction of the double bonds in a series of trans-2-enoyl thioesters with different chain lengths. In this respect the properties of Etr1p and Etr2p are unique among the acyl-CoA metabolizing enzymes. Often the members of this group show preference for certain chain length of fatty acids, although overall substrate preference overlaps. Typical examples are mammalian acyl-CoA dehydrogenases and ␤-keto-acyl-CoA thiolases (45). The similar kinetic properties of Etr2p and Etr1p are also supported by the structural data; the

FIG. 3. Schematic representation of the Etr1p-Etr2p crystal structure. A, the contents of one asymmetric unit of the Etr1p-Etr2p crystal unit cell. Polypeptide chains of Etr1p are shown in blue, and Etr2p is in red (backbone atoms shown only). The NADPH co-factor is shown in black. The crystal is made up of the three possible dimeric protein combinations: Etr1p-Etr2p heterodimer (left), Etr1p-Etr1p homodimer (middle), and Etr2p-Etr2p homodimer (right). In each dimer only one monomer binds the co-factor. B, stereo view of ribbon drawing

of the structure of Etr2p with the residues differentiating it from Etr1p indicated. The C␣ trace of the ␤-strands (blue), ␣-helices (red), and other polypeptide chains (gray) as well as NADPH are also shown. C, Etr1p with a bound NADPH superimposed on Etr2p with a bound NADPH. The conformation of polypeptide chains and co-factors are virtually identical (residual mean and standard deviation on all backbone atoms 0.81 Å). D, Etr2p with a bound NADPH (red) superimposed on Etr2p without NADPH (green). Only C␣ atoms are shown. Conformational change induced by co-factor binding, as seen earlier for Etr1p (23) is apparent in the co-factor binding Rossmann fold domain (residual mean standard deviation on all backbone atoms 1.14 Å).


41219

TABLE IV Saccharomyces cerevisiae genes involved in fatty acid metabolism in comparison with orthologous genes in Candida tropicalis S. cerevisiae gene

Function

Reference

At least two C. tropicalis ORFs similar to S. cerevisiae single ORF DCI1 ⌬3,5-⌬2,4-Dienoyl-CoA isomerase ECI1 ⌬3-⌬2-Dienoyl-CoA isomerase FOX2 Multifunctional enzyme type 2/Fox2p POX1 Acyl-CoA oxidase ERG10 CAT2 ETR1

RST data base search RST data base search RST data base search RST data base search; Okazaki et al. 1987; Picataggio et al. 1991 Kanayama et al. 1998; Ueda et al. 2000 Ueda et al. 1998 This work

Acetoacetyl-CoA thiolase Carnitine acetyltransferase Enoyl-thioester reductase

One C. tropicalis ORF similar to S. cerevisiae single ORF PXA1, PXA2 ABC transporter ACB1 Acyl-CoA binding protein FAA1–FAA4, FAT1 Very/long chain fatty acyl-CoA ligase MDH1 Malate dehydrogenase SPS19 2,4-Dienoyl-CoA reductase CIT2 Peroxisomal citrate synthase OLE1 ⌬-9-Fatty acid desaturase LIP2 Lipoyl ligase No similar C. tropicalis ORFs to S. cerevisiae ORFs identified ANT ATP carrier CRC1, AGP2 Carnitine/acylcarnitine carrier POT1 ␤-Ketoacyl-CoA thiolase ICL1 Isocitrate lyase IDP3 Peroxisomal isocitrate dehydrogenase TES1 Acyl-CoA thioesterase CTA1 Catalase A ELO1 Fatty acid elongation in the endoplasmic reticulum ELO2/FEN1 1,3-␤-Glucan synthase subunit (putative), involved in elongation ELO3/SUR4 Required for conversion of 24-carbon fatty acids to 26-carbon species in elongation SCS7 Desaturase/ hydroxylase in elongation TSC13 2-Enoyl-CoA reductase in elongation YBR15 9w ␤-Keto-reductase in elongation LIP5 Lipoic acid synthase ACP1 Acyl carrier protein CEM1 ␤-Keto-acyl synthase MCT1 Malonyl-CoA:ACP transferase OAR1 3-Oxoacyl-ACP reductase FAS2 Fatty acid synthase complex, ␣-subunit FAS1 Fatty acid synthase, complex ␤-subunit

architectures in the vicinity of the active sites in the both proteins were similar, and the amino acid residue differences Ile67 (Val), Ala92 (Thr), and Lys251 (Arg) in Etr2p (Etr1p) were positioned in the structure in a way that their interference on the catalysis is unlikely (Fig. 3B). Even if the preferences of the Etr2p and Etr1p were toward short and medium chain 2-enoyl thioester substrates, they showed also activities toward long chain substrates, giving credence to the idea of mitochondrial fatty acid synthesis being required for generation of also other chain lengths of fatty acids than octanoic acid, indicated as a precursor in the synthesis of lipoic acid in yeast and plant mitochondria (46 – 48). Generation of crystals containing the three possible dimeric variants of Etr2p and Etr1p indicates that the protein homodimers dissociate and reassociate in the solution containing a mixture of the proteins. Because both ETR2 and ETR1 are transcribed simultaneously and encode enzymatically active reductases, we suggest that the three dimer variants are also found under physiological conditions. In this respect, the situation would be similar to tissue-specific tetrameric lactate dehydrogenase or to dimeric creatine kinase isoforms in mammals (49 –51). Respiratory growth experiments with triclosan showed that the drug can enter mitochondria from the culture medium. The inhibition of the respiratory growth of ybr026c⌬ cells comple-

RST RST RST RST RST RST RST RST

data data data data data data data data

base base base base base base base base

search search search search search search search search

RST RST RST RST RST RST RST RST RST

data data data data data data data data data

base base base base base base base base base

search search search search search search search search search

RST data base search RST RST RST RST RST RST RST RST RST RST

data data data data data data data data data data

base base base base base base base base base base

search search search search search search search search search search

mented with mitochondrially targeted FabI supports the view that enzymatically active 2-enoyl thioester reductase is essential for the maintenance of respiratory-competent mitochondria in yeast. Failure to inhibit the respiratory growth that depended on Etr1p, Etr2p, or Ybr026p suggested that triclosan does not inhibit reductases of the medium chain dehydrogenases/reductases protein family at the concentration effective against the short chain dehydrogenases/reductase type of bacterial enoyl thioester reductases. Close similarity of ETR2 and ETR1 indicates the genes have arisen via gene duplication recently in the evolution. The higher identity of the nucleotide in the coding region than of in the 5⬘- and 3⬘-flanking regions of the genes indicates the importance of both functional and structural integrity of the proteins in C. tropicalis. The allowance of mutations at the promoter regions of genes is reflected by the different ratios of the ETR2 and ETR1 expression levels under fermentable and nonfermentable growth conditions. This suggests that at their promoter regions, binding of transcription controlling factors, which remain to be identify in future, have changed. Acknowledgments—We thank Marika Kamps and Tanja Kokko for technical assistance. We acknowledge with thanks the use of the MAXlab synchrotron facility in Lund, Sweden. We are grateful to Dermatologica Widmer for the generous gift of the drug triclosan.

41220

C. tropicalis Mitochondrial 2-Enoyl Reductase Genes REFERENCES

1. Picataggio, S., Deanda, K., and Mielenz, J. (1991) Mol. Cell. Biol. 11, 4333– 4339 2. Tanaka, A., and Ueda, M. (1993) Mycol. Res. 97, 1025–1044 3. Rachubinski, R. A. (1990) in The Genetics of Candida (Kirsch, D. R., Kelly, R., and Kurtz, M. B., eds) pp. 177–186, CRC Press, Boca Raton, FL 4. Kawamoto, S., Nozaki, C., Tanaka, A., and Fukui, S. (1978) Eur. J. Biochem. 83, 609 – 613 5. Lazarow, P. B., and Fujiki, Y. (1985) Annu. Rev. Cell Biol. 1, 489 –530 6. Nowak, M. A., Boerlijst, M. C., Cooke, J., and Smith, J. M. (1997) Nature 388, 167–171 7. Llorente, B., Durrens, P., Malpertuy, A., Aigle, M., Artiguenave, F., Blandin, G., Bolotin-Fukuhara, M., Bon, E., Brottier, P., Casaregola, S., Dujon, B., de Montigny, J., Lepingle, A., Neuveglise, C., Ozier-Kalogeropoulos, O., Potier, S., Saurin, W., Tekaia, F., Toffano-Nioche, C., Wesolowski-Louvel, M., Wincker, P., Weissenbach, J., Souciet, J., and Gaillardin, C. (2000) FEBS Lett. 487, 122–133 8. Okazaki, K., Tan, H., Fukui, S., Kubota, I., and Kamiryo, T. (1987) Gene (Amst.) 58, 37– 44 9. Blandin, G., Ozier-Kalogeropoulos, O., Wincker, P., Artiguenave, F., and Dujon, B. (2000) FEBS Lett. 487, 91–94 10. Torkko, J. M., Koivuranta, K. T., Miinalainen, I. J., Yagi, A. I., Schmitz, W., Kastaniotis, A. J., Airenne, T. T., Gurvitz, A., and Hiltunen, K. J. (2001) Mol. Cell. Biol. 21, 6243– 6253 11. Yamazoe, M., Shirahige, K., Rashid, M. B., Kaneko, Y., Nakayama, T., Ogasawara, N., and Yoshikawa, H. (1994) J. Biol. Chem. 269, 15244 –15252 12. Harington, A., Schwarz, E., Slonimski, P. P., and Herbert, C. J. (1994) EMBO J. 13, 5531–5538 13. Mikolajczyk, S., and Brody, S. (1990) Eur. J. Biochem. 187, 431– 437 14. Rock, C. O., and Cronan, J. E. (1996) Biochim. Biophys. Acta 1302, 1–16 15. Schneider, R., Brors, B., Massow, M., and Weiss, H. (1997) FEBS Lett. 407, 249 –252 16. Zensen, R., Husmann, H., Schneider, R., Peine, T., and Weiss, H. (1992) FEBS Lett. 310, 179 –181 17. Johnston, J. R. (ed) (1994) Molecular Genetics of Yeast: A Practical Approach, IRL Press at Oxford University Press, Oxford 18. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1989) Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York 19. Glanz, S. (1992) Primer of Biostatistics, 3rd Ed., McGraw-Hill, New York 20. Jones, E. W. (1977) Genetics 85, 23–33 21. Laemmli, U. K. (1970) Nature 227, 680 – 685 22. Zeelen, J. P., Pauptit, R. A., Wierenga, R. K., Kunau, W. H., and Hiltunen, J. K. (1992) J. Mol. Biol. 224, 273–275 23. Airenne, T. T., Torkko, J. M., Van den plas, S., Sormunen, R. T., Kastaniotis, A. J., Wierenga, R. K., and Hiltunen, K. J. (2003) J. Mol. Biol. 327, 47–59 24. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., GrosseKunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta Crystallogr.

Sect. D Biol. Crystallogr. 54, 905–921 25. Dodson, E. J. (1994) Acta Crystallogr. Sect. D Biol. Crystallogr. 50, 760 –763 26. Perrakis, A., Morris, R., and Lamzin, V. S. (1999) Nat. Struct. Biol. 6, 458 – 463 27. Jones, T. A., Zou, J. Y., Cowan, S. W., and Kjeldgaard, M. (1991) Acta Crystallogr. Sect. A 47, 110 –119 28. Vriend, G. (1990) J. Mol. Graph. 8, 52–56 29. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) J. Appl. Crystallogr. 26, 283–291 30. Guex, N., and Peitsch, M. C. (1997) Electrophoresis 18, 2714 –2723 31. Kamiryo, T., Mito, N., Niki, T., and Suzuki, T. (1991) Yeast 7, 503–511 32. Doi, M., Homma, M., Chindamporn, A., and Tanaka, K. (1992) J. Gen. Microbiol. 138, 2243–2251 33. Jornvall, H., Hoog, J. O., and Persson, B. (1999) FEBS Lett. 445, 261–264 34. Jornvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J., and Ghosh, D. (1995) Biochemistry 34, 6003– 6013 35. Kallberg, Y., Oppermann, U., Jornvall, H., and Persson, B. (2002) Protein Sci. 11, 636 – 641 36. Nordling, E., Jornvall, H., and Persson, B. (2002) Eur. J. Biochem. 269, 4267– 4276 37. Heath, R. J., Su, N., Murphy, C. K., and Rock, C. O. (2000) J. Biol. Chem. 275, 40128 – 40133 38. Heath, R. J., White, S. W., and Rock, C. O. (2001) Prog. Lipid. Res. 40, 467– 497 39. Roujeinikova, A., Sedelnikova, S., de Boer, G. J., Stuitje, A. R., Slabas, A. R., Rafferty, J. B., and Rice, D. W. (1999) J. Biol. Chem. 274, 30811–30817 40. Blandin, G., Durrens, P., Tekaia, F., Aigle, M., Bolotin-Fukuhara, M., Bon, E., Casaregola, S., de Montigny, J., Gaillardin, C., Lepingle, A., Llorente, B., Malpertuy, A., Neuveglise, C., Ozier-Kalogeropoulos, O., Perrin, A., Potier, S., Souciet, J., Talla, E., Toffano-Nioche, C., Wesolowski-Louvel, M., Marck, C., and Dujon, B. (2000) FEBS Lett. 487, 31–36 41. Kanayama, N., Ueda, M., Atomi, H., and Tanaka, A. (1998) J. Bacteriol. 180, 690 – 698 42. Ueda, M., Kanayama, N., and Tanaka, A. (2000) Cell Biochem. Biophys. 32, 285–290 43. Ueda, M., Kawachi, H., Atomi, H., and Tanaka, A. (1998) Biochim. Biophys. Acta 1397, 213–222 44. Kwast, K. E., Burke, P. V., Staahl, B. T., and Poyton, R. O. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 5446 –5451 45. Hiltunen, J. K., and Qin, Y. (2000) Biochim. Biophys. Acta 1484, 117–128 46. Brody, S., Oh, C., Hoja, U., and Schweizer, E. (1997) FEBS Lett. 408, 217–220 47. Hoja, U., Wellein, C., Greiner, E., and Schweizer, E. (1998) Eur. J. Biochem. 254, 520 –526 48. Gueguen, V., Macherel, D., Jaquinod, M., Douce, R., and Bourguignon, J. (2000) J. Biol. Chem. 275, 5016 –5025 49. O’Carra, P., and Mulcahy, P. (1990) Biochem. Soc. Trans. 18, 272–274 50. Quest, A. F., Eppenberger, H. M., and Wallimann, T. (1990) FEBS Lett. 262, 299 –304 51. Rosenberg, U. B., Eppenberger, H. M., and Perriard, J. C. (1981) Eur. J. Biochem. 116, 87–92 52. Sugita, T., and Nakase, T. (1999) Syst. Appl. Microbiol. 22, 79 – 86