carotovorum subsp. carotovorum

Journal of Plant Pathology (2014), 96 (4, Supplement), S4.113-S4.131S4.113 Edizioni ETS Pisa, 2014

Disease Note

Disease Note

FIRST REPORT OF PECTOBACTERIUM CAROTOVORUM SUBSP. CAROTOVORUM

FIRST REPORT OF CHERRY RASP LEAF VIRUS INFECTING CHERRY IN

CAUSING SOFT ROT ON WATERMELON IN IRAN H. Dana, G. Khodakaramian and K. Rouhrazi

SHANDONG PROVINCE, CHINA Y.X. Ma1, J.J. Li1,2, X.D. Li2 and S.F. Zhu1

Department of Plant Protection, Faculty of Agriculture, Bu-ali Sina University, Hamedan, Iran

1Institute of Plant Quarantine, Chinese Academy of Inspection and Quarantine, Beijing 100029, P.R. of China 2Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an 271018, Shandong Province, P.R. of China

Iran is the 4th largest producer of watermelon (Citrullus lanatus) in the world. In 2012 a disease characterized by water-soaked lesions and soft rot was observed on mature and immature fruits of watermelon cv. Crimson sweet. Fruit samples with conspicuous symptoms were transferred to laboratory and bacterial colonies were isolated from these on nutrient agar. Hypersensitivity reaction (HR) assays (Bauer et al., 1994) were successfully done using 108 CFU/ml bacterial suspension into tobacco leaf epidermis. Bacterial isolates were Gram-negative, facultative anaerobes, able to soften potato slices and growing at 37°C. They were negative for oxidase, urease and sensitivity to erythromycin, positive for catalase, gelatinase and utilization of malonate and citrate. Isolates produced acid from lactose, cellobiose, raffinose and trehalose (Schaad et al., 2001). The pathogenicity of bacterial isolates was confirmed by injecting cell suspension (calibrated at 107 CFU/ml) in watermelon fruits. Symptoms developed on fruits 3 to 4 days post inoculation looking the same as those shown by naturally infected fruits. Control samples injected with sterilized distilled water remained healthy. A 16S ribosomal RNA fragment of 1100 bp was amplified from bacterial isolates and the partial 16S rRNA gene sequence was deposited in GenBank under the accession No. KF956742. Based on phenotypic characteristics and the 99.7% homology of 16S rRNA sequence to Pectobacterium carotovorum subsp. carotovorum (Pcc), the bacterium that causes water-soaked and soft rot of watermelon fruit was identified as Pcc. To our knowledge, this is the first report of soft rot caused by Pcc on watermelon from Iran.

Cherry rasp leaf virus (CRLV, genus Cheravirus, family Secoviridae) may cause symptoms on cherry such as leaf distortion and enations on the underside of the leaves along the midribs, whereas limbs of infected trees might become bare near the base (Adaskaveg and Caprile, 2014). In 2002, CRLV was first reported in Liaoning Province based on the result of field survey, virus purification and electron microscope observations (Tan et al., 2002). Shandong province is one of the most important cherry production areas in China. During May and June in 2013, a survey was conducted for the occurrence of CRLV in a sweet cherry orchard in the countryside of Zoucheng city (Shandong). Although no characteristic CRLV symptoms such as leaf distortion and enations were observed, leaf samples were anyhow randomly collected from 20 cherry trees, each sample consisting of 10 leaves. These samples were subjected to RNA extraction and RT-PCR assay for amplifying the vp24 gene of CRLV RNA2 using primer pairs vp24F (5’-GGCCCTGACCCTTTTTCCTTTCATTTG-3’) and vp24R (5’-GGTGTACTCAGCTTTGAGGGCTC-3’). DNA fragments of ca. 580 bp were amplified from 14 out of the 20 cherry leaf samples. PCR products of two randomly selected samples were cloned into pMD18-T vector (TaKaRa, Japan) and sequenced in both directions. Sequence alignment and BLAST analysis showed that the nucleotide sequences of both fragments were 100% identical to vp24 gene of a flat apple isolate of CRLV (GenBank Accession No. AY122330). To the best of out knowledge, this is the first report of the occurrence of CRLV in Shandong province based on molecular assays.

Bauer D.W., Bogdanove A.J., Beer S.V., Collmer A., 1994. Erwinia chrysanthemi hrp genes and their involvement in soft rot pathogenesis and elicitation of the hypersensitive response. Molecular Plant-Microbe Interactions 7: 573-581. Schaad N.W., Jones J.B., Chun W., 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd Ed. APS Press St. Paul, MN, USA.

Adaskaveg J.E., Caprile J.L., 2014. Diseases. In: UC Statewide IPM Program. UC IPM Pest Management Guidelines: Cherry, pp. 62. University of California ANR Publication, California, USA. Tan H.D., Li S.Y., Zhao S.H., Wang H., Sang F.J., 2002. Preliminary identification and control of Cherry rasp leaf virus. Northern Fruits 2: 6-7.

Corresponding author: G. Khodakaramian Fax: +988114424190 E-mail: [email protected]

Corresponding author: S.F. Zhu Fax: +86.0.1064934644 E-mail: [email protected]

Received January 8, 2014 Accepted June 2, 2014

Received February 5, 2014 Accepted July 1st, 2014

S4.114 Journal of Plant Pathology (2014), 96 (4, Supplement), S4.113-S4.131

Disease Note

Disease Note

‘CANDIDATUS PHYTOPLASMA ASTERIS’ ASSOCIATION WITH LEAF YELLOWS AND WITCHES’ BROOM SYMPTOMS OF CODIAEUM VARIEGATUM IN INDIA

FIRST REPORT OF SESAME WILT DISEASE CAUSED BY FUSARIUM PROLIFERATUM IN IRAN

A.K. Tiwari1, K. Shukla2, S. Kumar3, Madhupriya3 and G.P. Rao3

M. Torabi1, M. Ghorbany1, M. Salari1 and M.R. Mirzaee2

1Central

Laboratory, UP Council of Sugarcane Research, Shahjahnapur 242001, UP, India 2Department of Botany, DDU Gorakhpur University, Gorakhpur 273 009, UP, India 3Division of Plant Pathology, Indian Agriculture Research Institute, Pusa Campus 110012, New Delhi, India

Codiaeum variegatum (garden-grown croton species), a member of the family Euphorbiaceae, is native to southern India, Sri Lanka, Indonesia, Malaysia, and the western Pacific Ocean islands, where it grows in open forests and scrub. In August 2013, leaf yellows and witches’ brooms symptoms were observed on C. variegatum plants grown at Lucknow (Uttar Pradesh, India) and Sitamadhi (Bihar, India). Three symptomatic samples from each locations were tested for phytoplasma detection using the universal primer P1/P7 (Deng and Hiruki, 1991;Schneider et al., 1995) in a first round, then primers R16F2n/R16R2 in nested PCR assays (Gundersen and Lee, 1996). Products of ca. 1.8 kb and 1.2 kb, respectively, were amplified from all symptomatic samples. Six amplicons of ca. 1.2 kb were directly sequenced from both ends and found 99% identical to each others. One representative 16Sr DNA C. variegatum phytoplasma sequence from each location was deposited in GenBank under the accession Nos KJ161308 (Lucknow) and KJ161309 (Sitamadhi). Both phytoplasma isolates shared maximum 16S rDNA sequence identity (99%) among themselves and with several isolates of Candidatus Phytoplasma asteris (16SrI group) from different parts of the world. Results of phylogenetic analyses of 1.25 kb 16Sr DNA products from Lucknow and Sitamadhi isolates revealed that the Lucknow isolate clustered together with strains of 16SrI-D subgroup, whereas the Sitamadhi isolate clustered with 16Sr I-B member strains of reference isolates in GenBank. Candidatus Phytoplasma asteris has been associated with diseased Croton spp. from Colombia (Perilla et al., 2012; HG764351) but, to the best of our knowledge, it has never been reported from India. Thanks to DST, New Delhi, India for the financial assistance. Deng S., Hiruki C., 1991. Amplification of 16S rRNA genes from culturable and nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61. Gundersen D.E., Lee I.M., 1996. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathologia Mediterranea 35: 144-151. Perilla-Henao M.L., Dickinson M., Franco-Lara L., 2012. First report of ‘Candidatus Phytoplasma asteris’ affecting woody hosts (Fraxinus uhdei, Populus nigra, Pittosporum undulatum, and Croton spp.) in Colombia. Plant Disease 96: 1372 Schneider B., Seemuller E., Smart C.D., Kirkpatrick B.C., 1995. Phylogenetic classification of plant pathogenic mycoplasmalike organisms or phytoplasmas. In: Razin S., Tully J.G. (eds). Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 1, pp. 369-380. Academic Press, San Diego, CA, USA.

1Department

of Plant Protection, College of Agriculture, University of Zabol, Zabol, Iran 2Agricultural and Natural Resources Research Center of south Khorasan, Birjand, Iran

In July 2012 a survey was conducted to determine the fungal agents of wilt and crown rot disease of sesame in South Khorasan province, Iran. Fusarium proliferatum (T. Matsushima) Nirenberg was isolated and identified based on morphological characteristics on PDA, CLA and SNA culture media (Nirenberg and O’Donnell, 1998; Leslie and Summerell, 2006) from 47% of infected tissues. Colonies were fast growing, forming abundant aerial mycelium, with colorless to dark purple appearance on colony reverse. On CLA, club-shaped and single-celled microconidia were formed in chains and in conidial heads arising from monophialides and poly-phialides, the macroconidia were slender, almost straight, and usually 3-5 septate. Chlamydospores were absent. The internal transcribed spacer (ITS) region of ribosomal DNA was amplified using fungal-specific primer pair ITS1F/ITS4 and the PCR product was sequenced. Comparison of the sequence (GenBank accession No. KM459007) revealed 100% similarity to F. proliferatum (GenBank accession Nos AF291061 and HQ607967). Pathogenicity of the fungus was confirmed by inoculating 2-weekold seedlings of Oltan cultivar with an adjusted conidial suspension. Symptoms similar to those observed in the field appeared on inoculated seedlings. The fungus was consistently re-isolated from symptomatic plants, while controls remained symptomless. To our knowledge, this is the first report of F. proliferatum causing sesame wilt disease in Iran. Leslie J.F., Summerell B.A., 2006. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, USA. 388 pp. Nirenberg H., O’Donnell K., 1998. New Fusarium species and combinations within the Gibberella fujikuroi species complex. Mycologia 90: 434-458.

Corresponding author: G.P. Rao Fax: +91.551.25840772 E-mail: [email protected]

Corresponding author: M.R. Mirzaee Fax: +98.56122227076 E-mail: [email protected]

Received March 7, 2014 Accepted July 3, 2014

Received March 26, 2014 Accepted September 6, 2014

Journal of Plant Pathology (2014), 96 (4, Supplement), S4.113-S4.131S4.115

Disease Note

Disease Note

FIRST REPORT OF VANILLA DISTORTION MOSAIC VIRUS (VDMV) IN ORNAMENTAL ZINNIA BICOLOR IN INDIA

FIRST REPORT OF TOBACCO MOSAIC VIRUS INFECTING CABBAGE IN IRAN

C.G. Balaji, R. Aravintharaj, K. Nagendran, R. Priyanka and G. Karthikeyan Department of Plant Pathology, Tamil Nadu Agricultural University, Coimbatore 641 003, India

Leaf samples of Zinnia bicolor plants showing viruslike symptoms such as mosaic and chlorotic rings were collected from Navsari (Gujarat), India. To characterize the presence of viruses, reverse transcription-polymerase chain reaction (RT-PCR) was carried out with a potyvirus degenerate primer pair (PNIbF1: 5’-GGBAAYAATAGTGGNCAACC-3’ and PCPR1: 5’GGGGAGGTGCCGTCTCDATRCACCA-3’) (Hsu et al., 2005) using total RNA obtained from symptomatic leaves. A single DNA fragment of approximately 1000 nucleotides (nts) covering the 3’ end of the NIb gene and the 5’ end of the coat protein (CP) gene was amplified. The DNA amplicon was cloned into pGEM-T vector and sequenced. The nucleotide sequence analysis (804 bp) revealed 82% identity with Vanilla distortion mosaic virus (VDMV). From this sequence, a specific VDMV primer pair (GKVDMVF: 5’-GGAAAGCTCCATACATCTCGGAA-3’ and GKVDMVR: 5’- CACGAGGTGGAACCTCA CTA-3’) was designed to amplify a 1100 nt RT-PCR product covering the entire CP gene (804 nts), part of the NIb region (143 nts) and part of the 5’ end of the untranslated region (153 nts). The DNA amplicon was cloned, sequenced and submitted to GenBank as accession number KJ013533. Sequence analysis revealed 88% and 94% identity with VDMV from Vanilla planifolia (AY943945) in India at the nucleotide and aminoacid level, respectively. This is the first report of Vanilla distortion mosaic virus in ornamental Zinnia bicolor. Hsu Y.C., Yeh T.J., Chang Y.C., 2005. A new combination of RTPCR and reverse dot blot hybridization for rapid detection and identification of potyviruses. Journal of Virological Methods 128: 54-60.

A.A. Farahani1, F. Rakhshandehroo1 and N. Shahraeen2 1 Department of Plant Pathology, College of Agriculture and Natural Resources, Science and Research Branch, Islamic Azad University, P.O.Box.14515-775, Tehran, Iran 2 Department of Plant Virology, Plant Pests and Diseases Research Institute, P.O. Box 19395-1454, Tehran, Iran

Tobacco mosaic virus (TMV) is distributed worldwide in all areas where horticultural crops are grown. In 2011, commercial cabbage (Brassica oleracea var. capitata) fields in the Savejbolagh district of Alburz province in Iran showed mosaic and malformations on young leaves. Based on the symptoms and previous virus survey outputs in the region (Alishiri et al., 2013), the involvement of tobamoviruses in disease aetiology was suspected. A total of 55 symptomatic cabbage leaf samples were collected from different fields and tested by DAS-ELISA using specific TMV antisera (Bioreba, Switzerland). TMV was detected in 58% of the samples tested. Its presence was confirmed by RT-PCR using specific primers designed in the coat protein gene (Letschert et al., 2002) with amplification of a 694 bp fragment from ELISApositive but not from ELISA-negative control samples. The RT-PCR product of a TMV isolate was sequenced and the nucleotide sequence was deposited in GenBank as accession No. KF527475. BLAST analysis showed 90% and 100% identity with the coat protein gene of other TMV isolates (AF516913, AJ429078, AY360447, HE818417) at the nucleotide and amino acid levels, respectively. A host range trial using infected cabbage leaf extracts as inoculum revealed characteristic TMV symptoms on mechanically inoculated Chenopodium amaranticolor, Nicotiana tabacum cv. Samsun and Solanum lycopersicum. TMV isolates induced chlorotic local lesions on inoculated leaves of C. amaranticolor and systemic mosaic and malformations in tomato and tobacco plants. Symptomatic herbaceous hosts tested positive for TMV antibodies in ELISA. To the best of our knowledge, this is the first report of TMV on cabbage in Iran. Alishiri A., Rakhshandehroo F., Zamanizadeh H.R., Palukaitis P., 2013. Prevalence and evolutionary analyses of the coat protein gene of Tobacco mosaic virus in Iran. The Plant Pathology Journal. 29: 260-273. Letschert B., Adam G., Lesemann D.E., Willingmann P., Heinze C., 2002. Detection and differentiation of serologically cross reacting tobamoviruses of economical importance by RT-PCR and RT-PCR-RFLP. Journal of Virological Methods 106: 1-10.

Corresponding author: C.G. Balaji E-mail: [email protected]

Corresponding author: F. Rakhshandehroo Fax: +98.2144865474 E-mail: [email protected]

Received March 29, 2014 Accepted April 2, 2014

Received April 2, 2014 Accepted April 4, 2014


Disease Note

Disease Note

FIRST REPORT OF

FIRST REPORT OF CHILLI LEAF CURL VIRUS ASSOCIATED WITH LEAF CURL DISEASE OF POTATO IN INDIA

CITRUS PSOROSIS VIRUS IN SYRIA R. Abou Kubaa1,2, S. Saleh1, S. Kumari3, A. El Khateeb4 and K. Djelouah1 1CIHEAM

- Mediterranean Agronomic Institute, Via Ceglie 9, 70010 Valenzano (BA), Italy 2Department of Plant Protection, Ministry of Agriculture and Agrarian Reform, Damascus, Syria 3Agricultural Research Center in Lattakia, General Commission for Scientific Agricultural Research, Lattakia, Syria. 4International Center for Agricultural Research in the Dry Areas, Aleppo, Syria

Citrus psorosis virus (CPsV) is one of the oldest known graft-transmissible viruses of citrus. It causes typical bark scaling lesions in the trunk and limb of sweet orange, mandarin, grapefruit and other citrus spp. During spring 2011, a total of 250 symptomatic and asymptomatic trees, including 100 from a mother block in Lattakia governorate and 150 from six commercial orchards located in Jableh, Tartous and Lattakia areas were sampled to assess the presence of CPsV. All collected samples were analyzed by DAS-ELISA according to Potere et al. (1999) using a commercial kit (Agritest, Italy). Results indicated the presence of CPsV in two Navel Orange trees located in Lattakia. The presence of CPsV was confirmed in these trees by reverse transcription polymerase chain reaction (RT-PCR) using primers consF (5’- ACAAAGAAATTCCCTGCAAGGG-3’) and consR (5’-AAGTTTCTATCATTCTGAAACCC-3’) that target part of the CPsV coat protein gene (Roy et al., 2005) with the amplification of the expected size (411 bp) DNA product. The RT-PCR product was cloned and sequenced. The sequence of CPsV isolate SYR-C7 (GenBank accession No. HG964696) showed 97% nucleotide identity with Italian CPsV isolates (GenBank accession Nos AM235964 and AY194917). Symptoms associated to CPsV were observed in Syria (Bové, 1995) but the causal agent had yet to be identified. To our knowledge, this is the first CPsV detection in Syria by serological and molecular assays. Bové J.M., 1995. Virus and Virus-Like Diseases of Citrus in the Near East Region. FAO, Rome Eds, Italy, ISBN-13: 9789251038277: 518. Potere O., Boscia D., Djelouah K., Elicio V., Savino V., 1999. Use of monoclonal antibodies to citrus psorosis virus for diagnosis. Journal of Plant Pathology 81: 209-212 Roy A., Fayad A., Barthe G., Brlansky R.H. 2005. A multiplex polymerase chain reaction method for reliable, sensitive and simultaneous detection of multiple viruses in citrus trees. Journal of Virological Methods 129: 47-55.

Corresponding author: K. Djelouah Fax: +39.080.4606275 E-mail: [email protected] Received April 26, 2014 Accepted April 28, 2014

M.S. Khan1, A.K. Tiwari2, S.H. Ji1 and S.C. Chun1 1Department of Bioresource and Food Science, College of Life and Environmental Sciences, Konkuk University, Seoul-143 701, Korea Republic 2Central Lab, U P Council of Sugarcane Research, Shahjahnapur-242 001, UP, India

Potato (Solanum tuberosum L.) is an important food crop worldwide. In India, potato is cultivated in an area of about 1.34 million hectares with a total production of about 24.7 million tons. In February 2014, potato plants with a bushy and stunted growth as well as foliar curl and bright yellowing were observed at Matera, District Bahraich in Uttar Pradesh. The incidence of the disease was high (mean of 56%) in different fields. Detection of begomoviruses by PCR using generic begomovirus coat protein gene primers (Khan et al., 2014) resulted in a 770 bp amplicon in 11 symptomatic plant samples. No amplicon was obtained from asymptomatic plant samples. Amplicons from the 11 symptomatic plants were cloned in a TA plasmid (Takara Mighty TA cloning kit, Japan). Two clones per amplicon were sequenced in both orientations, resulting in a consensus sequence, which was submitted to GenBank as accession number KJ590964. BLASTn analysis of the nucleotide sequence revealed 99% identity with Chilli leaf curl virus (ChLCV) isolates originating from different plant species (JF682241, JN663846, HM007104, EU939533, HM007114, JN896946). Phylogenic analyses using MEGA version 5.0 showed the virus isolate from potato clustering in a separate clade with other ChLCV isolates and having distant relationships with other members of the genus Begomovirus in the family Geminiviridae. Tomato leaf curl New Delhi virus was previously reported in potato affected by leaf curl disease (Usharani et al., 2004; Khan et al., 2014). To the best of our knowledge, this is a first report of ChLCV associated with leaf curl and bright yellowing of potato in India. Khan M.S., Tiwari A.K., Raj S.K., Srivastava A., Ji S.H., Chun S.C., 2014. Molecular epidemiology of begomoviruses occurring on some vegetables, grain legume and weed species in the Terai belt of north India. Journal of Plant Diseases and Protection 121: 53-57. Usharani K.S., Surendranath B., Paul-Khurana S.M., Garg, I.D., Malathi V.G., 2004. Potato leaf curl-a new disease of potato in northern India caused by a strain of Tomato leaf curl New Delhi virus. Plant Pathology 53: 235.

Corresponding author: S.C. Chun Fax: +82.2.450.3726 E-mail: [email protected] Received April 26, 2014 Accepted April 29, 2014


Disease Note

Disease Note

FIRST REPORT OF ONION YELLOW DWARF VIRUS AND GARLIC COMMON LATENT VIRUS INFECTION

FIRST REPORT OF DIEBACK OF OLIVE TREES CAUSED BY PHOMA FUNGICOLA IN TUNISIA

S. Majumder and S. Johari

S. Krid Hadj Taieb*, M.A. Triki*, I. Hammami and A. Rhouma

IN GARLIC FROM NEPAL

Department of Biotechnology, Sharda University, Knowledge Park III, G. Noida, India 201306

Laboratoire d’amélioration et Protection des Ressources Génétiques de l’olivier, Institut de l’olivier de Sfax, BP 208 Cité Mahrajène, 1082 Tunis, Tunisia * These authors contributed equally to this work and are regarded as the joint first authors.

Garlic (Allium sativum L.) is one of the most important culinary herbs in the Indian subcontinent. Several viruses belonging to the genera Potyvirus, Carlavirus and Allexivirus are known to infect garlic worldwide (Dijk, 1994; Walkey and Antill, 1989). Leaves from 20 different samples of cultivar ‘Sauntha lasoon’ showing mild to severe mosaic symptoms were collected in April of 2013 from two fields of Dharchula, Nepal. Direct antigen coated (DAC)-ELISA was performed with antisera to Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV) and Garlic common latent virus (GarCLV) (Bioreba, Reinach, Switzerland). All the samples were positive for OYDV and 16 were positive for GarCLV. These results were confirmed by reverse transcription (RT)-PCR using specific primers (Majumder and Baranwal, 2014) and total RNA extracted from 100 mg of leaves with the RNeasy Plant Mini kit (Qiagen, USA) according to the manufacturer’s protocol. Expected amplicons of ca. 320 bp for OYDV and ca. 450 bp for GarCLV were obtained from all the samples tested, indicating mixed infections. Direct sequencing of the PCR products produced 276 bp and 461 bp long nucleotide sequences with 78% and 91% identity with sequences of an OYDV isolate from garlic in India (GenBank accession No. DQ519034 ) and a GarCLV isolate from garlic in India (GenBank accession No. FJ154841), respectively. SLV was not found by ELISA or RT-PCR in any of the samples tested. To our knowledge, this is the first report of OYDV and GarCLV in garlic in Nepal.

During spring 2013, a new disease was observed on olive (Olea europea) cv. Chemlali in orchard in Sahlin (Sahel of Tunisia). Symptoms included abundant dead branches and wilted leaves and shoot necrosis. Shoots showing dieback symptoms were disinfected with 2% sodium hypochlorite, rinsed in sterile distilled water and air dried. Several fragments (3 x 3 mm) of infected shoots were cut and placed on potato dextrose agar medium (PDA). All plates were incubated at 25°C for 4 days under continuous fluorescent light. A pycnidial fungus was consistently isolated from branch cankers and identified as Phoma fungicola Aveskamp, Gruyter et Verkley, based on morphological characteristics and analysis of the ITS gene region (White et al., 1990). The sequence showed high identity (99%) with a reference sequence (strain H11 H10; accession No. KF29376 3.1). Pathogenicity tests were conducted on 2-year old olive plants (cv. Chemlali). A mycelial plug cut from the margin of an actively growing colony of the fungus was placed into a shallow wound (0.4 cm 2) inferted with a sterilized scalpel on the stem base. Inoculated wounds were wrapped with Parafilm. In control plants, sterile PDA plugs were placed into artificial wounds. Ten replicate inoculated plants were used and maintained in a greenhouse at 25°C. Two months after the inoculation, the inoculated trees reproduced stem browning symptoms observed in the field, while control plants remained healthy. Koch’s postulates were then verified and P. fungicola was isolated from inoculated stems, whereas the controls were free of the fungus. Phoma sp. and P. incompta have been reported as responsible for branch dieback of olive tree in Tunisia and Italy, respectively (Rhouma et al., 2010; Ivic et al., 2010). To the best of our knowledge, this is the first report of P. fungicola as a causal agent of dieback of olive trees in Tunisia.

Van Dijk P., 1994. Virus diseases of Allium species and prospects for their control. Acta Horticulturae 358: 299-306. Walkey D.G.A., Antill D.N., 1989. Agronomic evaluation of virusfree and virus infected garlic (Allium sativum L.). Journal of Horticultural Science 64: 53-60. Majumder S., Baranwal V.K., 2014. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions. Journal of Virological Methods 202: 34-38

Ivic D., Ivanovic A., Milicevic T., Cvjetkovic B., 2010. Shoot necrosis of olive caused by Phoma incompta a new disease of olive in Croatia. Phytopathologia Mediterranea 49: 414-416. Rhouma A., Triki M.A., Krid S., Msallem M., Tuset J.J., 2010. First report of a branch dieback of olive trees in Tunisia caused by Phoma sp. Plant Disease 94: 636. White T.T., Bruns T., Lee S., Taylor J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). PCR protocols. A guide for Methods and Application, pp. 315-322. Academic Press, San Diego, CA, USA.

Corresponding author: S. Majumder Fax: +91.120.2323610 E-mail: [email protected]

Corresponding author: S. Krid Hadj Taieb Fax. +216.74.241442 E-mail: [email protected]

Received May 28, 2014 Accepted November 14, 2014

Received June 11, 2014 Accepted June 19, 2014


Disease Note

Disease Note

FIRST REPORT OF LEAF BLIGHT OF ALOE VERA CAUSED BY SPHAEROPSIS SAPINEA IN INDIA

BACTERIAL WILT OF LIMA BEAN (PHASEOLUS LUNATUS) CAUSED BY

D. Kamil1, D.K. Sharma2, T.P. Devi1 and M. Singh1

CURTOBACTERIUM FLACCUMFACIENS pv. FLACCUMFACIENS, A NEW DISEASE IN IRAN

1Division

of Plant Pathology, Indian Agricultural Research Institute, New Delhi, 110012, India 2Centre for Environment Science and Climate Resilient Agriculture (CESCRA), Indian Agricultural Research Institute, New Delhi, 110012, India

Aloe vera (Aloe barbadensis Miller) is a drought-resistant perennial succulent plant of the family Liliaceae. In September 2013, plants exhibiting severe leaf blight symptoms were observed in the Experimental Farm of the Indian Agricultural Research Institute (IARI), New Delhi. The disease appeared as small circular brown lesions on the leaves which soon developed into dark-brown diffuse spots that turned grey at the centre. The spots frequently coalesced into extended patches, blightening the leaves and, gradually, the entire foliage. Isolation on potato dextrose agar (PDA) (Rao et al., 1991) yielded colonies that were initially white, but later turned grey to greyish black and produced dark-brown pycnidia. Pycniospores were brown, clavate, straight, aseptate, thick-walled, apex-obtuse, tapered to a truncate base and measured 30-45×10-16 µm. Based on morphology, the fungus was identified as Sphaeropsis sapinea. To confirm the identification, internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS1 and ITS4 (White et al., 1990), sequenced and submitted in GenBank (accession No. KM114902). The highest similarity was found with Sphaeropsis sapinea sequences. For pathogenicity tests, fives 6-month-old healthy plants of A. barbadensis were sprayed with spore suspension (5×105 spore/ml) of the pathogen whereas five control plants were sprayed with sterilized water. Leaf symptoms like those seen on naturally infected were observed only in inoculated aloe vera plants from which a fungus identical to that used for inoculation was re-isolated and deposited at the Indian Type Culture Collection (ITCC 7390), Division of Plant Pathology, New Delhi, India. This is the first report of leaf blight caused by Sphaeropsis sapinea on aloe vera in India. Rao G.P., Singh M.., Verma K.P., 1991. Leaf spot disease causing fungus of sugar cane. Annual Report, CSSBRI, Seorahi, India: 86-87. White T.J., Bruns T., Lee S., Taylor J., 1999 Amplification and direct sequencing of fungal ribosomal genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). PCR Protocols: a Guide to Methods and Applications, pp. 315-322. Academic Press, New York, NY, USA.

E. Osdaghi Department of Plant Protection, Faculty of Agriculture, Ramin Agricultural & Natural Resources University, Bavi, Khuzestan, Iran

In the summer of 2013, during surveys in lima bean (Phaseolus lunatus) (cv. Christmas Pole) fields of East Azerbaijan, Northwest Iran, interveinal necrotic lesions and marginal chlorosis were observed on the leaves. The isolation of bacterial was done on Yeast Peptone Glucose Agar (YPGA) medium (EPPO, 2011). Yellow-colored colonies 1-2 mm in diameter were present on YPGA plates after incubation at 25°C for 48 h. All isolates were Gram-positive, of oxidative but not fermentative metabolism, and had the ability to grow at 37°C. All hydrolyzed aesculin, casein, and gelatin, produced acid from inositol, mannose and maltose but not from mannitol and erythritol, were of positive catalase and oxidase, but of negative urease and indole production (EPPO, 2011). Bacterial strains were identified as Curtobacterium flaccumfaciens pv. flaccumfaciens (Cff) based on biochemical test results. The pathovar-specific primer pair CffFOR2 and CffREV4 amplified a 306 bp fragment of the isolates and confirmed them as Cff (Tegli et al., 2002). The strains were deposited in the University of Tehran Microorganisms Collection (Accession No. Cffcb123). Pathogenicity test was conducted on 20 day old lima bean (cv. Christmas Pole) plants. The Cff suspensions (1×108 CFU/ml) were prepared from 48 h old culture on YPGA. Node infiltration method was conducted for the inoculation of plants (Hsieh et al., 2003). Disease symptoms appeared 10-15 days after inoculation. First trifoliate leaves of the inoculated plants exhibited symptoms of marginal necrosis and interveinal yellowing. Cff was consistently re-isolated from artificially infected lima bean tissues on YPGA and re-identified using CffFOR2 and CffREV4 primer pairs. This is the first report of Cff causing bacterial wilt in lima bean in Iran. EPPO, 2011. Curtobacterium flaccumfaciens pv. flaccumfaciens. OEPP/EPPO Bulletin 41: 320-328. Hsieh T.F., Huang H.C., Mündel H.H., Erickson S.R., 2003. A Rapid Indoor Technique for Screening Common Bean (Phaseolus vulgaris L.) for Resistance to Bacterial Wilt [Curtobacterium flaccumfaciens pv. flaccumfaciens (Hedges) Collins and Jones]. Revista Mexicana De Fitopatología 21: 370-374. Tegli S., Sereni A., Surico G., 2002. PCR-based assay for the detection of Curtobacterium flaccumfaciens pv. flaccumfaciens in bean seeds. Letters in Applied Microbiology 35: 331-337.

Corresponding author: D. Kamil Fax: +91-11-25843113 E-mail: [email protected]

Corresponding author: E. Osdaghi Fax: +98.6123222428 E-mail: [email protected]

Received July 2, 2014 Accepted September 11, 2014

Received July 10, 2014 Accepted October 3, 2014


Disease Note

Disease Note

FIRST REPORT OF POTATO BROWN ROT CAUSED BY RALSTONIA SOLANACEARUM IN GEORGIA

FIRST REPORT OF A “CANDIDATUS PHYTOPLASMA SOLANI” RELATED STRAIN ASSOCIATED WITH A POTATO REDDENING DISEASE IN GREECE

M. Muradashvili, G. Meparishvili, Z. Sikharulidze and S. Meparishvili

K.N. Moraki, V.I. Maliogka and N.I. Katis

Department of Plant Diseases Monitoring, Diagnostics and Molecular Biology, Institute of Phytopathology and Biodiversity, Batumi Shota Rustaveli State University, 90, str. Tavisupleba, Kobuleti, 6200, Adjara, Georgia

Aristotle University of Thessaloniki, Faculty of Agriculture, Forestry and Natural Environment, School of Agriculture, Lab of Plant Pathology, 54 124 Thessaloniki, Greece

Potato is one of the most important constituent of the human diet in Georgia. Potato brown rot caused by Ralstonia solanacearum is an economically important bacterial disease and the cause of severe damage to the potato industry. During 2011-2013 a survey of potato plantations and storage facilities in different potato-producing regions of Georgia, samples were collected of tubers with brown rot symptoms and wilted potato leaves and stems. Since 2010, bacterial wilt presumed to be caused by R. solanacearum has been an important disease in Georgia. The disease was first reported in tomato in Chkorotsku and Kutaisi regions (west Georgia), where it caused up to 100% plant loss in greenhouse- and field-grown crops (Meparishvili et al., 2012). Since then, several cases of this disease have been documented on potato in home gardens in the Kobuleti region. In 2012 -2013, brown rot symptoms were detected in several commercial potato cultivars. i.e. Jelly, Marfona, Picasso, Finca, Agria, Alliance, Marabely in Khulo (west Georgia) and Akhaltsikhe (south Georgia). Bacteria isolated from wilted potato plants and rotten tubers produced typical pearly white, flat, irregular, fluidal colonies on CPG and fluidal, irregular in shape and milky white colonies with pink centers on SMSA media, respectively. These colonies were presumed to belong to R. solanacearum, thus their identity was sought and confirmed by specific PCR using the primer pair OLI/Y2 (Seal et al., 1993). All tested isolates and positive control DNA extracted from R. solanacearum type strain NCPPB 325 produced the expcted 288 bp product, confirming their identity as Ralstonia solanacearum. To the best of out knowledge, this is the first report on the presence of potato brown rot in Georgia.

Potato (Solanum tuberosum), one of the most important crops worldwide, is susceptible to a high number of viruses and phytoplasmas. During the summer of 2013 symptoms similar to those caused by phytoplasmas, such as dwarfing, bright red discoloration, and rolling of the top leaves were observed in potato crops of cvs. Spunta and Jelly in Kastoria (40° 31’0 .12 “N21° 16’0 .12” E), Northern Greece. The affected plants were scattered in the field and their incidence ranged among the plots between 10% and 20%. In order to investigate the etiology of the aforementioned symptoms, leaves from 10 symptomatic and 10 asymptomatic plants of each variety were collected and subjected to DNA extraction. The extracts were tested using a generic nested PCR that targets the highly conserved 16S rRNA gene of phytoplasmas. More specifically, the universal primer set P1/P7 (Schneider et al., 1995) was used in the first round of PCR, whereas R16F2n/R16R2 primers (Gundersen and Lee, 1996) were applied in the nested step. The expected PCR products of ca. 1200 bp were amplified from all samples coming from symptomatic plants but not from the asymptomatic ones. One amplicon from each variety was further sequenced in both directions and their BLAST analysis revealed 98% similarity with the sequences of several “Candidatus Phytoplasma solani” (16SrXII-A stolbur group) strains (e.g. Bulgarian strain 241/13, KF907506). The two Greek sequences were 99% similar between them and were deposited in the EMBL-EBI under the accession Nos HG531809 and HG792592. “Ca. Phytoplasma solani” is endemic in Greece and was first detected in Datura stramonium plants in the area of Thessaloniki (Macedonia, Northern Greece). However, this is to our knowledge the first report of a potato disease caused by a “Ca. Phytoplasma solani” related strain in our country.

Research supported by a grant from the International Science and Technology Center (Project No. G-1775p). Mepharishvili G., Sikharulidze Z., Thwaites R., Tsetskhladze T., Dumbadze R., Gabaidze M., Muradashvili M., 2012. New Disease Reports 25: 16. [doi:10.5197/j.2044-0588.2012.025.016] Seal S.E., Jackson L.A., Young J.P.W., Daniels M.J., 1993. Differentiation of Pseudomonas solanacearum, Pseudomonas syzygii, Pseudomonas pickettii and the blood disease bacterium by partial 16S rRNA sequencing: construction of oligonucleotide primers for sensitive detection by polymerase chain reaction. Microbiology 139: 1587-1594.

Gundersen D.E., Lee I.M., 1996. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathologia Mediterranea 35: 144-151. Schneider B., Seemueller E., Smart C.D., Kirkpatrick B.C., 1995. Phylogenetic classification of plant pathogenic mycoplasmalike organisms or phytoplasmas. In: Razin S., Tully J.G. (eds). Molecular and Diagnostic Procedures in Mycoplasmology. Vol. 1, pp. 369-380. Academic Press, San Diego, California, USA.

Corresponding author: Z. Sikharulidze Fax: +995 422 271787 E-mail: [email protected]

Corresponding author: V.I. Maliogka Fax: +30.2310998854 E-mail: [email protected]

Received August 27, 2014 Accepted November 13, 2014

Received July 18, 2014 Accepted September 26, 2014


Disease Note

Disease Note

FIRST REPORT OF LEEK YELLOW STRIPE VIRUS IN FOREIGN AND POLISH GARLIC PLANTS IN CENTRAL POLAND

FIRST REPORT OF GUMMOSIS OF MANGO TREES CAUSED BY NEOFUSICOCCUM PARVUM IN SICHUAN, SOUTHWEST CHINA

M. Chodorska, E. Paduch-Cichal, E. Kalinowska, O. Gaczkowska, M. Lis, B. Sierant and M.S. Szyndel Warsaw University of Life Sciences - SGGW, Faculty of Horticulture and Landscape Architecture, Department of Plant Pathology, Nowoursynowska 159, 02-776, Warsaw, Poland

Leek yellow stripe virus (LYSV), genus Potyvirus, family Potyviridae (King et al., 2011) is the most common and important virus infecting a wide range of Allium worldwide. The aim of this study was to detect and identify LYSV in leek and garlic plants originating in central Poland, and also materials from Belgium, Egypt, and Spain purchased in Polish markets in April 2014. Randomly collected 178 samples were tested by a double-antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA), according to the manufacturer’s instructions (DSMZ, Braunschweig, Germany). All leek plants tested negative for LYSV, whereas 31 of 120 garlic bulbs tested positive. The presence of LYSV was confirmed by reverse transcription (RT)-PCR using total RNA extracted with the silica capture method (Boom et al., 1990; Malinowski, 1997) and primers 1-LYSV/2-LYSV (Parrano et al., 2012) designed to amplify a part of the N-terminal domain of the coat protein (CP) gene of the virus (363 bp). A sequence of the partial CP genes of the 12 LYSV isolates was submitted to GenBank (Accession Nos KM032272-KM032283). BLAST analysis of Polish sequences showed 96-99% identity at the nucleotide and amino acid levels. Sequences of Egyptian isolates, first representatives from this locations, showed 92 and 95% nucleotide and amino acid identities, respectively. However Spanish isolates revealed 95% and 97% nucleotide and amino acid identities, respectively. To the best of our knowledge, this is the first report of LYSV in foreign and Polish garlic plants available for purchase in central Poland. The accurate identification of viruses present in garlic plants, especially in imported plant material, will help to use the appropriate strategies to reduce viral incidence in garlic-growing areas. Boom R., Sol C.J.A., Salimans M.M.M., Jansen C.L., WertheimVan Dillen P.M.E., Van Der Nordaa J., 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495-503. King A.M.Q., Adams M.J., Carstens E.B., Lefkowitz E.J., 2011. Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego, USA. Malinowski T., 1997. Silicacapture - reverse transcription - polymerase chain reaction (SC-RT-PCR): application for the detection of several plant viruses. In Dehne H.W., Adam G., Diekmann M., Frahm J., MaulerMachnik A., Van Halteren P. (eds). Diagnosis and Identification of Plant Pathogens. Proceedings of 4th International EFPP Symposium Bonn, 9-12 September 1996. Kluwer Academic Publishers, Budapest, 445-448. Parrano L., Afunian M., Pagliaccia D., Douhan G., Vidalakis G., 2012. Characterization of viruses associated with garlic plants propagated from different reproductive tissues from Italy and other geographic regions. Phytopathologia Mediterranea 51: 549-565.

Q.L. Li1,2, T.J. Deng3, S.P. Huang1,2, T.X. Guo1,2, J.Y. Mo1,2 and T. Hsiang4 1Institute of Plant Protection, Guangxi Academy of Agricultural Sciences, Nanning, Guangxi, 530007, China 2Guangxi Key Laboratory of Biology for Crop Diseases and Insect Pests, Nanning, Guangxi, 530007, China 3Plant Protection Station of Guangxi Province, Nanning, Guangxi, 530022, China 4 School of Environmental Sciences, University of Guelph, Guelph, Ontario, N1G 2W1, Canada

Mango (Mangifera indica) is an important fruit crop in southern China, and gummosis is one of the most important diseases. In September 2012, symptomatic branches were collected in Panzhihua, Sichuan province. On potato dextrose agar, isolates of similar morphological characteristics were consistently recovered from surface-sterilized branch pieces. The fungus was identified as Neofusicoccum parvum based on morphology and DNA sequence comparisons (Costa et al., 2010). Conidia were hyaline, thin walled, spindle-shaped to ellipsoid, nonseptate, and ranged from 15 to 23.5 × 4 to 7 μm (average 19.5 × 5.6 μm). The rDNA internal transcribed spacer region, a partial sequence of the β-tubulin gene, and the translation elongation factor 1-α gene of one isolate (L13), showed 100% identity to N. parvum (GenBank accession Nos GU997685, HM480386 and HQ859955). Pathogenicity of three isolates was tested in three green twigs and three 3-year-old branches in mango orchards of Guangxi Academy of Agricultural Sciences, Guangxi, China. Five wounds were made for each location with a sterilized needle. Mycelial plugs were placed at wounds and then covered with parafilm. Control twigs were inoculated with uncolonized PDA plugs. Two weeks later, typical brown lesions were observed on inoculated branches, and gum exuded from infected tissues wound. No symptoms were seen on the controls. Koch’s postulates were fulfilled by reisolation of N. parvum from diseased branches. In China, the disease was mainly associated with Lasiodiplodia theobromae (Li et al., 2013) and Botryosphaeria dothidea (Mo et al., 2013). To our knowledge, this is the first report of N. parvum causing mango gummosis in China. The research was supported by Natural Science Foundation of Guangxi, China (2013GXNSFBA019075), Foundation for Development of Science and Technology of Guangxi Academy of Agricultural Sciences (2013JZ08) and Foundation of Guangxi Key Laboratory of Biology for Crop Diseases and Insect Pests (13-051-47-KF-1). Costa V.S.O., Michereff S.J., Martins R.B., Gava C.A.T., Mizubuti E.S.G., Câmara M.P.S., 2010. Species of Botryosphaeriaceae associated on mango in Brazil. European Journal of Plant Pathology 127: 509-519. Li Q.L., Guo T.X., Pan Z.B., Huang S.P., Mo J.Y., Ning P., Hsiang T., 2013. An outbreak of gummosis of mango trees caused by Lasiodiplodia theobromae in Guangxi, south China. Plant Disease 97: 690. Mo J.Y., Li Q.L., Guo T.X., Huang S.P., Pan Z.B., Ning P., Hsiang T., 2013. First report of gummosis caused by Botryosphaeria dothidea on mango trees in Guangxi, south China. Journal of Plant Pathology 95: 665.

Corresponding author: M. Chodorska Fax: +48.225932043 E-mail: [email protected]

Corresponding author: J. Mo Fax: +86-0771-3243874 E-mail: [email protected]

Received August 1, 2014 Accepted October 22, 2014

Received September 18, 2014 Accepted September 20, 2014


Disease Note

Disease Note

FIRST REPORT OF MIXED INFECTION OF PAPAYA RINGSPOT VIRUS AND PAPAYA LEAF DISTORTION MOSAIC VIRUS ON CARICA PAPAYA L.

FIRST REPORT OF ROSEMARY LEAF SPOT CAUSED BY PHOMA GLOMERATA IN IRAN

W. Shen*, D. Tuo*, Y. Yang, P. Yan, X. Li and P. Zhou Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology & Analysis and testing center, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China *These authors contributed equally to this work.

Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV) from the family Potyviridae produce similar symptoms in papaya such as foliar mosaic, ringspots and distortion, water soaking streaks on petioles, and ringspots on fruit. PRSV is the most widespread and destructive viral disease damaging papaya production in the world, whereas PLDMV was recently identified in China (Tuo et al., 2013). In March 2014, 23 papaya trees displaying disease symptoms similar to those of PRSV or PLDMV were observed in Haikou (Hainan Island, China). Six samples were co-infected with PRSV and PLDMV, as shown by DAC-ELISA with antisera to PRSV or PLDMV. Mixed infection was subsequently confirmed by RT-PCR using PRSV-specific primers designed in a highly conserved region of gene P3 (P3-F, 5’TTGTGTACGACTTCTCACCGAA3’ and P3-R, 5’CGAATGTCATCCAAAGACT GATGATAAAC3’) and PLDMV-specific primers designed in a highly conserved region of the coat protein (CP) gene (CP-F, 5’GGCATGTGGTTTATGATGCAAGG G3’ and CP-R, 5’GCTCCGTGTTCTCAGTCGCATT3’). DNA fragments of the expected size (613 and 355 bp, respectively) were amplified from each mixed infected sample using PRSV and PLDMV-specific primers, and then cloned and sequenced. BLASTn analysis of the nucleotide sequences obtained from the cloned PCR products showed 99% identity with a PRSV isolate from Hainan (GenBank accession No. EF183499) and 100% identity with a PLDMV isolate from Hainan (GenBank accession No. JX974555) (Lu et al., 2008; Tuo et al., 2013). To our knowledge, this is the first report of mixed infection of PRSV and PLDMV on papaya, prompting the need for evaluating the potential threat of the mixed virus infection to papaya production. Work supported by the National Natural Science Foundation of China (grant Nos 31371918, 31171822, and 31000844), the Major Technology Project of Hainan (ZDZX2013023-1), and the National Nonprofit Institute Research Grant (ITBB110211). Lu Y.W., Shen W.T., Zhou P., Tang Q.J., Niu Y.M., Peng M., Xiong Z., 2008. Complete genomic sequence of a Papaya ringspot virus isolate from Hainan Island, China. Archives of Virology 153: 991-993. Tuo D.C., Shen W.T., Yan P., Li C.Q., Gao L., Li X.Y., Li H.P., Zhou P., 2013. Complete genome sequence of an isolate of Papaya leaf distortion mosaic virus from commercialized PRSV-resistant transgenic papaya in China. Acta Virologica 57: 452-455.

D. Moshrefi Zarandi1, M.M. Aminaee2, A. Sharzei3 and S. Rezaee4 1Department

of Plant Pathology, Marvdasht Branch, Islamic Azad University, Marvdasht, Iran 2Department of Plant Protection, Agricultural and Natural Resources Research Center of Kerman, Iran 3Department of Entomology and Plant Pathology, Aburaihan Campus, University of Tehran, Tehran, Iran 4Department of Plant Pathology, College of Agriculture and Natural Resources, Science and Research Branch, Islamic Azad University, Tehran, Iran

Rosemary (Rosemarinus officinalis) is an ornamental and medicinal plant grown in Iran. During a survey in November 2012, symptoms of wilt and leaf spot were observed in almost half of rosemary fields of Kerman (southeast of Iran). Samples of infected leaves were surface sterilized with 0.5% sodium hypochlorite, rinsed with sterile distilled water, cultured onto potato dextrose agar (PDA) medium and incubated at 25°C for seven days. The isolated fungus produced a pale brown to dark green colony. Ovoid or ellipsoidal, hyaline, and aseptate conidia were produced abundantly in subglobose pycnidia. Numerous dictyochlamydospores and chlamydospores were also observed. Based on the morphological characters, the fungus was identified as Phoma glomerata (Boerema et al., 2004). To confirm the species of the fungus, DNA was extracted from a single spore isolate and the internal spacer regions (ITS) were amplified with universal primers ITS1 and ITS4. The resulting sequence (532 bp), which showed more than 99% identity with Phoma glomerata, was submitted to NCBI GenBank (Accession No. KM114267). To test the pathogenicity, two month old plants were sprayed by a suspension of 104 spores per ml, covered with plastic bags and incubated under greenhouse conditions at 25-28°C. Pale brown small spots were developed on an average of 31.48% of the leaves after seven days. This fungus has been previously reported from Iran on cucumber (Hatami et al., 2008) and Ficus elastica (Aghapour et al., 2009). To the best of our knowledge, this is the first report of Phoma glomerata on rosemary in Iran and possibly in the world. Aghapour B., Fotouhifar K.B., Ahmadpour A., Ghazanfari K., 2009. First report of leaf spot disease on Ficus elastica caused by Phoma glomerata in Iran. Australasian Plant Disease Notes 4: 82-83. Boerema G.H., de Gruyter J., Noordeloos M.E., Hamers M.E.C., 2004. Phoma Identification Manual. Differentiation of Specific and Infra-specific Taxa in Culture. CABI Publishing. CAB International Wallingford, Oxfordshire, UK. Hatami N., Zamanizadeh H., Aminaee M.M., 2008. Collection and identification of plant pathogenic fungi in cucumber greenhouses. In: Proceeding of the 18th Iranian Plant Protection Congress, Hamedan 2008: 195.

Corresponding author: P. Zhou Fax: +86.898.66988559 E-mail: [email protected]

Corresponding author: D. Moshrefi Zarandi E-mail: [email protected]




Disease Note

Disease Note

FIRST REPORT OF COCHLIOBOLUS SPICIFER CAUSING LEAF SPOT DISEASE OF TRIANTHEMA PORTULACASTRUM

CAUSING NECK BENDING DISEASE OF DATE PALM IN IRAN

V. Kumar1, K.R. Aneja2, N. Aggarwal1 and M. Kaur1

M.R. Mirzaee1, H. Tajali1 and S.A. Javadmosavi2

1Department

of Microbiology, Kurukshetra University, Kurukshetra Research, Training and Diagnostic Centre, Kurukshetra-136118, India

2Vaidyanath

Trianthema portulacastrum Simmons (Horse purslane) weeds showing symptoms of light brown to blackish leaf spot were observed during survey conducted in between 2011-13 in Haryana, India. A fungus was consistently isolated from leaf lesions on potato dextrose agar (PDA) upon incubation 25°C for 7 days. The pathogen identity was verified by the International Mycological Institute (IMI), CABI Bioscience UK (IMI Number 503552) based on its morphological and by ITS rDNA sequence analysis. The sequence obtained from this sample showed 100% identity to sequences of Cochliobolus spicifer Nelson and its anamorphic state Bipolaris spicifer Bainier (Cunha et al., 2012). The best matches included strains from reference culture collections e.g. JN192387 (CBS 274.52). Reproduction of symptoms in inoculated healthy leaves fulfilled Koch’s postulates and confirmed pathogenicity. C. spicifer has been isolated from a wide variety of plants e.g. Arachis, Capsicum, Gossypium, Musa, Piper, Solanum, Triticum, Vicia and Vigna and reported from Europe, Africa, the Middle East, Asia, Australasia and South America. A total of nine fungal pathogens have been reported on T. portulacastrum weed from various parts of the globe (Aneja et al., 2014). Literature search reveals that the leaf spot disease caused by C. spicifer on T. portulacastrum has not yet been reported worldwide. Aneja K.R., Kumar V., Sharma C., 2014. Leaf-spot disease of Trianthema portulacastrum – a new record from world. Journal of Innovative Biology 1: 112-116. da Cunha K.C., Sutton D.A., Fothergill A.W., Cano J., Gené J., Madrid H., De Hoog S., Crous P.W., Guarro J., 2012. Diversity of Bipolaris species in clinical samples in the United States and their antifungal susceptibility profiles. Journal of Clinical Microbiology 50: 4061-4066.

THIELAVIOPSIS PARADOXA

1 Agricultural

and Natural Resources Research Center of Southern Khorasan, Birjand, P.O. Box 413, Iran 2Agricultural Manangement of Tabas, Tabas, Khorasan Province, Iran

In April 2014, severe neck bending symptoms were observed on date palm (Phoenix dactylifera L.) in Tabas region of Southern Khorasan, Iran. Symptoms included inclination of the area of the uppermost portion of the trunk and internal brown discoloration of the petiole bases. A fungus with the characteristics of Thielaviopsis paradoxa (Teleomorph: Ceratocystis paradoxa) was consistently isolated on potato dextrose agar (PDA) from the symptomatic tissues. The fungus produced two types conidia, including cylindrical, hyaline to pale brown which formed endogenously in chains, 5-7.5×7.5-15 μm, and oval, thick-walled, black chlamydospores in chains from the tips of short lateral hyphae that were 7.5-15×10-25 μm. The ITS region of rDNA was amplified using primer pair ITS1F/ITS4 and the PCR product was sequenced. Comparison of the sequence (GenBank accession No. KM519456) revealed 99% similarity to C. paradoxa (DQ318203). Date palm seedlings (cv. Kabkab) and banana fruits were inoculated with PDA plugs taken from 5-day-old single-spore isolates. Disease symptoms developed on both hosts, on banana fruits within 5-7 days and on date palm seedlings after 12 days and re-isolation from affected tissues yielded T. paradoxa. The control seedlings and fruits showed no symptoms. T. paradoxa has been reported as the causal agent of neck bending disease on date palm in Iraq and Qatar (Abbas and Abdulla, 2003) and trunk rot of Canary Island date palm and date palm from Italy (Polizzi et al., 2006). This is the first report of the disease as well as the first confirmed record of the fungus T. paradoxa in Iran. Abbas E.H., Abdulla A.S., 2003. First report of neck bending disease on date palm in Qatar. Plant Pathology 52: 790. Polizzi G., Castello I., Vitale A., Catara V., Tamburino V., 2006. First report of Thielaviopsis trunk rot of date palm in Italy. Plant Disease 90: 972.

Corresponding author: K.R. Aneja E-mail: [email protected]

Corresponding author: M. R. Mirzaee Fax. +98 5612222624 E-mail: [email protected]

Received September 5, 2014 Accepted October 16, 2014

Received October 9, 2014 Accepted October 19, 2014


Disease Note

Disease Note

DETECTION OF WATERMELON SILVER MOTTLE VIRUS INFECTING

FIRST REPORT OF DIEBACK OF OLIVE TREES CAUSED BY NIGROSPORA sp. IN TUNISIA

WATERMELON IN YUNNAN, SOUTHWEST OF CHINA

Y.Y. Yin 1,2, Q. Fang1, X. Lu1, T.T. Li1, M. Ding1 and Z.K. Zhang1 1Institute

of Biotechnology and Germplasm Resources, Yunnan Academy of Agricultural Sciences, Kunming, Key Laboratory of Agricultural Biotechnology of Yunnan Province, Key Lab of the Southwestern Crop Gene Resources and Germplasm Innovation, Ministry of Agriculture, Kunming, 650223, P.R. China 2Institute of Alpine Economic Plant, Yunnan Academy of Agricultural Sciences, Lijiang, 674100, P.R. China

Watermelon is an economically important fruit crop in Yunnan province, China. During a survey in July 2013, watermelon plants showing symptoms of silver mottle on fruits and bud necrosis were discovered in Menghai county of Yunnan province in China. The incidence of symptomatic plants ranged from 80 to 90%. Leaves of ten symptomatic plants were collected and tested by electron microscopy and ELISA. Tospovirus-like spherical particles 80-90 nm in diameter were observed in the sap of diseased leaves, and the ten samples reacted positively to Watermelon silver mottle virus (WSMoV) and Groundnut bud necrosis virus (GBNV) antibodies (Agdia, USA). Total RNA was extracted from symptomatic leaves using TRIzol reagent (Invitrogen, USA) and used in RT-PCR with tospovirus universal primer J13 (5’- CCCGGATCCAGAGCAAT-3’) (Cortez et al., 2011). The RT-PCR products were cloned into pGEM-T Easy vector (Promega, USA) and sequenced. The S RNA sequence of the watermelon virus isolate from Yunnan (YN) was deposited in GenBank (accession No. KM242056). The complete sequence of S RNA was 3,554 nt, sharing 96 and 97% identity with WSMoV isolates from Taiwan (NC_003843) and Japan (AB042650), respectively. The nucleocapsid protein (N) gene of the YN isolate, the non-structual (NSs), and the intergenic region share 97 and 98% nucleotide sequence identity with the Taiwan and Japan isolates, respectively. WSMoV was first reported in Taiwan (Yeh et al., 1995) and then in Guangzhou province of China (Rao et al., 2013). To our knowledge, this is the first report of WSMoV infecting watermelon in Yunnan province, southwest region of China.

S. Krid Hadj Taieb, M. Cheffi, A. Rhouma and M.A. Triki Laboratoire d’Amélioration et Protection des Ressources Génétiques de l’Olivier, Institut de l’Olivier de Sfax, BP 208 Cité Mahrajène, 1082 Tunis, Tunisia

During spring 2011, a new disease was observed on olive (Olea europea) cv. Chemlali in an orchard in Hencha (south east Tunisia). Inspection of the affected planting revealed reddish-brown necrotic lesions on the bark of dead twigs and branches. A fungus isolated on potato dextrose agar (PDA) from symptomatic twigs and branches had an initially white mycelium which turned gray with age. The fungus was identified as Nigrospora sp. based on morphological characteristics and analysis of the ITS gene region (White et al., 1990). A BLAST search of GenBank database revealed 100% homology with a reference sequence of Nigrospora sp. (strain P19E2, accession No. JN 207298.1). Pathogenicity tests were conducted on 10 two-year-old olive trees of cv. Chemlali by placing a mycelial plug in a shallow wound on the stem of each plant. Control plants were inoculated with sterile PDA plugs. Two months post inoculation, brown discolourations and necrotic lesions developed on inoculated stems whereas controls remained healthy. Nigrospora sp. was recovered from the necrotic lesion, fulfilling Koch’s postulates. White T.T., Bruns T., Lee S., Taylor J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). PCR protocols. A guide for Methods and Application, pp. 315-322. Academic Press, San Diego, CA, USA.

This work was supported by Special Fund for Agro-scientific Research in the Public Interest (Project nr. 201303028). Cortez I., Saaijer J., Wongjkaew K.S., Pereira A.M., Goldbach R., Peters D., Kormelink R., 2001. Identification and characterization of a novel tospovirus species using a new RT-PCR approach. Archives of Virology 146: 265-278. Yeh S.D., Chang T.F., 1995. Nucleotide sequence of the N gene of Watermelon silver mottle virus, a proposed new member of the genus Tospovirus. Phytopathology 85: 58-64. Rao X.Q., Wu Z.Y., Li Y., 2013. Complete genome sequence of a Watermelon silver mottle virus isolate from China. Virus Genes 46: 576-580. Corresponding authors: M. Ding, Z.K. Zhang Fax: +8687165160084 E-mail:[email protected]

Corresponding author: S. Krid Hadj Taieb Fax. +216 74 241442 E-mail: [email protected]


Received September 18, 2014 Accepted November 3, 2014


Disease Note

Disease Note

FIRST RECORD OF FIG BADNAVIRUS-1 IN FIG TREES IN IRAN

FIRST REPORT OF BOTRYTIS CINEREA CAUSING POSTHARVEST GRAY MOLD OF TEJOCOTE (CRATAEGUS MEXICANA) FRUIT IN MEXICO

M.R. Alimoradian1, F. Rakhshandehroo1 and M. Shams-Bakhsh2 1Department

of Plant Pathology, College of Agriculture and Natural Resources, Science and Research Branch, Islamic Azad university, P.O. Box. 14515-775, Tehran, Iran 2Department of Plant Pathology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran

In May 2014, mottling and chlorotic spots with necrotic margins were observed on the leaves of fig plants growing outdoor and private gardens in the Karaj district of Alburz (Iran). Based on symptoms, the involvement of Fig badnavirus-1 [FBV-1 (genus Badnavirus, family Caulimoviridae)] in disease aetiology was suspected. Mechanical inoculations of crude sap from symptomatic leaves extracted in 0.1 M phosphate buffer, pH 7.2, containing 0.01% Na 2SO3 induced a mild mosaic in Cucumis sativus, vein clearing in Cucurbita pepo and Nicotiana tabacum cv. Samsun, whereas Phaseolus vulgaris remained symptomless. Twenty leaf samples from five fig gardens were randomly collected and tested for the presence of FBV-1 by PCR using total DNA extracted from leaf samples (Dellaporta et al., 1983) and primers 580F/1650R as described by Laney et al. (2012). Two out of the 20 samples tested proved to be infected with FBV-1, as shown by amplification of a 1070 bp DNA fragment encompassing ORF1, ORF2 and ORF3 of the viral genome. BLAST analysis of the FBV-1 sequences from Iran (GenBank accession Nos. KM610208 and KM610209) showed 98% and 91-97% identity at the nucleotide and amino acid levels, respectively, with the corresponding FBV-1 sequences available in GenBank. The presence of FBV-1 was also confirmed by PCR in inoculated herbaceous indicators. FBV-1 is known to occur in fig trees in different countries worldwide (Minafra et al., 2012), however, to the best of our knowledge, this is the first record from Iran. Dellaporta S.L., Wood J.Y., Hicks J.B., 1983. A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1: 19-21. Laney A.G., Hassan M., Tzanetakis I.E., 2012. An integrated badnavirus is prevalent in fig germplasm. Phytopathology 102: 1182-1189. Minafra A., Chiumenti M., Elbeaino T., Digiaro M., Bottalico G., Pantaleo V., Martelli G.P., 2012. Occurrence of Fig badnavirus 1 in fig trees from different countries and in symptomless seedlings. Journal of Plant Pathology 94: S4.105.

E.H. Nieto-López1, L.A. Aguilar-Pérez1, V. Ayala-Escobar1, D. Nieto-Angel1, R. Nieto-Angel2, S.G. Leyva-Mir2 and J.M. Tovar-Pedraza1 1Fitopatología,

Instituto de Fitosanidad, Campus Montecillo, Colegio de Postgraduados. Km 36.5 Carretera México-Texcoco. Montecillo, Texcoco, 56230. Estado de México, México 2Departamento de Fitotecnia y Parasitología Agrícola, Universidad Autónoma Chapingo. Km 38.5 Carretera México-Texcoco. Chapingo, Texcoco, 56230. Estado de México, México

In Mexico, tejocote (Crataegus spp.) is grown commercially on a total area of more than 900 ha. During November and December 2013, fruits of Crataegus mexicana var. chapeado showing a gray and firm rot were collected in commercial markets in Puebla. Small pieces of decayed fruits were surface-disinfected for 1 min in a 2% sodium hypochlorite solution, rinsed in sterile distilled water, and plated onto potato dextrose agar (PDA). A fungus was isolated whose colonies were initially whitish but turned gray with age. Black and irregular sclerotia were formed after 14 days of incubation at 20°C. Conidiophores were erect, subhyaline and dichotomously branched, and bore unicellular, ovoidellipsoid, subhyaline conidia measuring 7.7-12.7x6.1-9.5 µm. Based on morphology, the fungus was identified as Botrytis cinerea. Genomic DNA was extracted and the internal transcribed spacer (ITS) region of rDNA was amplified using the universal primers ITS5 and ITS4 (White et al., 1990). PCR products were purified and sequenced. The resulting sequence of 496 bp was deposited in GenBank (accession No. KM594622). BLAST search showed 100% identity with B. cinerea sequences KF010847 and KJ476697. To confirm the pathogenicity of the fungus, 10 tejocote fruits were surface-disinfected with 80% ethanol. A conidial suspension (1x106 spores ml-1) was sprayed on the surface of non-wounded fruits. Control fruits were sprayed with sterile distilled water. Typical gray mold symptoms with gray sporulating lesions were observed only on inoculated fruits after eight days. Koch´s postulates were fulfilled when the pathogen was re-isolated from the diseased fruits. To our knowledge, this is the first report of B. cinerea causing postharvest fruit rot on tejocote in Mexico and worldwide. White T.J., Bruns T., Lee S., Taylor J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). PCR protocols: A Guide to Methods and Applications, pp. 315-322. Academic Press, San Diego, CA, USA.

Corresponding author: F. Rakhshandehroo Fax: +98.21.44868445 E-mail: [email protected]

Corresponding author: J.M. Tovar-Pedraza Fax: 52.595.9520200 E-mail: [email protected]




Disease Note

Disease Note

FIRST REPORT OF PEPINO MOSAIC VIRUS ON TOMATO IN APULIA, ITALY

FIRST REPORT OF ASPERGILLUS JAPONICUS CAUSING BROWN SPOT ON LIRIOPE PLATYPHYLLA IN CHINA

G. Bubici, A. De Stradis and F. Cillo Istituto per la Protezione Sostenibile delle Piante del CNR, Sezione di Virologia, Via Amendola 165/A - 70126 Bari, Italy

Y.S. Qian, S. Cai, W.Q. Ma, P.P. Mao, H.Z. Wang and J.B. Wu Zhejiang Provincial Key Laboratory for Genetic Improvement and Quality Control of Medicinal Plants, Hangzhou Normal University, Hangzhou, 310036, China

In October 2013, unusual chlorotic patches were observed on the middle leaves of a few tomato plants cv. Lotty grown in a greenhouse located in the countryside of Fasano (Apulia, southern Italy). Younger leaves and fruits were symptomless and no aggravation of symptoms was detected as time went by. Electron microscope observations of leaf dips revealed the presence of filamentous virus particles ca. 520 nm in length. Mechanical inoculations with leaf extracts from symptomatic tomatoes elicited a mosaic reaction in Nicotiana benthamiana, but not in tomato plants cv. UC82, which, however, were systemically infected, as shown by RT-PCR. A RT-PCR product of the expected size (ca. 700 bp) was obtained using the degenerate broad-spectrum potexvirus primers Potex5/Potex1RC (van der Vlugt and Berendsen, 2002). The amplicon was custom sequenced (BMR Genomics, Italy) and the sequence deposited in GenBank under the accession No. KM923762. BLAST alignment showed that the 700 bp amplicon shared 97-99% homology with the RNA-dependent RNA polymerase (RdRp) gene of several isolates of Pepino mosaic virus (PepMV) genotype CH2, 82% homology with the LP and EU genotypes, and 79-80% with the US genotype. A RT-PCR-restriction fragment length polymorphism (RFLP) analysis of the RdRp amplicon with EcoRI and BglII restriction endonucleases confirmed that our isolate, designated PUG1, belongs to the CH2 genotype (Hanssen, 2010). Our observations and assays are consistent with the presence of PepMV in the tomato plants tested, and the fact that PUG1 is a mild isolate of the virus. PepMV has previously been recorded from tomato in three Italian regions, i.e. Sardinia, Sicily and Campania, but this the first report from Apulia. Hanssen I.M., 2010. Pepino mosaic virus: an endemic pathogen of tomato crops. Ph.D. Thesis, Wageningen University, Wageningen, The Netherlands. ISBN 978-90-8585-557-6. van der Vlugt R.A.A., Berendsen M., 2002. Development of a general potexvirus detection method. European Journal of Plant Pathology 108: 367-371.

Liriope platyphylla (LP; family Liliaceae) is a herbaceous perennial usually grown as low-growing landscape plant, the tubers of which are used as expectorants, antitussives and tonics in traditional Chinese medicine (Hur et al., 2004). In June 2013, yellow and brown spots were observed on LP leaves in several gardens in Pan’an (Zhejiang Province, China). Symptomatic tissues were cut into small pieces, plated on potato dextrose agar (PDA), and incubated at 25°C in the dark. New white mycelia were developed from the margins of diseased tissues after 4 days, and a pure strain F13T-2 was obtained at last. Colonies grew up to about 46.0 mm in diameter after 132 h. At the same time, the surface of mycelia was covered by a large number of conidia, which made the colony purplish-dark. The ribosomal internal transcribed spacer (ITS) region was amplified with ITS1 and ITS4 primers and sequenced. Sequence analysis showed that the ITS sequence of F13T-2 (GenBank Accession No. KF672363) was 99% identical to the ITS sequence of Aspergillus japonicus strain VIT-SB1 (KC128815). Pathogenicity test showed that the fungus present on the inoculated LP leaves was morphologically identical to that originally observed on diseased plants, which fulfilled Koch’s postulates. A. japonicus had been reported as synthetic materials and potentially adequate for industrial production of fructooligosaccharides (Mussatto et al., 2009). To our knowledge, this is the first report of brown spot caused by A. japonicus on LP in China. Study supported by the Project of Zhejiang Provincial Key Laboratory for Genetic Improvement and Quality Control of Medicinal Plants (No. 201308 & 201313), the Hangzhou Scientific and Technological Program (No. 20130432B07), the Scientific Research Programs of Department of Education of Zhejiang Province (No. Y201431430), and the National Science Foundation of Zhejiang Province (No. LY14C010003).

Hur J., Lee P., Kim J., Kim A.J., Kim H., Kim S.Y., 2004. Induction of nerve growth factor by butanol fraction of Liriope platyphylla in C6 and primary astrocyte cells. Biological and Pharmaceutical Bulletin 27: 1257-1260. Mussatto S.I., Aguilar C.N., Rodrigues L.R., Teixeira J.A., 2009. Colonization of Aspergillus japonicus on synthetic materials and application to the production of fructooligosaccharides. Carbohydrate Research 344: 795-800.

Corresponding author: G. Bubici Fax number: +39 080 544 3608 E-mail: [email protected]

Corresponding author: J.B. Wu Fax: +86.571.28865333 E-mail: [email protected]




Disease Note

Disease Note

FIRST REPORT OF LEAF SPOT CAUSED BY ARTHRINIUM ARUNDINIS ON ROSEMARY IN IRAN

FIRST REPORT OF DIEBACK OF OLIVE TREES CAUSED BY NEOFUSICOCCUM AUSTRALE IN TUNISIA

S. Bagherabadi, D. Zafari and F. Ghobadi Anvar

M.A. Triki*, S. Krid HadjTaieb*, M. Cheffi and A. Rhouma

Department of Plant Protection, College of Agriculture, Bu Ali Sina University, Hamedan, Iran

During a survey in 2013, symptoms of brown leaf spots on rosemary (Rosmarinus officinalis) were observed in greenhouses in Hamedan province, Iran. Small fragments of infected tissue were taken from the margins of leaves and were placed on potato dextrose agar (PDA) for 7 days under 12/12 h alternating cycle of light and dark at temperature of 25°C. Isolates on PDA medium were slow-growing, grayish white with floccose whitish aerial mycelium that covered entire PDA plates. Sporulation generally localized in some dark spots in aerial mycelium. Mycelium consisted of smooth, hyaline, branched, septate hyphae, 2 to 3 μm diameter. Conidiophores were erect, septate, smooth, hyaline to brown and very different in shape and size but about 5 µm in diameter and reduced to conidiogenous cells. Conidiogenous cells were pale brown, smooth, ampulliform, 6 to 10 μm long; the apical neck was 3 to 4 μm long, basal part 5 to 6 μm long. Conidia were 1-celled, dark brown, smooth, lemon-shaped to spherical, 5 to 7 μm in diameter, 2 to 4 μm wide with a germ slit at senescence stage. Based on morphological characteristics, the pathogen was identified as Arthrinium arundinis (Corda) Dyko & B. Sutton (Crous and Groenwald, 2013). The internal transcribed spacer regions (ITS1, ITS2 and 5.8s gene) of rDNA were amplified with the primers ITS1/ITS4 and sequenced (Crous and Groenwald, 2013). The sequence was deposited in GenBank (Accession No. KM035852) and in BLAST search showed 99% similarity with sequences belonging to A. arundinis in accordance with morphological identification. In order to confirm Koch’s postulates, pathogenicity tests were done twice on fully developed plants. Rosemary leaves were sprayed with conidial suspension (105 spores/ml), while control plants were sprayed with sterile distilled water. After inoculation, rosemary plants were kept in a growth chamber at 25°C. One week after inoculation, leaf spot symptoms were observed on the inoculated leaves and A. arundinis was successfully reisolated from artificially infected plants. To our knowledge, this is the first report of leaf spot caused by A. arundinis on R. officinalis in Iran.

Laboratoire d’amélioration et Protection des Ressources Génétiques de l’olivier, Institut de l’olivier de Sfax, BP 208 Cité Mahrajène, 1082 Tunis, Tunisia * These authors contributed equally to this work and are regarded as the joint first authors.

In spring 2011, a severe disease resulting in tree dieback of olive tree cv Chemlali was observed in an orchard in Hencha (south east of Tunisia). Symptomatic trees exhibited abundant dead twigs and wilted leaves. On potato dextrose agar (PDA), a fungus isolated from symptomatic twigs and branches was initially white becoming glaucous grey to greenish grey on the upper surface. The fungus was identified as Neofusicoccum australe. based on morphological characteristics and analysis of the ITS gene region (White et al., 1990). The sequence analysis of ITS region of the isolate revealed 100% homology with a reference sequence of N. australe (Strain E54 ML, accession No. KF702388.1). Pathogenicity tests were conducted on 10 two-year old olive trees cv. Chemlali. A mycelial plug was put in a shallow wound on the stem of each plant. Control plants were inoculated with sterile PDA plugs. All plants were kept in a greenhouse. Two months after the inoculation, symptoms appeared with stems showing brown color. No symptoms developed on the control plants. Neofusicoccum was isolated from inoculated stems, thus fulfilling Koch’s postulates. N. australe has been reported as responsible for cordon grapevine dieback in Italy (Linaldeddu et al., 2010). To the best of our knowledge, this is the first report of N. australe as a causal agent of dieback of olive trees in Tunisia. Linaldeddu B.T., Scanu B., Schiaffino A., Serra S., 2010. First report of Neofusicoccum australe associated with grapevine cordon dieback in Italy. Phytopathologia Mediterranea 49: 417. White T.T., Bruns T., Lee S., Taylor J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). PCR protocols. A guide for Methods and Application, pp. 315-322. Academic Press, San Diego, CA, USA.

Chen K., Wu X.Q., Huang M.X., Han Y.Y., 2014. First report of brown culm streak of Phyllostachys praecox caused by Arthrinium arundinis in Nanjing, China. Plant Disease 98, 1274. Crous P.W., Groenewald J.Z., 2013. A phylogenetic re-evaluation of Arthrinium. IMA Fungus 4: 133. Corresponding author: D. Zafari Fax: +98.8114424190 E-mail: [email protected]

Corresponding author: S. Krid HadjTaieb Fax: + 21674241442 E-mail: [email protected]

Received November 1st, 2014 Accepted November 8, 2014

Received November 12, 2014 Accepted November 13, 2014


Disease Note

Disease Note

BACTERIAL SOFT ROT OF CYMBIDIUM GRANDIFLORIUM CAUSED BY

FIRST REPORT OF TOBACCO VEIN

PECTOBACTERIUM CAROTOVORUM subsp. CAROTOVORUM IN CHINA A.S.A.

1State

Elshakh1,

Tao1,

Wang2,

Z.Y. A.J. C.L. Yang1 and G.L. Xie1

Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou 310029, China 2Agricultural Ecology & Plant Protection Station of Yuhang District, Hangzhou 31100, China

Cymbidium grandiflorum cv. Vanguard with symptoms of soft rot was observed in spring 2013 in Hangzhou, China. Rotting was initially confined to several small water-soaked lesions, which enlarged rapidly in diameter. The affected areas became soft and mush while its surface turned discolored and somewhat depressed. The severely infected plants gave off repulsive odor and died. Five bacterial strains coded CH-1 to CH-5(CEC2013-2) isolated from the infected plants showed characteristics similar to those of the standard reference strains of Pectobacterium carotovorum subsp. carotovorum LMG 2404 and P. carotovorum subsp. carotovorum SD-6 in phenotypic tests, including results of Biolog (version 5.2), pathogenicity tests, and FAME, using the Microbial Identification System with aerobic bacterial library (TSBA 6.0). Bacterial isolates were facultative aerobic, rod-shaped, gramnegative, peritrichous flagella, and did not produce greenfluorescent diffusible pigment in King’s Medium B. Colonies on nutrient agar were grey white, slightly raised with smooth margins. Hypersensitive reaction was observed in tobacco. All isolates were identified as P. carotovorum subsp. carotovorum with Biolog similarity of 0.651-0.756 and FAMEs similarity of 0.538-0.703. Crystal violet pectate (CVP) medium test of the strains showed characteristic of P. carotovorum. Identification was confirmed by the specific PCR primers of P. carotovorum subsp. carotovorum pmr A F0145 and E2477 (Mohamed et al., 2014). Inoculation of healthy C. grandiflorum cv. Vanguard plants reproduced the symptoms observed in natural infections, which differ from the bacterial stem rot of poinsettia induced by Pectobacterium chrysanthemi (Rungnapha et al., 2008). The bacterium was re-isolated from symptomatic plants of C. grandiflorium. To the best of our knowledge this is the first report of soft rot of C. grandiflorum caused by this bacterium in China.

BANDING MOSAIC VIRUS IN POTATO IN CHINA

C. Geng1*, T.-S. Zhu2*, J.-L. Liu1, X.-D. Li1, Y.-P. Tian1 and R. Gao1 1Laboratory

of Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, China 2College of Plant Science and Technology, Tarimu University, Alar 843300, China * These authors contributed equally to this research.

Tobacco vein banding mosaic virus (TVBMV) is a distinct potyvirus infecting solanaceous plants with increasing importance for tobacco and other crops in mainland China (Zhang et al., 2011). During an investigation on the host range of TVBMV, we collected 180 potato (Solanum tuberosum) samples showing mild vein banding and mosaic symptoms from Shandong Province. Six samples collected in Linyi reacted positively in PTA-ELISA and Western blot assay with antiserum against TVBMV coat protein. Total RNA was extracted from leaves of a potato sample designated as FX using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and reverse transcribed with M-MLV using primer complementary to the 3’-end of TVBMV coat protein ORF (5’-CTACACGCCACTCACACCAAG-3’). The CP ORF of the TVBMV isolate FX was amplified in PCR with the reverse primer mentioned above and the forward primer identical to the 5’-terminal sequence of TVBMV CP ORF (5’-AATGACGAACAGACAGTTGATGCTG-3’). The PCR fragment was cloned into pGEM-T vector and sequenced. The Blast results indicated that the 816 nt-long CP ORF of the isolate FX (GenBank accession No. DQ917752) showed 99.88% identity with that of TVBMV isolate YND (EF219408) from Yunnan province (Yu et al., 2007). To the best of our knowledge, this is the first report of TVBMV on potato in China. As its importance for the industry is yet to be studied, measures should be taken to avoid the infection of TVBMV in production of virus-free seed potatoes. Work supported by Shandong Provincial Natural Science Foundation (ZR2011CM019) and Special Research Fund for Doctoral Program of Higher Education (20123702110013) from Ministry of Education, China.

Kettani-Halabi M., Terta M., Amdan M., El Mostafa El Fahime, Bouteau F., Ennaji M.M., 2013. An easy, simple inexpensive test for the specific detection of Pectobacterium carotovorum subsp. carotovorum based on sequence analysis of the pmrA gene. BMC Microbiology 13: 176. Rungnapha K., Yu S.H., Xie G.L.. 2008. Bacterial Stem Rot of Poinsettia Caused by a Dickeya sp. (Pectobacterium chrysanthemi) in China. Plant Disease 92: 1135.

Yu X.Q., Lan Y.F., Wang H.Y., Liu L.J., Zhu X.P., Valkonen J.P.T., Li X.D., 2007. The complete genomic sequence of Tobacco vein banding mosaic virus and its similarities with other potyviruses. Virus Genes 35: 801-806. Zhang C.L., Gao R., Wang J., Zhang G.M., Li X.D., Liu H.T., 2011. Molecular variability of Tobacco vein banding mosaic virus populations. Virus Research 158: 188-198.

Corresponding author: G.L. Xie Fax: +86 86049815 E-mail: [email protected]

Corresponding author: X.D. Li Fax: +86.538.8226399 E-mail: [email protected]

Received September 18, 2013 Accepted December 3, 2014

Received October 29, 2014 Accepted December 3, 2014


Disease Note

Disease Note

FIRST REPORT OF AGERATUM YELLOW VEIN VIRUS AND PAPAYA LEAF CURL GUANGDONG VIRUS ON EUPHORBIA PULCHERRIMA IN CHINA

FIRST REPORT OF NEONECTRIA RADICICOLA ASSOCIATED WITH ROOT

J. Zhang*, G.J. Cui*, C.X. Yang and Z.J. Wu Institute of Plant Virology, Fujian Agriculture and Forestry University, Key Laboratory of Plant Virology of Fujian Province, Fuzhou 350002, China * J. Zhang and G.J. Cui contributed equally to this work.

Three Euphorbia pulcherrima (poinsettia, family Euphorbia) plants showing leaf curl and vein thickening symptoms were collected in Fujian Province, China, in 2006. Total DNA was extracted from each sample using a CTAB method. A fragment of approximately 500 bp was amplified by PCR in each sample, using the special degenerate primer pair PA/ PB (Deng et al., 1994). PCR products were gel-purified, ligated into pMD18-T vector (Takara Biotechnology, China), and sequenced. Six clones from each sample were sequenced. Phylogenetic analysis of the 500 bp fragments showed that these sequences formed three distinct branches, and sequence alignment among each branches (63.3% to 73.6%) in one sample indicated that each sample might be mixed infected by three distinct viruses. FE01, FE02 and FE03 isolates representing each virus were further studied. To amplify the fulllength DNA-A of the three isolates, three pairs of abutting primers (FE01-F 5’-CCTTAGCAAGTAGTTCATTCCG-3’/ FE01-R 5’-GACATGTCTTTGTCAGTTAGTGG-3’, FE02F 5’-CCACTCAGAACGCTCCCTCA-3’/FE02-R 5’-GTTCGTGGTAGGGACCACTT-3’, and FE03-F 5’-TGCGCGCTCATCGCTTAGT-3’/FE03-R 5’-ATTATATTGGTCGAGGGCCCAC-3’) were designed based on the obtained sequences, respectively. They were determined to be 2751 (FJ487911), 2754 (FJ495183) and 2733 (FJ495184) nucleotides, and had the typical genome organization of Old World monopartite begomoviruses, respectively. Sequence comparisons revealed that the three isolates were most closely related to those of Euphorbia leaf curl virus (ELCV, AJ558121), Ageratum yellow vein virus (AYVV, FJ869908) and Papaya leaf curl Guangdong virus (PaLCuGDV, FJ869907), with 92.8%, 99.8% and 99.1% sequence identity, respectively. The attempt to detect a DNA-B or a betasatellite component by using specific primers (Briddon et al., 2002; Rojas et al., 1993) was unsuccessful. To the best of our knowledge, this is the first report of AYVV and PaLCuGDV and mixed infection of three begomoviruses in poinsettia in China. Briddon R.W., Bull S.E., Mansoor S., Amin I., Markham P.G., 2002. Universal primers for the PCR-mediated amplification of DNA beta: a molecule associated with some monopartite begomoviruses. Molecular Biotechnology 20: 315-318. Deng D., McGrath P.F., Robinson D.J., Harrison B.D., 1994. Detection and differentiation of whitefly-transmitted geminiviruses in plants and vector insects by the polymerase chainreaction with degenerate primers. Annals of Applied Biology 125: 327-336. Rojas M.R., Gilbertson R.J., Russell D.R., Maxwell D.P., 1993. Use of degenerate primers in the polymerase chain-reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77: 340-347.

ROT DISEASE OF OLIVE IN TUNISIA

M.A. Triki1*, Y. Gharbi1*, S. Krid1, M. Cheffi1, T. Rahma2, I. Hammami1, A. Rhouma1 and R. Gdoura2 1Laboratoire de Recherche: Amélioration et Protection des Ressources Génétiques de l’Olivier, Sfax BP1087, Institut de l’Olivier, IRESA - Université de Sfax, Tunisie 2Unité de Recherche toxicologie - Microbiologie Environnementale et Santé (UR11ES70), Faculté des Sciences de Sfax, Université de Sfax, Université de Sfax, Tunisie * These authors contributed equally to this work and are regarded as the joint first authors.

Olive (Olea europaea) is an economically important crop in Tunisia. During surveys of olive diseases conducted in 2013 in Tunisia, symptoms of leaf wilting and chlorosis, Brown-to-black discoloration of the wood in cross-sections of the stems and necrotic lesions in the roots were observed on young olive trees. Isolation of the pathogen was performed from 15 infected root and stem samples plated onto PDA medium amended with 50 µg ml-1 of streptomycin sulfate. Fungal colonies were then cultured on synthetic nutrient-poor agar medium. All isolates were identified as Cylindrocarpon sp. based on colony morphology and conidial characteristics (Booth, 1966). The isolates developed abundant floccose mycelium, which varied in color from brownyellow to sepia. All isolates produced only macroconidia, which were hyaline, straight, and predominantly three septate measuring 15.75 to 29.50 µm × 3.25 to 4.75 µm. Identity of these isolates was confirmed by sequencing the internal transcribed spacer region, which was amplified using primer pair ITS1 and ITS4 (White et al., 1990). The ITS sequences were deposited in GenBank (KM503139). These sequences revealed 98% genetic identity with those of Neonectria radicicola the anamorphic form of Cylindrocarpon species available in GenBank. Pathogenicity of N. radicicola in olive cv. Chemlali was evaluated using three isolates. Three months after inoculation, the inoculated plants developed wilting and root symptoms similar to those observed in the field. N. radicicola was recovered from all the symptomatic plants. This is the first report of N. radicicola causing root rot of olive in Tunisia, which may potentially affect the sustainability of olive nurseries. Booth C., 1966. The genus Cylindrocarpon. Mycological Papers 104: 1-56. White T.J., Bruns T., Lee S., Taylor J.W., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). PCR Protocols: A Guide to Methods and Applications, pp. 315-322. Academic Press, San Diego, CA, USA.

Corresponding author: Z.J. Wu Fax: +86.591.83705130 E-mail: [email protected]

Corresponding author: M.A. Triki Fax: +216 98 235 163 E-mail: [email protected]

Received September 17, 2014 Accepted December 3, 2014



Disease Note

Disease Note

FIRST REPORT OF GRAPEVINE LEAFROLL ASSOCIATED VIRUS-4 STRAIN 5 IN ITALY

FIRST REPORT OF A DISEASE CAUSED BY FUSARIUM GLOBOSUM ON GIANT CANE IN IRAN

D. Rizzo1, A. Luvisi2, L. Stefani1, M. Paoli1, G. Marchi3, A. Panattoni2 and A. Materazzi2

A.M. Heydari-Nezhad, V. Babaeizad, H.A. Mirhosseini and M. Khaksari

1Servizio

Fitosanitario Regionale, servizi agroambientali di vigilanza e controllo, Regione Toscana, Via dei Fiori 8, 51010 Pescia (PT), Italy 2Department of Agriculture, Food and Environment, University of Pisa, Via del Borghetto, 80, 56124 Pisa, Italy 3Department of Crop, Soil and Environmental Science, University of Florence, Piazzale delle Cascine 28, 50114 Firenze, Italy

Leafroll is one of the most harmful viral diseases affecting grapevine worldwide. Historically, a dozen of viruses, named grapevine leafroll-associated viruses (GLRaVs), belonging to genera Closterovirus and Ampelovirus (Family Closteroviridae), have been found associated with the disease. Recent studies showed that GLRaV-4, -5, -6, -Pr, Deand -Car are in fact strains of the same virus species (Abou Ghanem-Sabanadzovic et al., 2012) prompting taxonomic and nomenclatural revision of these viruses. Among these viruses, GLRaV-4 strain 5 has been reported from many viticultural areas in the world. In 2012-2013, surveys for virus detection disclosed the identification of GLRaV-4 strain 5 in 768 samples collected in Tuscany. The virus presence was ascertained by real-time (RT)-PCR as reported by Osman et al. (2007). GLRaV-4 strain 5 was found in 2 samples (0.63% rate, 2012) and in 4 samples (1.16%, 2013) in cvs Sangiovese and Canaiolo. Further molecular analysis revealed that one infected vine hosted a single GLRaV-5 infection, while other infected vines were infected with multiple viruses, including GLRaV-3, GVA, GFkV and GRSPaV. The GLRaV-4 strain 5 sequences obtained from the positive samples shared 96% nucleotide identities with the corresponding fragment of a reference GLRaV-5 isolate (GenBank accession No. JX559639.1). The nucleotide sequence was deposited in GenBank as accession No. KM252726. To the best of our knowledge this is the first report of the occurrence of GLRaV-4 strain 5 in Italian vineyards. Abou Ghanem-Sabanadzovic N., Sabanadzovic S., Gugerli P., Rowhani A., 2012. Genome organization, serology and phylogeny of Grapevine leafroll-associated viruses 4 and 6: taxonomic implications. Virus Research 163: 120-128. Osman F., Leutenegger C., Golino D., Rowhani A., 2007. Realtime RT-PCR (TaqMan®) assays for the detection of Grapevine leafroll associated viruses 1–5 and 9. Journal of Virological Methods 141: 22-29.

Department of Plant Protection, Sari Agricultural Sciences and Natural Resources University, P.O.BOX 578, Mazandaran, Sari, Iran

Giant cane (Arundo donax) is a monocotyledonous plant belonging to the family Poaceae, whose stems are used in handicrafts and paper industry (Dudley, 2000). Blight of leaf sheaths and stem lesions with a light brown coloured center, surrounded by a darker brown line were observed on A. donax plants in different regions of the Mazandaran province (Iran). Fragments from symptomatic tissues were washed, surface-disinfected with 70% ethanol and a 1% sodium hypochlorite (NaClO) solution and plated on potato dextrose agar (PDA). Fungal cultures displayed a white floccose mycelium that turned often violet with age. A violet pigment that darkened with age was released in the medium. Microconidia were abundant, oval or globose shaped whereas a limited number of 3-5 septate macroconidia was produced. Micro- and macroconidia were ca. 5-10×1 and 15-30×2-3 μm in diameter, respectively. Based on morphological features, the disease agent was identified as Fusarium globosum (Leslie and Summerell, 2006), a result that was confirmed by amplifying by PCR the translation elongation factor (TEF) region (Jurado et al., 2010) and sequencing the obtained product (a 600 bp amplicon). This sequence was then compared with related sequences from GenBank. BLAST analysis of a 600 bp fragment showed 100% similarity with Fusarium globosum (accession No. KJ746615). Pathogenicity tests were conducted by placing mycelial plugs taken from the margins of 3-day-old colonies on the stem of healthy plants. The same symptoms appeared one week after inoculation. Fusarium globosum was previously reported on corn, wheat and barley in Iran (Darvishnia et al., 2005). This is the first report of Giant cane Fusarium sheath blight in Iran. Darvishnia M., Alizade A., Zare R., Mohammadi E., 2006. Three new Fusarium taxa isolated from gramineous plants in Iran. Rostaniha 7: 193-205 (in Persian) Dudley T.L., 2000. Arundo donax L. Invasive plants of California’s wildlands: 53-58. Jurado M., Marín P., Callejas C., Moretti A., Vázquez C., GonzálezJaén M.T., 2010. Genetic variability and Fumonisin production by Fusarium proliferatum. Food Microbiology 27: 50-57. Leslie J.F., Summerell B.A., 2006. The Fusarium laboratory manual, Blackwell publishing, Iowa, USA.

Corresponding author: A. Materazzi Fax: +39 050 2210559 E-mail: [email protected]

Corresponding author: A.M. Heydari-Nezhad E-mail: [email protected]

Received October 29, 2014 Accepted December 4, 2014

Received October 23, 2014 Accepted November 4, 2014


Disease Note

Disease Note

FIRST REPORT OF BOTRYTIS BLIGHT CAUSED BY BOTRYTIS CINEREA ON RUDBECKIA FULGIDA IN ITALY

FIRST REPORT OF COLLETOTRICHUM GRAMINICOLA ON SOUTHERN SWEET-

A. Garibaldi, D. Bertetti, G. Ortu and M.L. Gullino

E. Mirzwa-Mróz1, W. Kukula1, R. Dzieciot1, M. Wit1, K. Baczek2, Z. Weglarz2 and A. Pawelczak2

Centre of Competence for the Innovation in the AgroEnvironmental Sector (AGROINNOVA), University of Turin, Via Leonardo da Vinci 44, 10095 Grugliasco, Italy

In January 2014, a previously unknown leaf and stem blight was observed on Rudbeckia fulgida grown in a glasshouse of the Agroinnova Centre, in Grugliasco, northern Italy. In June 2014, the same symptoms appeared on R. fulgida cultivated in a private garden near Biella, northern Italy. The morphological characteristics of the fungus isolated from infected tissues were typical of Botrytis cinerea (Ellis, 1971). The Internal Transcribed Spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4, and sequenced (GenBank Accession No. KJ698645). BLAST analysis (Altschul et al., 1997) of the 489 bp segment showed a 99% similarity with the sequence of Botryotinia fuckeliana GU395993. In pathogenicity test, symptoms were reproduced on plants of R. fulgida sprayed with a spore and mycelial suspension of the pathogen and B. cinerea was consistently reisolated. Controls sprayed only with water remained healthy. This is the first report of B. cinerea on R. fulgida in Italy. Fifteen isolates of B. cinerea obtained from R. fulgida were evaluated in vitro on PDA amended with increasing concentrations of fungicides. Five strains were resistant to benzimidazoles (ED50 > 100 mg/l, M.I.C. > 300 mg/l), while 3 strains out of 15 showed a reduced sensitivity to iprodione (ED50 5 mg/l, MIC 10 mg/l). Altschul S.F., Madden T.L., Schaffer A.A., Zhang Z., Miller W., Lipman D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programme. Nucleic Acids Research 25: 3389-3402. Ellis M.B., 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, UK.

GRASS LEAVES IN POLAND

1Department

of Plant Pathology, 2Department of Vegetable and Medicinal Plants, Faculty of Horticulture, Biotechnology and Landscape Architecture, Warsaw University of Life SciencesSGGW, 159 Nowoursynowska Street, 02-776 Warsaw, Poland

Southern sweet-grass (Hierochloë australis) is a perennial tuft-grass the leaves of which are used for aromatization of alcohol and tobacco products (Przybyl et al., 2011). In 2013 oblong, irregular lesions surrounded with reddish-brown ring, as well as yellow, reddish brown discoloration were observed in Warsaw-Wilanów on H. australis leaves. Black acervuli with setae were only noted around necrotic spots. Seven isolates of the fungus were obtained on PDA from infected leaves. Cultures were black-gray with aerial white mycelium. Conidia were hyaline, 1-celled, lunate to falcate 22.4×4.4 µm in size. All isolates produced melanized appressoria. Linear growth of isolates was measured on PDA, Czapek solution agar, CMA, MEA and SNA at 24°C. The best growth of the fungus after10 days incubation was observed on PDA (73 mm in diameter) and the slowest on SNA (34 mm). To fulfill Koch’s postulates each of isolates was used to inoculate healthy, 30-day-old seedlings of H. australis by placing a drop of a conidial suspension on their leaves (10 plants/isolate). The leaf surface had previously been disinfected with 1% sodium hypochlorite. Inoculated plants were sealed in foil bags and incubated at 24°C. Symptoms appeared after 5 days. Isolates obtained from artificially inoculated leaves had the same morphology as those used for inoculation. The internal transcribed spacer (ITS) region of the fungus was amplified using the primers ITS1/ ITS4 (Hsiang and Goodwin, 2001) and sequenced (GenBank accession Nos. KM040784, KM040785). BLAST analysis of sequences showed 99% homology to Colletotrichum graminicola. To our knowledge, this is the first report of C. graminicola on H. australis. So far, in Poland this pathogen was only found on maize (Korbas, 2006) and bentgrass (Pronczuk, 2000). Hsiang T., Goodwin P.H., 2001. Ribosomal DNA sequence comparisons of Colletotrichum graminicola from turfgrasses and other hosts. European Journal of Plant Pathology 107: 593-599. Korbas M., 2006. Głownie kukurydzy i inne choroby- szkodliwość i możliwości zwalczania. Progress in Plant Protection Research/ Postępy w Ochronie Roślin 46 (1): 354-357. Prończuk M., 2000. Choroby traw - występowanie i szkodliwość w uprawie na nasiona i użytkowaniu trawnikowym. In: Monografie i Rozprawy Naukowe 4. IHAR Radzików: 183. Przybył J.L., Paczesna E., Angielczyk M., Bączek K., Podyma W., Geszprych A., Węglarz Z., 2011. Intraspecific variability of southern sweet-grass (Hierochloe australis (Schrad.) Roem. et Schult.) wild growing in Poland. Acta Horticulturae 925: 89.

Corresponding author: M.L. Gullino Fax: +39.011.6709307 E-mail: [email protected]

Corresponding author: E. Mirzwa-Mróz E-mail: [email protected]


Received October 28, 2014 Accepted November 2, 2014


Disease Note

Disease Note

PRESENCE OF FIG LEAF MOTTLEASSOCIATED VIRUS 3 IN AN IRANIAN FIG ORCHARD

FIRST REPORT OF LEVEILLULA TAURICA ON CAPPARIS SPINOSA IN

E. Norozian1, F. Rakhshandehroo1 and M. Shams-bakhsh2

G. Bubici

1Department

of Plant Pathology, College of Agriculture and Natural Resources, Science and Research Branch, Islamic Azad university, P.O.Box.14515-775, Tehran, Iran, 2Department of Plant Pathology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran

Fig leaf mottle-associated virus 3 (FLMaV-3) is a putative member of the family Closteroviridae that has been found in fig mosaic disease (FMD) affected fig trees in Turkey (Elci et al., 2012). In May 2014, outdoor fig gardens in Mazandaran province (north of Iran) with FMD symptoms such as leaf mottling and systemic mosaic on young leaves were surveyed and 20 samples were collected from ten fig gardens. Total RNAs was extracted from all twenty samples and healthy fig leaves and used in RT-PCR with primer pair FLMaV-3s F (5’-CTGTATCTGTCATTACCTCTTCGGG-3’) and FLMaV-3as R (5’-CTGTATCTGTCATTACCTCTTCGGG-3’) designed to amplify part of the heat shock protein 70 homologue (HSP70h) gene of FLMaV-3 (GenBank accession No. EF654103). The expected 375 bp DNA fragment was amplified from one fig sample but not from the others. The DNA amplicon was purified and cloned into pTZ57R/T (MBI Fermentas, Germany) and sequenced. The corresponding sequence of the partial HSP70h gene was deposited in GenBank under accession No. KM516760. BLAST analysis showed that the sequence of the Iranian FLMaV-3 isolate had 96% and 100% identity with an isolate from the USA (GenBank accession No. EF654103) at the nucleotide and amino acid levels, respectively. Various viruses belonging to different genera have been reported in fig trees in Iran (Shahmirzaie et al., 2012; Nouri Ale-Agha and Rakhshandehroo, 2013; Danesh-Amuz et al., 2014), however, to our knowledge, this is the first report of FLMaV-3 naturally infecting fig in Iran. Elci E., Serce C.U., Gazel M., Caglayan K., 2012. Molecular detection and comparative sequence analysis of viruses infecting Fig trees in Turkey. Journal of Phytopathology 160: 418-423. Nouri Ale-Agha G., Rakhshandehroo F., 2014. Detection and molecular variability of Fig fleck-associated virus and Fig cryptic virus in Iran. Journal of Phytopathology 162: 417-425. Shahmirzaie M., Rakhshandehroo F., Zamanizadeh H.R., Elbeaino T., 2012. Current status of fig mosaic disease in Iran. Journal of Phytopathology 160: 324-330.

ITALY

Istituto per la Protezione Sostenibile delle Piante, Sezione di Virologia, Consiglio Nazionale delle Ricerche, via Amendola 165/A, 70126 Bari, Italy

In July 2014, a white fungal efflorescence was observed on the stems and both surfaces of mature and young leaves of a caper plant (Capparis spinosa) growing in the Campus of the University of Bari. Light microscope observations revealed the presence of simple or branched conidiophores emerging through leaf stomata, and bearing conidia singly or in short chains. Primary (pyriform) and secondary (cylindrical) conidia, typical of the anamorphic stage of Leveillula taurica (Lév.) G. Arnaud, causal agent of powdery mildew (Palti, 1988), measured on average 62.2×20.2 µm (±7.23×±2.18 µm standard deviation). The teleomorphic stage was not observed during three months of observation. A 630-bp PCR amplicon obtained with the ITS1/ITS4 primer pair was sequenced (BMR Genomics, Italy) and deposited in GenBank under the accession No. KP164030 (isolate designated CSP-PUG1). The sequence shared up to 99% homology with several accessions of L. taurica, including the one previously reported on caper (AB045002), and other species of the genus. The Koch’s postulates were met with a successful pathogenicity test on caper. It is worth noting that, besides this plant, I have never observed powdery mildew on spontaneous caper plants in different Apulian (southern Italy) sites, even when they were growing close to highly susceptible plant species such as Convolvulus arvensis. Therefore, the sporadic pathogen occurrence on this plant might be due to microclimatic conditions unusual for caper. Indeed, the diseased plant had grown under a prolonged shading near a building, but caper normally grows in sun-drenched places like stone walls and rocky cliffs. To the best of my knowledge, this is the first report of L. taurica on caper in Italy. Palti J., 1988. The Leveillula mildews. The Botanical Review 54: 423-535.

Corresponding author: F. Rakhshandehroo Fax: +98.21.44868445 E-mail: [email protected]

Corresponding author: G. Bubici Fax: +39 080 544 3608 E-mail: [email protected]

