CD25+ Treg specifically suppress autoAb ... - Wiley Online Library

Eur. J. Immunol. 2009. 39: 225–233

DOI 10.1002/eji.200838699

Immunomodulation

CD25+ Treg specifically suppress auto-Ab generation against pancreatic tissue autoantigens Isis Ludwig-Portugall, Emma E. Hamilton-Williams, Janine Gotot and Christian Kurts Institute of Molecular Medicine and Experimental Immunology, Friedrich-Wilhelms-Universita¨t, Bonn, Germany To study B-cell tolerance against non-lymphoid tissue autoantigens, we generated transgenic rat insulin promoter (RIP)-OVA/hen egg lysozyme (HEL) mice expressing the model antigens, OVA and HEL, in pancreatic islets. Their vaccination with OVA or HEL induced far less auto-Ab titers compared with non-transgenic controls. Depletion of CD25+ cells during immunization completely restored auto-Ab production, but did not affect antibodies against a foreign control antigen. Depletion at later time-points was not effective. OVA-specific CD25+ FoxP3+ Treg were more frequent in the autoantigen-draining pancreatic LN than in other secondary lymphatics of RIP-OVA/HEL mice. Consistently, B cells were suppressed in that LN and also in the spleen, which is known to concentrate circulating antigen, such as the antigens used for vaccination. Suppression involved preventing expansion of autoreactive B cells in response to autoantigen, reducing antibody production per B-cell and isotype changes. These findings demonstrate that CD25+ Treg suppress auto-Ab production against non-lymphoid tissue antigens in an antigenspecific manner.

Key words: Auto-antibodies . B cells . Tolerance . Transgenic mice . Treg

Introduction Autoreactive B cells are controlled by a series of self-tolerance mechanisms. The first checkpoint incapacitates B cells of high affinity to autoantigen in the bone marrow, by receptor editing [1, 2] or central deletion [1–4]. Self-reactive low-affinity B cells enter the periphery and can constitute up to 5–20% of circulating mature B cells in healthy individuals [5, 6]. Therefore, further peripheral checkpoints exist, such as deletion [1, 2, 7] or anergy [1, 8, 9]. Anergic B cells are arrested in the transitional T2 developmental stage, followed by their death [10]. B cells also die in response to continuous antigen binding [11] and BCR signaling [9]. Auto-Ab production by autoreactive B cells that survive these checkpoints can be avoided by extrinsic regulation [1], like

Correspondence: Professor Christian Kurts e-mail: [email protected]

& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

the absence of T cell help resulting from central T-cell tolerance, which appears to be more efficient than central B-cell tolerance [12]. Th cells are required for B-cell survival [1], class switching, Ig synthesis and somatic hypermutation [6, 13, 14]. The latter process not only further increases BCR diversity but may also generate self-reactive B cells, with an even higher risk for autoimmunity, because after somatic hypermutation, B cells are long-lived and produce high-affinity Ab [15]. Thus, additional tolerance mechanisms seem to be required for maintaining peripheral B-cell tolerance, such as active suppression [6]. In addition to T-cell suppression, Treg have also been proposed to control antibody production, since auto-Ab titers in B-cellmediated disease models were associated with decreased numbers or functionality of Treg, and because depletion of Treg aggravated disease [16, 17]. The role of Treg in antibody production against non-lymphoid tissue autoantigens is unresolved. In rat insulin promoter (RIP)-mOVA mice expressing the model antigen, OVA, in pancreatic islets [18], Treg accumulated

www.eji-journal.eu

225

226

Isis Ludwig-Portugall et al.

in the pancreatic LN (PLN) and suppressed other T cells in an organ-specific manner [19–21]. However, the question regarding antigen-specificity of Treg is unresolved, both for suppression of T and B cells [22, 23]. Here we used novel transgenic mice to address these open questions by studying the role of Treg in tissue auto-Ab generation.

Eur. J. Immunol. 2009. 39: 225–233

OVA IgG titers were further reduced by 2 orders of magnitude, to the levels of T-cell-depleted non-transgenic (non-tg) mice (Fig. 1H), demonstrating that some help was available to autoreactive B cells.

CD25+ cells specifically suppress auto-Ab production against non-lymphoid tissue autoantigen

Results Generation and characterization of transgenic ROHhigh and ROHlow mice To study auto-Ab generation against tissue-restricted autoantigens, we generated ROHhigh and ROHlow transgenic mice expressing the membrane bound model antigens, OVA and hen egg lysozyme (HEL), in pancreatic islet b cells. The transgene contained the rat insulin promoter, the transferrin receptor transmembrane domain, OVA and HEL [18, 24, 25] (Fig. 1A). Immunohistology revealed antigen expression exclusively in pancreatic islets of both lines, which in ROHlow mice was lower and patchy (Fig. 1B). The present study used predominantly ROHhigh mice, while the ROHlow line was employed to exclude effects resulting from transgene insertion into immunologically relevant loci. To investigate whether thymic expression of the transgene caused negative selection of specific T cells, ROHhigh mice were crossed with OT-I mice. OT-I and ROHhigh mice single transgenic mice did not develop spontaneous diabetes, whereas six of six double-transgenic mice showed glucosuria and complete islet destruction at 3–4 wk of age (data not shown). Thus, the thymus of ROHhigh mice permitted development of OVA-specific CD8+ T cells, ruling out complete negative selection by thymic OVA expression. To examine whether B cells of ROHhigh mice were tolerant, we immunized with OVA/alum or b-GAL/alum as a control non-self-antigen (experimental scheme in Fig. 1C). IgG-titers against OVA after 2 wk were reduced 5–7fold in both ROH lines, whereas titers against b-GAL were unchanged (Fig. 1D). OVA-specific IgM titers were also reduced, albeit only by 15–20% (Fig. 1E), and IgA titers were undetectable in the serum (data not shown). Diminished anti-OVA IgG titers were also detectable on days 7 and 26 after immunization (Fig. 1F). Without vaccination, auto-Ab titers were barely detectable (note the background in Fig. 1F). Among the auto-Ab subtypes, IgG1 was dominant (Fig. 1G), as expected when alum is used. These titers were about 40% reduced in ROHhigh mice, whereas titers of the other non-opsonizing subtype, IgG3, was unchanged (Fig. 1G). The opsonizing subtype IgG2a was unchanged, while IgG2b was significantly increased in transgenic mice (Fig. 1G). These findings demonstrated incomplete transgene-specific B-cell tolerance in both ROH lines. The remaining low IgG autoAb also suggested that Th cells may not be completely tolerant. Indeed, when we immunized T-cell-depleted ROHhigh mice, anti-


To investigate whether Treg were involved in preventing auto-Ab production, we determined antibody titers in mice depleted of CD25+ cells using PC61 antibody (experimental protocol in Fig. 2A). Only the CD4+ CD25+ cell population expressed the transcription factor FoxP3+ (Fig. 2B). PC61 treatment reduced CD4+ CD25+ cells by more than 99% and FoxP3+ cells by more than 90% in ROHhigh (Fig. 2B) and non-tg mice (data not shown). ROHhigh mice non-tg controls were immunized with OVA and HEL, or with b-GAL as a control non-self-antigen and antibody titers were measured 26 days later. To ensure depletion over 26 days, PC61 injection was repeated on days 7 and 14 (Fig. 2A). Indeed, this treatment restored most of the anti-OVA and antiHEL IgG auto-Ab titers in transgenic mice (Fig. 2C). This also confirmed that OVA- and HEL-specific B and CD4+ Th cells were not centrally tolerant in ROHhigh mice, but instead were controlled peripherally by CD25+ cells. Antibody titers against b-GAL in ROHhigh mice, and against OVA, HEL and b-GAL in nontg mice were unchanged by CD25+ cell depletion (Fig. 2C), excluding effects on titers against non-self-antigens. Similar results were obtained with ROHlow mice (data not shown). Thus, CD25+ cells specifically suppressed auto-Ab production against pancreatic self-antigens.

CD25+ cells reduce the number of autoreactive B cells and auto-Ab production per B cell Theoretically, CD25+ cells could have suppressed auto-Ab production by reducing the number of autoreactive B cells, or by reducing auto-Ab production per cell. We tested both possibilities by examining splenocytes from the experiment shown in Fig. 2A by ELISPOT. The number of OVA-specific IgG spots indicated the number of autoreactive B cells, and the area of the spot correlated with the amount of auto-Ab of sufficient affinity secreted per B cell. In the spleens of ROHhigh mice, OVA-specific B cells were 50% less frequent and produced 20% smaller spots than in non-tg controls (Fig. 3A). Depleting CD25+ cell during the expansion phase restored both parameters (Fig. 3A). PC61 had no stimulatory effect per se, because values in depleted and non-depleted non-tg mice were similar (Fig. 3A). Thus, CD25+ cells reduced autoreactive B-cell numbers and, to a lesser extent, auto-Ab production per B cell. When we analyzed B cells from the axillary or cervical LN as examples of non-autoantigen-draining LN, neither of these

www.eji-journal.eu

Eur. J. Immunol. 2009. 39: 225–233

Immunomodulation

Figure 1. Incomplete B- and Th-cell tolerance against transgenic self-antigens in ROH mice. (A) Plasmid used for generating ROH mice. (B) Cryosections of pancreata of ROHhigh and ROHlow mice stained for OVA and HEL expression. (C) Experimental protocol for (D–H): ROHhigh, ROHlow and non-tg mice were immunized with OVA or b-GAL in alum i.p. in weekly intervals. Sera were taken after 7, 14 and 26 days. (D and E) OVA- and b-GAL-specific IgG (D) and IgM (E) titers on day 14 measured by ELISA. (F) Kinetics of anti-OVA titers after vaccination. The line indicates background auto-Ab titers in non-vaccinated ROHhigh mice. (G) OVA-specific IgG1, IgG2a, IgG2b and IgG3 titers on day 14. (H) ROHhigh mice and nontg controls were depleted of T cells with T24 Ab, 1 day later immunized with OVA/alum i.p. and on day 21, OVA-specific IgG serum titers were measured. Results are representative of four (D–F) or two (B, G and H) individual experiments. po0.05, po0.01, po0.001.


www.eji-journal.eu

227

228


Eur. J. Immunol. 2009. 39: 225–233

Figure 2. CD25+ cells specifically suppress auto-Ab production against non-lymphoid tissue autoantigen. (A) Experimental protocol: mice were immunized with OVA, HEL or b-GAL in alum i.p. in weekly intervals (black arrows). CD25+ cells were depleted by i.p. injection of PC61 antibody at 4 and 1 day before the first immunization and 1 day before the 2nd and 3rd immunization (gray arrows). Mice were analyzed on day 26. (B) Blood from PC61-depleted (right dot-plot) or non-treated (left dot-plot) ROHhigh mice stained with CD4-APC and either CD25-PE on the same day. The histogram shows intracellular FoxP3 expression in CD4+ CD25 cells (R1) and CD4+ CD25+ (R2) before deletion and in the CD4+ cells after PC61 injection (R3). (C) OVA-, HEL- and b-GAL-specific IgG serum titers in ROHhigh mice and non-tg controls determined by ELISA 26 days after immunization. Data shown as mean7SD (n 5 4) of one representative of four experiments. po0.05.

parameters were reduced, and depletion of CD25+ cells did not change this (Fig. 3B). Thus, CD25+ cells did not regulate autoreactive B cells in these LN, suggesting that these B cells may have contributed to the low residual auto-Ab production detected in non-depleted ROHhigh mice (Fig. 3B). In the autoantigen draining PLN of ROHhigh mice, OVAspecific B cells were less frequent than in non-tg controls, and depletion of CD25+ cells restored their numbers (Fig. 3C, upper panel). Auto-Ab production per B cell was only slightly reduced in tg mice, but CD25+ cell depletion significantly increased this production by 10% (Fig. 3C, lower panel). Thus, autoreactive B cells were suppressed in the PLN, in contrast to all other LN tested. When we examined B-cell differentiation and maturation markers in ROHhigh mice, CD25+ cell depletion did not change


the proportions of OVA-specific B cells of the CD21 CD23 IgDa IgMa+++ T1 or the CD21+++ CD23++ IgDa+++ IgMa+++ T2 transitional stage, the CD21++ CD23++ IgDa+++ IgMa+ mature stage, or of CD21+CD23gDIgMa+++ marginal zone B cells in the spleen or LN (data not shown), demonstrating that CD25+ cells did not arrest B cells in an immature differentiation stage.

Suppression of auto-Ab production requires CD25+ cell function during the B-cell expansion phase The above results suggested that CD25+ cell-mediated suppression occurred during the early phase of auto-Ab production, for example, by preventing autoreactive B-cell expansion after

www.eji-journal.eu

Eur. J. Immunol. 2009. 39: 225–233

challenge with autoantigen. If so, then depleting CD25+ cells after the expansion phase, e.g. on day 23 (protocol in Fig. 4A), should fail to restore auto-Ab production in ROHhigh mice. Indeed, this was the case, as OVA-specific titers were unchanged after PC61 treatment (Fig. 4B), as were titers against the foreign antigen b-GAL (Fig. 4C). Consistently, ELISPOT analysis demonstrated that the reduced numbers of splenic B cells producing OVA-specific antibodies in ROHhigh mice could not be restored by depletion of CD25+ cells on day 23 (Fig. 4D). The reduction of auto-Ab production per B cell in this experiment was not statistically significant (data not shown). These findings confirmed that the suppressive effect of CD25+ cells was mediated during the early phase of the B-cell response against autoantigen.

Immunomodulation

their antigen-specific induction in ROHhigh mice. When we studied the activation state of DO11.10 cells in the PLN as previously described [26], we found upregulation of CD44 and downregulation of CD62L in the PLN of double-tg mice (Fig. 5C), as compared with a non-draining LN (Fig. 5D), or with the PLN in single-tg control mice (Fig. 5E), supporting antigen-specific Treg activity in this node. We detected OVA-specific Treg neither in the thymus of singletg DO11.10 mice nor in the thymus of 3.5-wk-old double-tg mice, and only in low numbers in adult double-tg mice (Fig. 5A and B), consistent with Treg accumulation in the PLN, as previously reported to occur in RIP-mOVA mice [20]. In conclusion, these findings demonstrated higher frequency and activity of Treg in the autoantigen-draining PLN, consistent with their higher suppressive activity in this site.

Frequency of OVA-specific Treg in ROHhigh mice

Discussion The suppression of autoreactive B cells in the PLN (Fig. 3C) raised the possibility that OVA-specific Treg were more abundant in this site. To investigate this hypothesis, we crossed ROHhigh mice to DO11.10 transgenic mice expressing CD4+ T cells specific for OVA. Indeed, in 3.5-wk-old double-tg mice, CD4+ CD25+ FoxP3+ DO11.10 cells were more abundant in the PLN (Fig. 5A), though statistical significance was reached only at 10 wk of age (Fig. 5B). Lower numbers of Treg of this phenotype were also found in adult mice in the spleen and in non-draining LN (Fig. 5B), possibly indicating recirculation. Few Treg were detected in single-transgenic DO11.10 mice lacking OVA autoantigen (Fig. 5), confirming

Using newly generated ROHhigh transgenic mice, we have demonstrated that CD25+ cells suppress the production of autoAb against non-lymphoid tissue autoantigens. The suppressive CD25+ cells were CD4+ and FoxP3+ and thus could be classified as classical Treg. Previous studies had mostly examined the effects of Treg on other T cells [22, 23]. Although such Treg mostly required stimulation through their TCR, it remained controversial whether they needed to be specific for the same antigen as the suppressed T cells [22, 23, 27]. Our in vivo system demonstrated that CD25+ cells inhibited autoreactive B cells in an antigenspecific manner, which is important to ensure unimpaired Ab

Figure 3. CD25+ cells reduce numbers of autoreactive B cells and auto-Ab production per B cell. Using the experimental protocol shown in Fig. 2A, 106 cells from the spleen (A), axial (B) and pancreatic (C) LN of ROHhigh mice or controls were transferred on day 26 after the first immunization into ELISPOT plates coated with OVA. Subsequently, OVA-specific B-cell numbers (upper panels) and antibody production per B cell (lower panels) were determined. Data shown as mean7SD (n 5 4) of one of four experiments. po0.01, po0.001.


www.eji-journal.eu

229

230


Figure 4. Suppression of auto-Ab production requires CD25+ cell function during the B-cell expansion phase. (A) Experimental protocol: mice were immunized with OVA or b-GAL in alum i.p. in weekly intervals (black arrow). Three days prior to analysis CD25+ cells were depleted once by PC61.5 antibody injection (gray arrow). (B) OVA- and (C) b-GAL-specific IgG serum titers in ROHhigh and control mice after 26 days determined by ELISA. Shown as mean7SD (n 5 4). (D) OVAspecific B-cell numbers in the spleen determined by ELISPOT shown as mean7SD (n 5 4) of one of two experiments.

generation against foreign antigens during suppression of autoreactive B cells. Analysis of the suppressed B cells showed that Treg inhibited auto-Ab production by B-cell-intrinsic changes, as evidenced by lower antibody-production per B cell and by changes in subtype composition, and even more effectively by preventing B-cell expansion. Theoretically, expansion may be prevented by inhibiting B-cell proliferation or by inducing their deletion, or by both. In support of the second possibility, it has been shown already that Treg under certain circumstances can induce apoptosis of B cells [28, 29]. In contrast to previous reports, autoreactive B cells in our system were not irreversibly arrested in a transitional development state [10], but instead could proceed to activated mature B cells and produce auto-Ab in response to antigenic challenge once CD25+ cells were removed. Although anergy is principally sufficient to incapacitate autoreactive B cells, its reported dependence


Eur. J. Immunol. 2009. 39: 225–233

on continuous antigenic stimulation via the BCR [9, 30] may cause it to fail when antigen is lost. Anergy of B cells against systemic antigen may also be broken by autoreactive CD4+ Th cells as shown in transgenic systems using HEL [31] or hemagglutinin [32] as systemic autoantigens. Our findings are compatible with these previous findings by others, because also in ROHhigh mice some autoreactive CD4 T cell help was present. By controlling autoreactive Th cells, Treg are suitable to complement well-characterized anergy induction for maintaining B-cell tolerance. FoxP3+ Treg are thought to arise in the thymus, while the questions regarding their induction in secondary lymphatics and their antigen-specificity remain controversial [22, 23, 33–38]. A distinct Treg subset expressing T-cell activation markers underwent cell cycles in LN draining sites of antigen expression [26], implying antigen-specificity. In support of this, CD25+ OVAspecific DO11.10 cells selectively proliferated in the PLN of RIPmOVA mice [20]. Our observation of high numbers of OVAspecific CD25+ FoxP3+ Treg in the PLN of ROHhigh mice and their activation marker expression profile is consistent with these previous findings. Their absence from the thymus, in particular, at an early age, supports peripheral Treg generation in this node, but does not exclude thymic Treg generation in small numbers and subsequent accumulation and/or proliferation in the PLN. Both scenarios lead to high Treg numbers in this node and therefore can explain B-cell suppression in this site. The suppression in the spleen, but not in LN other than the PLN, despite similar frequency of Treg in these sites, indicated that a further factor was required. The antigen-specificity of suppression suggested antigen dose as a likely candidate. The spleen has been shown to concentrate circulating antigens particularly efficient, by means of a conduit system [39]. Presentation of enriched i.p.-injected OVA may have allowed particularly efficient stimulation and suppressive activity of Treg in the spleen. The conduit system of LN appears to be more efficient at enriching antigen arriving through the afferent lymphatics [40]. In our system, autoantigen was restricted to the pancreas and thus could reach via afferent lymphatics only the PLN. Site-specific suppression of autoreactive B cells was not observed in models examining systemic autoantigens, which are relevant, e.g. for the pathogenesis of lupus erythematosus. In lpr or gld mice, which are often used as lupus models, Treg suppressed the production of chromatin-specific auto-Ab [17]. Consistent with the present study, this required their function in the early phase of the B-cell response [41]. Effects on Ig production per B cell or on isotype switch were not examined in that report. Our study did not resolve whether suppression of B cells resulted from direct interaction with Treg, or indirectly by suppressing Th cells, or both. This mechanistic detail may be addressed using models in which autoreactive B cells can interact only with Th cells or with Treg. Also the site of Treg induction and molecular mechanism(s) by which Treg suppress auto-Ab formation remain to be clarified. In conclusion, we have demonstrated that Treg specifically suppress auto-Ab production by incapacitating autoreactive B cells that have escaped central tolerance. These findings can

www.eji-journal.eu

Eur. J. Immunol. 2009. 39: 225–233

Immunomodulation

Figure 5. Frequency of OVA-specific FoxP3+ Treg in ROHhigh mice. ROHhigh and DO11.10 mice were crossed. (A and B) At 3.5 wk (A) and 10 wk (B) of age, the numbers of CD4+ CD25+ FoxP3+ KJ1-26+ DO11.10 cells were determined in the PLN, non-draining axial LN, spleen and thymus in ROHhigh DO11.10 (black bars) and B6 DO11.10 control mice (white bars). (C–E) Expression of the activation markers CD62L and CD44 by DO11.10 cells in the PLN (C) and axial LN (D) of ROHhigh DO11.10 mice and in the PLN of B6 DO11.10 control mice (E) of 3.5 wk of age. Data shown as mean7SD (n 5 3) of one of two experiments. po0.01.

explain why FoxP3-deficient mice and humans bearing a FoxP3 mutation have higher titers of auto-Ab [42–44]. Importantly, the antigen-specificity of B-cell suppression identifies Treg as potential therapeutic targets for preventing auto-Ab formation.

Materials and methods Animals and reagents Mice were bred under specific pathogen-free conditions in the Haus fu ¨r Experimentelle Therapie in Bonn and used at 3.5–16 wk of age in accordance with German animal experimentation regulations. Mice were immunized by i.p. injection of 10 mg immunogen in alum at 1:1 ratio in 200 mL total volume. PC61.5 antibody was purified from hybridoma supernatant and used at 300 mg, T24 antibody at 300 mg per injection. All reagents, if not specified otherwise, were from Sigma (Taufkirchen, Germany).

Generation of transgenic ROHhigh and ROHlow mice The plasmid pBlueRIP/Tfr-Ova contains the Rat insulin promoter, cDNA for the human transferrin receptor membrane domain, the OVA gene (aa 161–407) and an SV40 poly(A) tail [18, 25]. The


StuI–XbaI (528 bp) fragment was excised and the 30 end of the OVA cDNA was amplified using the primers GGA GCT TCC ATT TGC CAG TG and CCC GGG AGG GGA AAC ACA TCT GCC AA, which introduces a Gly-Pro linker and a SmaI site at the 30 end. The 50 end was removed by StuI digestion, the PCR fragments were phosphorylated with T4 polynucleotide kinase and bluntligated back into the StuI–XbaI site of pBlueRIP/Tfr-Ova. HEL cDNA was amplified from the plasmid plExV3-HEL [24] with the primers GGGAAAGTCTTTGGACGATGTG and CCATGGTTACAGCCGGCAGCCTCTGAT, which introduced a stop codon and a NcoI site at the 30 end. The ends of this PCR fragment were phosphorylated and ligated into the newly generated SmaI site at the pBlueRIP/Tfr-Ova 30 end. The 3.47 kb XhoI–BamHI fragment was excised and injected into the pronuclei of fertilized C57/BL6 oocytes. The correct nucleotide sequence of the transgene was verified by sequencing.

ELISA and ELISPOT Serum IgG titers were determined by ELISA. Plates were coated with 250 mg OVA or HEL, or with 5 mg b-GAL per well overnight, blocked with 1% BSA in PBS, and serum dilutions were incubated for 2 h at room temperature. Bound antibody was revealed with biotinylated goat-anti-mouse IgG-bio (Dianova, Hamburg, Germany) or anti-IgG1, IgG2a, IgG2b, IgG3 Ab (BD Biosciences, Heidelberg, Germany), followed by streptavidin-peroxidase and

www.eji-journal.eu

231

232


Eur. J. Immunol. 2009. 39: 225–233

OPD-substrate. For ELISPOT, cell suspensions were incubated for 4 h on ELISPOT plates (Millipore, Bedford, USA). Spots were developed with 3-amino-9-ethylcarbazole (AEC) substrate and analyzed with a Bioreader 200 (Biosys GmbH, Karben, Germany).

7 Lang, J. and Nemazee, D., B cell clonal elimination induced by membrane-bound self-antigen may require repeated antigen encounter or cell competition. Eur. J. Immunol. 2000. 30: 689–696. 8 Goodnow, C. C. and Basten, A., Self-tolerance in B lymphocytes. Semin. Immunol. 1989. 1: 125–135. 9 Cambier, J. C., Gauld, S. B., Merrell, K. T. and Vilen, B. J., B-cell anergy: from transgenic models to naturally occurring anergic B cells? Nat. Rev. Immunol. 2007. 7: 633–643.

Flow-cytometry and statistics

10 Hartley, S. B., Cooke, M. P., Fulcher, D. A., Harris, A. W., Cory, S., Basten,

mAb were from BD Biosciences except anti-B220 and anti-Foxp3FITC were from eBioscience (San Diego, USA) and anti-IgG for ELISA were from Dianova. Dead cells were excluded with Hoechst-33342. Flow cytometry was performed on a FACSCantos II (BD) and data analysis with Flow-Jos software (Tristar, Ashland, OR). t-test analysis was carried out using Prisms (GrapPad, San Diego, USA), and po0.05, po0.01 and po0.001 considered statistically significant.

A. and Goodnow, C. C., Elimination of self-reactive B lymphocytes proceeds in two stages: arrested development and cell death. Cell 1993. 72: 325–335. 11 Gauld, S. B., Benschop, R. J., Merrell, K. T. and Cambier, J. C., Maintenance of B cell anergy requires constant antigen receptor occupancy and signaling. Nat. Immunol. 2005. 6: 1160–1167. 12 Adelstein, S., Pritchard-Briscoe, H., Anderson, T. A., Crosbie, J., Gammon, G., Loblay, R. H., Basten, A. and Goodnow, C. C., Induction of selftolerance in T cells but not B cells of transgenic mice expressing little self antigen. Science 1991. 251: 1223–1225. 13 Breitfeld, D., Ohl, L., Kremmer, E., Ellwart, J., Sallusto, F., Lipp, M. and Forster, R., Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J. Exp.

Acknowledgements: We thank Booshini Fernando for excellent technical assistance, Stefan Thiel for the plExV3-HEL plasmid and Sjef Verbeek for microinjections. We acknowledge technical support by the flow-cytometry core facility and the animal facility of the University Clinic of Bonn. I.L.-P. was supported by fellowship Lu 1387/1-1 of the Deutsche Forschungsgemeinschaft and by a Lise-Meitner fellowship of the German state of Nordrhein-Westfalen, C.K. by a career development grant of the German state of Nordrhein-Westfalen. Conflict of interest: The authors declare no financial or commercial conflict of interest.

Med. 2000. 192: 1545–1552. 14 Winkler, T. H., Fehr, H. and Kalden, J. R., Analysis of immunoglobulin variable region genes from human IgG anti-DNA hybridomas. Eur. J. Immunol. 1992. 22: 1719–1728. 15 Slifka, M. K., Antia, R., Whitmire, J. K. and Ahmed, R., Humoral immunity due to long-lived plasma cells. Immunity 1998. 8: 363–372. 16 Curotto de Lafaille, M. A. and Lafaille, J. J., CD4(+) regulatory T cells in autoimmunity and allergy. Curr. Opin. Immunol. 2002. 14: 771–778. 17 Seo, S. J., Fields, M. L., Buckler, J. L., Reed, A. J., Mandik-Nayak, L., Nish, S. A., Noelle, R. J. et al., The impact of T helper and T regulatory cells on the regulation of anti-double-stranded DNA B cells. Immunity 2002. 16: 535–546. 18 Kurts, C., Heath, W. R., Carbone, F. R., Allison, J., Miller, J. F. and Kosaka, H., Constitutive class I-restricted exogenous presentation of self antigens in vivo. J. Exp. Med. 1996. 184: 923–930.

References

19 Green, E. A., Choi, Y. and Flavell, R. A., Pancreatic lymph node-derived CD4(+)CD25(+) Treg cells: highly potent regulators of diabetes that require

1 Goodnow, C. C., Sprent, J., Fazekas de St Groth, B. and Vinuesa, C. G., Cellular and genetic mechanisms of self tolerance and autoimmunity. Nature 2005. 435: 590–597.

Antigen-dependent proliferation of CD4+CD25+ regulatory T cells in vivo.

2 Yurasov, S. and Nussenzweig, M. C., Regulation of autoreactive antibodies. Curr. Opin. Rheumatol. 2007. 19: 421–426.

approach by autoreactive B cells to escape tolerance. J. Exp. Med. 1993. 177: 999–1008.

transgenic mouse bearing anti-MHC class I antibody genes. Nature 1989. 337: 562–566.

E.

Campbell, D. J. et al., Induction of organ-selective CD4+ regulatory T cell homing. Eur. J. Immunol. 2007. 37: 978–989. 22 Thornton, A. M. and Shevach, E. M., CD4+CD25+ immunoregulatory

4 Nemazee, D. A. and Burki, K., Clonal deletion of B lymphocytes in a

Meffre,

J. Exp. Med. 2003. 198: 249–258. 21 Siewert, C., Menning, A., Dudda, J., Siegmund, K., Lauer, U., Floess, S.,

3 Gay, D., Saunders, T., Camper, S. and Weigert, M., Receptor editing: an

5 Wardemann,

TRANCE-RANK signals. Immunity 2002. 16: 183–191. 20 Walker, L. S., Chodos, A., Eggena, M., Dooms, H. and Abbas, A. K.,

T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J. Exp. Med. 1998. 188: 287–296. 23 Jonuleit, H. and Schmitt, E., The regulatory T cell family: distinct subsets

H.,

and

Yurasov,

S.,

Nussenzweig,

M.

Schaefer, C.,

A.,

Young,

Predominant

J.

W.,

autoantibody

production by early human B cell precursors. Science 2003. 301: 1374–1377. 6 Vinuesa, C. G., Tangye, S. G., Moser, B. and Mackay, C. R., Follicular

and their interrelations. J. Immunol. 2003. 171: 6323–6327. 24 Forquet, F., Calin, V., Trescol-Biemont, M. C., Kanellopoulos, J., Mottez, E., Kourilsky, P., Rabourdin-Combe, C. and Gerlier, D., Generation of hen egg lysozyme-specific and major histocompatibility complex class I-restricted cytolytic T lymphocytes: recognition of cytosolic and

B helper T cells in antibody responses and autoimmunity. Nat. Rev.

secreted antigen expressed by transfected cells. Eur. J. Immunol. 1990. 20:

Immunol. 2005. 5: 853–865.

2325–2332.


www.eji-journal.eu

Eur. J. Immunol. 2009. 39: 225–233

Immunomodulation

25 Teasdale, R. D., D’Agostaro, G. and Gleeson, P. A., The signal for Golgi

39 Nolte, M. A., Belien, J. A., Schadee-Eestermans, I., Jansen, W.,

retention of bovine beta 1,4-galactosyltransferase is in the transmem-

Unger, W. W., van Rooijen, N., Kraal, G. and Mebius, R. E., A

brane domain. J. Biol. Chem. 1992. 267: 4084–4096.

conduit

26 Fisson, S., Darrasse-Jeze, G., Litvinova, E., Septier, F., Klatzmann, D., Liblau, R. and Salomon, B. L., Continuous activation of autoreactive +

+

CD4 CD25 regulatory T cells in the steady state. J. Exp. Med. 2003. 198: 737–746. +

27 Hori, S., Carvalho, T. L. and Demengeot, J., CD25 CD4 regulatory T cells suppress CD4+ T cell-mediated pulmonary hyperinflammation driven by Pneumocystis carinii in immunodeficient mice. Eur. J. Immunol. 2002. 32:

chemokines

and

small

blood-borne

505–512. 40 Pape, K. A., Catron, D. M., Itano, A. A. and Jenkins, M. K., The acquire soluble antigen directly in the follicles. Immunity 2007. 26: 491–502. 41 Fields, M. L., Hondowicz, B. D., Metzgar, M. H., Nish, S. A., Wharton, G. N., Picca, C. C., Caton, A. J. and Erikson, J., CD4+CD25+ regulatory T cells

1282–1291. 28 Janssens, W., Carlier, V., Wu, B., VanderElst, L., Jacquemin, M. G. and Saint-Remy, J. M., CD4+CD25+ T cells lyse antigen-presenting B cells by Fas-Fas ligand interaction in an epitope-specific manner. J. Immunol. 2003.

inhibit the maturation but not the initiation of an autoantibody response. J. Immunol. 2005. 175: 4255–4264. 42 Bennett, C. L. and Ochs, H. D., IPEX is a unique X-linked syndrome characterized by immune dysfunction, polyendocrinopathy, enteropathy,

171: 4604–4612. 29 Zhao, D. M., Thornton, A. M., DiPaolo, R. J. and Shevach, E. M., Activated CD4+CD25+ T cells selectively kill B lymphocytes. Blood 2006. 107:

and a variety of autoimmune phenomena. Curr. Opin. Pediatr. 2001. 13: 533–538. 43 Brunkow,

3925–3932. 30 Gauld, S. B., Merrell, K. T. and Cambier, J. C., Silencing of autoreactive B cells by anergy: a fresh perspective. Curr. Opin. Immunol. 2006. 18: 292–297.

M.

E.,

Jeffery,

E.

W.,

Hjerrild,

K.

A.,

Paeper,

B.,

Clark, L. B., Yasayko, S. A., Wilkinson, J. E. et al., Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat. Genet. 2001. 27: 68–73.

31 Fulcher, D. A., Lyons, A. B., Korn, S. L., Cook, M. C., Koleda, C., Parish, C., Fazekas de St Groth, B. and Basten, A., The fate of self-reactive B cells depends primarily on the degree of antigen receptor engagement and availability of T cell help. J. Exp. Med. 1996. 183: 2313–2328. H.

distributes

humoral immune response is initiated in lymph nodes by B cells that +

32 Guay,

system

molecules through the splenic white pulp. J. Exp. Med. 2003. 198:

M.,

Larkin,

J.,

III,

Picca,

C.

C.,

Panarey,

44 Wildin, R. S., Ramsdell, F., Peake, J., Faravelli, F., Casanova, J. L., Buist, N., Levy-Lahad, E. et al., X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat. Genet. 2001. 27: 18–20.

L.

and

Caton, A. J., Spontaneous autoreactive memory B cell formation driven by a high frequency of autoreactive CD4+ T cells. J. Immunol. 2007. 178: 4793–4802. 33 Takahashi, T., Kuniyasu, Y., Toda, M., Sakaguchi, N., Itoh, M., Iwata, M., Shimizu, J. and Sakaguchi, S., Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of

Abbreviations: HEL: hen egg lysozyme non-tg: non-transgenic PLN: pancreatic LN RIP: rat insulin promoter ROHhigh, ROHlow mice: transgenic mice expressing high or low doses of OVA and HEL under the control of the rat insulin promoter

autoimmune disease by breaking their anergic/suppressive state. Int. Immunol. 1998. 10: 1969–1980. 34 Read, S., Mauze, S., Asseman, C., Bean, A., Coffman, R. and Powrie, F., CD38+CD45RB(low) CD4+ T cells: a population of T cells with immune regulatory activities in vitro. Eur. J. Immunol. 1998. 28: 3435–3447. 35 Thorstenson, K. M. and Khoruts, A., Generation of anergic and potentially immunoregulatory CD25+CD4 T cells in vivo after induction of peripheral tolerance with intravenous or oral antigen. J. Immunol. 2001. 167: 188–195. 36 Kretschmer, K., Apostolou, I., Jaeckel, E., Khazaie, K. and von Boehmer,

Full correspondence: Professor Christian Kurts, Institute of Molecular Medicine and Experimental Immunology, Friedrich-WilhelmsUniversita¨t, 53105 Bonn, Germany Fax: +49-228-287-1052 e-mail: [email protected] Additional correspondence: Dr. Isis Ludwig Portugall Institute of Molecular Medicine and Experimental Immunology, FriedrichWilhelms-Universita¨t, 53105 Bonn, Germany e-mail: [email protected]

H., Making regulatory T cells with defined antigen specificity: role in autoimmunity and cancer. Immunol. Rev. 2006. 212: 163–169. 37 Lohr, J., Knoechel, B. and Abbas, A. K., Regulatory T cells in the periphery.

Current address: Emma E. Hamilton-Williams, Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037, USA

Immunol. Rev. 2006. 212: 149–162. 38 Wong, J., Mathis, D. and Benoist, C., TCR-based lineage tracing: no evidence for conversion of conventional into regulatory T cells in response to a natural self-antigen in pancreatic islets. J. Exp. Med. 2007. 204: 2039–2045.


Received: 11/7/2008 Revised: 15/10/2008 Accepted: 21/10/2008

www.eji-journal.eu

233