cDNA sequence encoding metallothionein protein from Aegiceras corniculatum and its gene expression induced by Pb2+ and Cd2+ stresses Li Yuhong, Harrison I. Atagana, Liu Jingchun, Wu Wenlin & Wu Shijun
Environmental Monitoring and Assessment An International Journal Devoted to Progress in the Use of Monitoring Data in Assessing Environmental Risks to Man and the Environment ISSN 0167-6369 Volume 185 Number 12 Environ Monit Assess (2013) 185:10201-10208 DOI 10.1007/s10661-013-3324-y
1 23
Your article is protected by copyright and all rights are held exclusively by Springer Science +Business Media Dordrecht. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy Environ Monit Assess (2013) 185:10201–10208 DOI 10.1007/s10661-013-3324-y
cDNA sequence encoding metallothionein protein from Aegiceras corniculatum and its gene expression induced by Pb2+ and Cd2+ stresses Li Yuhong & Harrison I. Atagana & Liu Jingchun & Wu Wenlin & Wu Shijun
Received: 22 November 2012 / Accepted: 26 June 2013 / Published online: 16 July 2013 # Springer Science+Business Media Dordrecht 2013
Abstract Constructing various green wetland examples for mangrove wetland systems is a useful way to use natural power to remediate the polluted wetlands at intertidal zones. Metallothioneins (MT) are involved in heavy metal tolerance, homeostasis, and detoxification of intracellular metal ionsinplants.Inordertounderstandthemechanismofheavy metal uptake in Aegiceras corniculatum, we isolated its metallothionein gene and studied the MT gene expression in response to heavy metals contamination. Here, we report the isolation and characterization of MT2 genes from young stem tissues of A. corniculatum growing in the cadmium (Cd) and lead (Pb) polluted wetlands of Quanzhou Bay, southeast of China. The obtained cDNA sequence of MT is 512 bp in length, and it has an open reading frame encoding 79 amino acid residues with a molecular weight of 7.92 kDa and the theoretical isoelectric point of 4.55. The amino acids include 14 cysteine residues and 14 glycine residues. It is a non-transmembrane hydrophilic protein. Sequence and homology analysis showed the MT protein sequence shared L. Yuhong : W. Wenlin : W. Shijun Wetland Institute of Quanzhou Normal University, Quanzhou 362000, China H. I. Atagana (*) Institute for Science and Technology Education, University of South Africa, Pretoria, South Africa e-mail:
[email protected] L. Jingchun School of Life Sciences, Xiamen University, Xiamen 361005, China
more than 60 % homology with other plant type 2 MT-like proteingenes.Theresultssuggestedthattheexpressionlevel of MT gene of A. corniculatum young stems induced by a certain range concentration of Cd2+ and Pb2+ stresses (0.2 mmol L−1 Pb2+, 1 mmol L−1 Pb2+, 0.2 mmol L−1 Pb2+, and 40 μmmol L−1 Cd2+; 1 mmol L−1 Pb2+ and 40 μmol L−1 Cd2+) compared with control might show an adaptive protection. The expression levels of MT gene at 20 h stress treatment were higher than those at 480 h stress treatment. The expression levels of MT gene with 0.2 mmol L−1 Pb2+ stress treatment were higher than those with 0.2 mmol L−1 Pb2+ and40μmolL−1 Cd2+ stresstreatment,andtheMTgene expression levels with 1 mmol L−1 Pb2+ treatment were higher than those with 1 mmol L−1 Pb2+ and 40 μmol L−1 Cd2+ treatment. There exists an antagonistic action between Pb2+ and Cd2+ in the MT metabolization of A. corniculatum. Keywords Aegiceras corniculatum . Cadmium . Gene expression . Heavy metal stress . Lead . Metallothionein . Wetlands pollution
Introduction With the rapid development of modern industry, various contaminants including inorganic and organic substances are discharged into coastal environments. Among these innumerable contaminants, heavy metals pollution in coastal environment has become a global phenomenon because of the toxicity, persistence for several decades in the aquatic environment,
Author's personal copy 10202
bioaccumulation, and biomagnification in the food chain (Kamala-Kannan et al. 2008; Valls and Lorenzo 2002). Coastal wetlands do not only act as pollution sinks but also as pollution resource to organisms, which have weakened their ecological service functions. The use of natural phenomena to efficiently and in an environmentally friendly manner to remediate polluted environments is an important and worthwhile task to pursue. Constructing various green wetland examples for mangrove wetland systems is a wise way to use natural resources to remediate the polluted wetlands at intertidal zones where mangrove species are likely to inhabit. Mangrove ecosystems are diverse communities growing in intertidal zones of tropical to subtropical coastal rivers, estuaries, and bays. Many available data shows that some mangrove plants appear to possess a great tolerance to high levels of heavy metal pollution (Zhang et al. 2012; Li et al. 2010; Zhang et al. 2007; Chen et al. 1998; Tam and Wong 1996; Robertson and Phillips 1995; Tam and Wong 1994), but little information exists on the molecular mechanisms of their heavy-metal tolerance. Metallothioneins (MTs) are a family of lowmolecular-weight Cysteine-rich proteins, which are widely distributed in the invertebrates and vertebrates, plant, prokaryote, and the fungi kingdoms (Maria Guirola et al., 2012; Babula et al. 2012; Vasák and Hasler 2000). Despite the diversity of amino acid sequences in MTs, they are commonly structurally and analogical with high content of cysteine residues (up to 30 %), and lack of aromatic amino acids (Nordberg and Nordberg 2000; Boulanger et al. 1983). MTs can bind metallic ligands due to the cysteine residues of their polypeptide. The N-terminal part is marked as β-domain with three binding sites for divalent ions, usually for Zn(II) or Cd(II), with nine cysteinyl sulfurs. C-terminal part (α-domain) is capable of binding four divalent metal ions (Babula et al. 2012). The cysteine sulfhydryl groups can bind seven moles of divalent metal ions per mol of MT, while the molar ratio for monovalent metal ions (Cu and Ag) is 12 (Duncan and Stillman 2006). Although the naturally occurring protein has Zn(II) in both α- and β-domains binding sites, this ion may be substituted for another metal ion that has a higher affinity for thiolate such as Pb(II), Cu(I), Cd(II), Hg(II), Ag(I), Pt(II and IV), and/or Pd(II). (Babula et al. 2012; Nordberg and Nordberg, 2000). There is a central spacer region consisting of some amino acid residues without cystein within the amino- and
Environ Monit Assess (2013) 185:10201–10208
carboxy-terminal domains with less conservation linking the two domains (de Miranda et al. 1990; Zhang et al. 2004). Metallothionein gene from mangrove species including Bruguiera gymnorrhiza and Kandelia candel have been cloned, and MT2 gene transcripts in B. gymnorrhiza and Avicennia marina have been proposed as useful biomarkers for Cd, Pb, Zn, and Cu contaminants (Huang and Wang 2010; Huang et al. 2011). Aegiceras corniculatum is the most common mangrove plants in the intertidal wetlands in China, and it appears to possess a great tolerance to high levels of heavy metal pollution (Chen et al. 1998). There is, however, little information about the MT and other molecular mechanisms of heavy metal tolerance in A. corniculatum. Hence, it is interesting to study the MT genes and their responses to heavy metal pollution in the wetlands. Our previous studies have shown that both Pb and Cd pollution exists in the wetlands of Quanzhou Bay, southeast China (Li et al., 2006). The aim of this study was to clone and analyze the MT gene sequence from the young stem tissue of A. corniculatum growing in Quanzhou Bay wetlands, by encoding the MT protein and further study its function in the response to Pb and Cd pollution. The study will provide more details on the molecular mechanisms used by the metallothionein in A. corniculatum or a scientific basis for coastal wetland heavy-metal environment remediation with A. corniculatum.
Materials and methods Plant sampling and experiment exposure Six-month-old A. corniculatum seedlings from Luoyang mangrove seed cultivation base were transplanted in pots filled with water-washed sand and watered with 1/2 Hoagland's solution (containing 10‰ NaCl) to acclimate for 6 days under greenhouse conditions. For the experiment on heavy metal exposure, the 6-month-old A. corniculatum was submerged in aqueous solution containing 0.2 mmol•L−1 Pb2+, 1 mmol•L−1 Pb2+, 0.2 mmol•L−1 Pb2+, and 40 μmol•L−1 Cd2+; 1mmol•L−1 Pb2+ and 40 μmol•L−1 Cd2+ for 20 and 480 h (20 days). Control plants were submerged in liquid solution without heavy metals. Following heavy metal treatment, plants were collected and frozen in liquid nitrogen, which was prepared for RNA extraction.
Author's personal copy Environ Monit Assess (2013) 185:10201–10208
cDNA cloning and sequence analysis MT2cDNA sequence(GenBank accessionno.DQ913821) was first amplified from young stem RNA of 6-month-old A. corniculatum seedlings from Luoyang mangrove with reverse transcription polymerase chain reaction (RT-PCR). Total RNA was isolated using a modified CTAB method (Deng et al. 2004). However, we ground the samples under liquid nitrogen thoroughly into a fine powder as to get a shorter homogenization time. The CTAB extraction buffer contains 4 % β-mercaptoethanol to prevent sample oxidation and to inhibit RNase release from tissues prior to chloroform extraction. RNA integrity was examined by electrophoresis on a regular 1.0 % agarose gel and stored at −70 °C. Degenerate primers for cDNA cloning of MT were designed according to the conservative region in other plants MTs reported in NCBI. Conversion of mRNA to cDNA is achieved using a degenerate forward primer1 (5′-ATG TCT(G) TGC TGC (T) GGA (T) GGA (C) AAC TG-3′) and the oligo dT-anchor primer (5′ GACCACGCGTATCGATGTCGACTTTTTTTTTTT TTTTTA 3′) in the first reverse transcription reaction, then the diluted PCR product was used as template, Primer1 and anchor (5′GACCACGCGTATCGATG TCGAC 3′) were employed to carry out the second round of PCR for cloning MT gene. Gene-specific primers were designed from the previously determined DNA sequence to confirm the MT sequences. The amplified cDNA fragments were cloned into the pGEM-T Easy vector following the instructions provided (Promega Corporation, Madison, WI, USA). Recombinant bacteria were identified by blue/white screening and confirmed by PCR. Plasmids containing the inserted MT were used as a template for DNA sequencing. Nucleotide sequence was determined by the automatic sequencer ABI Prism 310 genetic analyzer (Applied Biosystems). The MT cDNA sequence and its translated amino acid sequence were analyzed and compared using the BLASTX and BLAST search program (http://ncbi.nlm. nih.gov/BLAST) with a GenBank database search; multiple alignments of the amino acid sequences were finished on http://www.ebi.ac.uk/Tools/msa/clustalw2/. The possible physical and chemical properties of A. corniculatum MT protein were analyzed on http://expasy. org/tools/protparam.html. The transmembrane region prediction and the hydrophobicity/hydrophilicity of the deduced amino acid sequence of MT were analyzed on
10203
http://www.ch.embnet.org/software/TMPRED_form.html and http://expasy.org/tools/protscale.html, respectively. Quantification of MT mRNA level Quantitative real-time PCR assays were conducted with SYBR Green using the relative standard curve method to analyze for metal-inducible MT mRNA expression by Applied Biosystems 7500 real-time PCR system, and the total RNA was reverse-transcribed into cDNA using the one-step TaKaRa Primescript™ RT reagent kit (Perfect Real-time, DRR037S, TaKaRa). In order to examine the MT mRNA expression changes, gene-specific primers were redesigned according to the released MT cDNA sequence on GenBank (DQ913821) and 18S rRNA cDNA sequence on GenBank(AY671951) as follows: MT forward primer(5′ATGTCGTGCTGTGGT GGAAA 3′), MT reverse primer (5′TCAAAGTA CATCTGCTTTGG3′), 18S rRNA forward primer (5′ CAAGGTGAAATTCTTGGAT3′), and 18S rRNA reverse primer (5′TAGGACGGTATCTGATCGTCT3′). The expected amplification products were 158 bp long for MT2 and 113 bp long for 18S rRNA. QPCR was performed as follows: denaturation at 95 °C for 3 min; 40 cycles of denaturation at 95 °C for 15 s, annealing at 56 °C for 30 s, and a final extension at 72 °C for 40 s. As an internal control, experiments were duplicated with 18S rRNA, and all data were expressed as change with respect to corresponding 18S rRNA calculated threshold cycle levels. Triplicate assays per cDNA sample were carried out to determine the average. Statistical analysis Results were presented as mean±standard deviation. The levels of statistical significance were determined by one-way ANOVA, and results were considered to be significant at p
