Cell Cycle The Saccharomyces cerevisiae checkpoint ...

This article was downloaded by: [205.232.28.240] On: 24 June 2015, At: 07:53 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Cell Cycle Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/kccy20

The Saccharomyces cerevisiae checkpoint genes RAD9, CHK1 and PDS1 are required for elevated homologous recombination in a mec1 (ATR) hypomorphic mutant Michael Fasullo & Mingzeng Sun Published online: 01 Aug 2008.

To cite this article: Michael Fasullo & Mingzeng Sun (2008) The Saccharomyces cerevisiae checkpoint genes RAD9, CHK1 and PDS1 are required for elevated homologous recombination in a mec1 (ATR) hypomorphic mutant, Cell Cycle, 7:15, 2418-2426, DOI: 10.4161/cc.6411 To link to this article: http://dx.doi.org/10.4161/cc.6411

PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions

[Cell Cycle 7:15, 2418-2426; 1 August 2008]; ©2008 Landes Bioscience

Report

The Saccharomyces cerevisiae checkpoint genes RAD9, CHK1 and PDS1 are required for elevated homologous recombination in a mec1 (ATR) hypomorphic mutant Michael Fasullo1,2,* and Mingzeng Sun1 1Ordway

Research Institute; Albany, New York USA; 2Department of Biomedical Sciences; School of Public Health; State University of New York; Albany, New York USA

IST RIB

OT D

Introduction

Mutations in ATR, a member of the PI3K family of genes,1 have been identified in SCKL patients.2 Since SCKL1 shares many clinical characteristics with Nijmegen breakage and LIG4 syndromes,3 which are defective in DNA repair, clinical features of SCKL may result from genetic instability. Consistent with this hypothesis, cells from some SCKL patients exhibit higher frequencies of chromosomal instability3 and SCE.4 The higher recombination frequencies may result from chromosomal breaks that occur when replication forks pass through chromosomal fragile sites.3,5 Saccharomyces cerevisiae (budding yeast) is a useful organism to understand genetic instability phenotypes conferred by mutations in the PI3K family of genes. MEC1 is the essential yeast homologue6 of the human ATR/ATM genes1 and shares some functions with both ATM and ATR. MEC1 prevents replication fork collapse, a function shared with ATR, but not ATM, in mammalian cells.1 Similar to ATR, MEC1 is required for viability; mec1 lethality can be suppressed by overexpression of RNR1 (ribonucleotide reductase), or by deleting SML1, an inhibitor of ribonucleotide reductase.7 mec1 mutants are thus sensitive to a broad range of DNA damaging agents, as well as inhibitors of ribonucleotide reductase, such as hydroxyurea (HU).6,8 mec1-D (null) mutants exhibit high rates of spontaneous and DNA damage-associated GCRs9 and LOH due to mitotic crossovers.10 One interpretation of mec1-associated genetic instability is that replication fork collapse results in more recombinogenic DNA lesions,11 which in turn initiates more GCRs and LOH. Considering that mec1-Δ is defective in cellular responses to DNA damage and dNTP imbalance,12 including S and G2 checkpoints,13 it is difficult to accurately quantify all the causes of the genetic instability phenotypes in mec1-Δ. mec1 hypomorphic mutants that retain essential function are useful in determining which mec1 phenotypes result from particular checkpoint defects. Such mutants include mec1-srf (synthetic lethality with rad-fifty-two), which accumulate single-stranded DNA,14 and

20

08

LA

ND

ES

BIO

SC

IEN CE

.D

ON

Specific ataxia telangiectasia and Rad3-related (ATR) mutations confer higher frequencies of homologous recombination. The genetic requirements for hyper-recombination in ATR mutants are unknown. MEC1, the essential yeast ATR/ATM homolog, controls S and G2 checkpoints and the DNA damage-inducibility of genes after radiation exposure. Since the mec1-Δ (null) mutant is defective in both S and G2 checkpoints, we measured spontaneous and DNA damage-associated sister chromatid exchange (SCE), homolog (heteroallelic) recombination, and homology-directed translocations in the mec1-21 hypomorphic mutant, which is defective in the S phase checkpoint but retains some G2 checkpoint function. We observed a sixfold, tenfold and 30-fold higher rate of spontaneous SCE, heteroallelic recombination, and translocations, respectively, in mec1-21 mutants compared to wild type. The mec1-21 hyper-recombination was partially reduced in rad9, pds1 and chk1 mutants, and abolished in rad52 mutants, suggesting the hyper-recombination results from RAD52-dependent recombination pathway(s) that require G2 checkpoint functions. The HU and UV sensitivities of mec1-21 rad9 and mec1-21 rad52 were synergistically increased, compared to the single mutants, indicating that mec1-21, rad52 and rad9 mutants are defective in independent pathways for HU and UV resistance. G2-arrested mec1-21 rad9 cells exhibit more UV resistance than non-synchronized cells, indicating that one function of RAD9 in conferring UV resistance in mec1-21 is by triggering G2 arrest. We suggest that checkpoint genes that function in the RAD9-mediated pathway are required for either homologous recombination or DNA damage resistance in the S phase checkpoint mutant mec1-21.

©

Downloaded by [205.232.28.240] at 07:53 24 June 2015

Key words: MEC1, homologous recombination, DNA repair, G2 checkpoint, yeast

UT E

.

Abbreviations: ATM, ataxia telangiectasia mutated; ATR, ATM and Rad3 related; DSB, double-strand break; GCR, gross chromosomal rearrangements; HU, hydroxyurea; LOH, loss of heterozygosity; MMS, methyl methanesulfonate; SCE, sister chromatid exchange; SCKL, seckel syndrome

*Correspondence to: Michael Fasullo; Ordway Research Institute; 150 New Scotland Avenue; Albany, New York 12208 USA; Tel.: 518.641.6467; Email: mfasullo@ ordwayresearch.org Submitted: 06/03/08; Accepted: 06/09/08 Previously published online as a Cell Cycle E-publication: http://www.landesbioscience.com/journals/cc/article/6411 2418

Cell Cycle

2008; Vol. 7 Issue 15

. UT E IST RIB OT D ON .D

IEN CE

mec1-21,8,15 which exhibits lower frequencies of GCRs and is more HU resistant, compared to mec1-Δ mutants.10 Although mec1-21 is deficient in both the S phase checkpoint and Rad53 activation after UV and HU exposure,8 X-ray exposure can trigger G2 arrest in mec1-21, which correlates with phosphorylation of Pds1 but not Rad53.16 mec1-21 chk1 and mec1-21 pds1 mutants exhibit enhanced sensitivity to X rays, compared to the single mutants,16 suggesting that the CHK1 signaling pathway contributes to recombinational repair in mec1-21. However, it is unknown whether the CHK1 signaling pathway contributes to DNA damage resistance when mec1-21 cells are exposed to DNA damaging agents that arrest or stall DNA replication, such as HU and UV. We asked whether G2 checkpoint genes, including CHK1, PDS1 and RAD9, contribute to homologous recombination in mec1-21 and DNA damage resistance after exposure to DNA lesions that hinder DNA replication. We demonstrate that, compared to wild type, mec1-21 mutants exhibit higher rates of RAD9-dependent spontaneous, homologous recombination between sisters, homologs and repeats on non-homologous chromosomes. We suggest that spontaneous DNA lesions generated in hypomorphic S phase mutants require G2 checkpoint genes for recombinational repair.

Results

20

08

LA

ND

ES

BIO

SC

Specific ATR cell lines exhibit higher frequencies Figure 1. SCE, translocation, and heteroallelic recombination assays used in this study. Ovals of SCE, although little is understood concerning represent centromeres and lines represent chromosomes. For simplicity, the left arms of chromothe genetic control of the hyper-recombination somes are not included. An arrow and feathers together denote HIS3. As indicated in the bottom phenotype. We asked whether mec1 (ATR) left of the figure, the 5' deletion, his3-Δ5', lacks the feather and the 3' deletion, his3-Δ3', lacks mutants, defective in the S phase checkpoint, also the arrow. The two regions of the sequence identity shared by the his3 fragments are indicated exhibit higher frequencies of SCE and genetic by decorated boxes; closely-spaced diagonal-filled boxes indicate a region of 167 bp, and the broadly-spaced diagonal line-filled boxes indicate a region of ~300 bp. The 117-bp HO instability phenotypes resulting from homologous cut site (HOcs), as indicated by an arrowhead, is located between these sequences within the recombination. We measured spontaneous recom- his3-Δ3'::HOcs fragment. The “X” indicates where recombination occurred. The his3-truncated bination phenotypes in the S phase checkpoint fragments are integrated into the trp1 locus to measure SCE events. His+ recombinants resultmec1-21,8,15 a mutant that is still proficient at ing from unequal SCE were selected that contain HIS3 flanked by his3-Δ3' and his3-Δ5'. triggering G2 arrest after radiation exposure.16 (B) Translocation events result from recombination between the same his3 fragments located each on chromosomes II and IV. Positions of the GAL1 and trp1 are shown on chromosomes II, The recombination assays are shown in Figure 1. IV, and the chromosomal translocations. (C) Heteroallelic recombination between ade2-a and + Unequal SCE was measured by selecting for His ade2-n generates ADE2. ADE2 and ade2 alleles are represented as boxes; ade2-a and ade2-n recombinants in haploid strains containing two are separated by approximately 1 kb. truncated his3 gene fragments.17 Diploid strains were used to measure heteroallelic recombination between ade2-a similar to wild type (Table 2). These data indicate that mec1-21 is and ade2-n18 and ectopic recombination between GAL1::his3-Δ5' recessive and exhibits a RAD52-dependent hyper-recombination and trp1::his3-Δ3'.17 phenotype. Spontaneous hyper-recombination SCE phenotype observed in Because mec1-Δ is defective in G2 checkpoint function and mec1-21 requires RAD52, and G2 checkpoint genes. We observed mec1-21 cells can still arrest in G2 after radiation exposure,16 we a sixfold increase in the rate of spontaneous unequal SCE in the determined whether hyper-recombination in mec1-21 required mec1-21 mutant compared to wild type (p < 0.05, Table 2). The rate downstream G2 checkpoint functions encoded by RAD9, PDS1 and of spontaneous SCE in mec1-21 containing pRS416-ADE3-MEC119 CHK1 (Table 2). The rates of spontaneous SCE in rad9 (YB147), was near wild-type levels (Table 2). The mec1-21 hyper-recombi- chk1 (YB335), pds1 (YB301) and wild type (YB163) were similar. nation phenotype was abolished in rad52 (Table 2). The rates of The hyper-recombination of mec1-21 was partially reduced (p < spontaneous SCE in sml1 (YB326) and mec1-Δ sml1 (YB327) were 0.05) in mec1-21 pds1(YB383), but was decreased to near wild-type

©


Homologous recombination in a yeast mec1 hypomorphic mutant

www.landesbioscience.com

Cell Cycle

2419


Table 1 Yeast strains Source (Synonym)

MATa ura3-52 his3-∆200 lys2-801 trp1-∆1 ade2-101

M. Carlson (MCY727)

YA165

MATα ura3-52 his3-∆200 trp1-∆1 leu2-∆1

F. Winston (FY250)

YA166

MATa ura3-52 his3-∆200 trp1-∆1 leu2-∆1

F. Winston (FY251)

YA184

MATa trp1-1 leu2-3,112 his3-11,15 ura3-1 can1-100 sml1::URA3 rad53::HIS3 RAD5

R. Rothstein (W2105-17B)

YA185

MATa trp1-1 leu2-3,112 his3-11,15 ura3-1 can1-100 mec1-∆::TRP1 sml1::HIS3 RAD5

R. Rothstein (U963-61A)

YA197

MATα ade2-1 trp1-1 leu2-3, 112 his3-11,15 ura3-1 can1-100 mec1-21

S. Elledge (Y620)

YB313

MATa-inc ura3-52 his3-∆200 lys2-801 trp1-∆1 gal3- mec1-21

Derived from cross of YB311 x YA165

YB314

MATα ura3-52 his3-∆200 lys2-801 trp1-∆1 gal3- mec1-21

Derived from cross of YB312 x YA166

YB315

MATa ura3-52 his3-∆200 ade2-a lys2-801 trp1-∆1 gal3-

Derived from YA102

YB316

MATα ura3-52 his3-∆200 ade2-a lys2-801 trp1-∆1 gal3- mec1-21

Derived from cross of YB315 x YB314

YB343

MATa ura3-52 his3-∆200 ade2-a lys2-801 trp1-∆1 gal3 rad9::URA3

This laboratory

MATα ura3-52 his3-∆200 ade2-101 trp1-∆1 gal3- leu2-3, 112 GAL1::his3-∆ 5' trp1::his3-∆3'::HOcs lys2- (leaky)

YB318

MATα ura3-52 his3-∆200 ade2-n trp1-∆1 gal3- leu2-3, 112 GAL1::his3-∆ 5' trp1::his3-∆3'::HOcs lys2- (leaky)

YB319

MATa-inc ura3-52 his3-∆200 ade2-n trp1-∆1 gal3- leu2-3, 112 GAL1::his3-∆ 5' trp1::his3-∆3'::HOcs lys2- (leaky) mec1-21

This laboratory

OT D

IST RIB

YB109

Derived from of YB109


YB316 x YB319

YB342

MATα ura3-52 his3-∆200 ade2-n trp1-∆1 gal3- leu2-3, 112 GAL1::his3-∆ 5' trp1::his3-∆3'::HOcs lys2- (leaky) rad9::LEU2 mec1-21

YB344

MATa ura3-52 his3-∆200 ade2-a lys2-801 trp1-∆1 gal3- rad9::URA3 mec1-21

Derived from cross of YB316 with YB343

YB345

YB342 x YB344

This laboratory

ON

YB325

YB315 x YB318

YB349

MATα ura3-52 his3-∆200 ade2-n trp1-∆1 gal3- leu2-3, 112 GAL1::his3-∆ 5' trp1::his3-∆3'::HOcs lys2- (leaky) rad9::LEU2

IEN CE

.D

YB348

YB350

This laboratory rad9::LEU2 disruption in YB382

This laboratory rad9::LEU2 disruption in YB318

YB343 x YB349

This laboratory

MATα ura3-52 his3-∆200 ade2-n trp1-∆1 gal3- leu2-3, 112 GAL1::his3-∆ 5' trp1::his3-∆3'::HOcs lys2- (leaky) mec1-21


YB147

MATa ura3-52 his3-∆200 ade2-101 lys2-801 trp1-∆1 gal3- trp1::[his3-∆3'::HOcs, his3-∆5'] rad9::URA3

This laboratory

YB163

MATa-inc ura3-52 his3-∆200 ade2-101 lys-801 trp1-∆1 gal3- trp1::[his3-∆3'::HOcs, his3-∆5']

This laboratory

MATα leu2-∆1

This laboratory

SC

YB382

YB312 YB326

ES

MATα leu2-∆1 pds1::LEU2

This laboratory

MATa-inc mec1-21

10th backcross of Y620 with YB163

MATα mec1-21

10th back cross of Y620 with YB163

MATa-inc sml1::KanMX

sml1::KanMX disruption in YB163

MATa-inc sml1::KanMX mec1-∆::TRP1

mec1::TRP1 disruption in YB326

YB328

MATα rad52::KanMX

rad52::KanMX disruption in YB204

YB347

MATa-inc mec1-21 rad52:KanMX

from cross of YB329 with YB328

YB331

MATa-inc mec1-21 rad9::URA3

From cross of YB142 with YB312

YB335

MATa-inc chk1::KanMX

chk1::KanMX disruption in YB163

YB337

MATα mec1-21 chk1::KanMX

from cross of YB336 with YB335

YB346

MATα mec1-21 + pRS416(MEC1)

Ura+ transformants of YB312

YB383

MATα mec1-21 pds1::KanMX

pds1::KanMX disruption in YB312

20

YB327

ND

YB311

LA

YB301

08

YB204

BIO

Strains to monitor SCEa

©


Strains to monitor translocations and heteroallelic

eventsa

.

Genotype

YA102

UT E

Strain

aAll strains listed below YB163 have the same genotype as YB163 unless indicated. Mating type is added for clarity. YB333 and YB334 may contain either ura3-52 or ura3∆0, and lys2∆0 or lys2-801.

levels in mec1-21 rad9 (YB331, p > 0.05) and mec1-21 chk1 (YB337). Thus, mec1-21 hyper-recombination requires the G2 checkpoint genes RAD9, CHK1 and PDS1. 2420

mec1-21 diploid mutants exhibit more spontaneous recombination between homologs and between repeated sequences on non-homologs. Since there are different genetic requirements for

Cell Cycle

2008; Vol. 7 Issue 15

Table 2 Rates of spontaneous SCE in mec1 and checkpoint mutants Genotypea

Rate (x 106)b

YB163

MEC1

1.1 ± 0.1

1

YB312

mec1-21

6.3 ± 0.9

5.7

YB326

sml1::KanMX

1.1 ± 0.2

1.0

YB327

mec1-∆::TRP1 sml1::KanMX

1.2 ± 0.2

1.1

YB346

mec1-21 + pRS416-ADE3-MEC1

1.9 ± 0.2

1.7

Strain

Ratioc

rad mutants

YB328

rad52::KanMX

0.24 ± 0.04

0.2

YB347

mec1-21 rad52::KanMX

0.31 ± 0.03

0.3

Checkpoint mutants rad9::URA3

1.0 ± 0.4

1.0

YB331

mec1-21 rad9::URA3

1.8 ± 1.0

1.6

YB335

chk1::KanMX

1.4 ± 0.3

1.3

YB337

mec1-21 chk1::KanMX

2.0 ± 0.4

1.8

pds1::LEU2

1.6 ± 0.0

1.6

mec1-21 pds1::KanMX

4.1 ± 0.7

3.7

YB383

UT E

complete genotype, see Table 1. bRate, number of events per cell division; n ≥ 3; cRatio, rate of SCE in mutant/rate of SCE in wild type.

OT D

aFor

IST RIB

YB301

.

YB147

20

08

LA

ND

ES

BIO

SC

IEN CE

.D

ON

sister chromatid and homolog recombination, we asked whether mec1-21 diploid mutants exhibited higher intragenic homolog (heteroallelic) recombination than wild type. Unlike spontaneous unequal SCE, spontaneous heteroallelic recombination between ade2-a and ade2-n (Fig. 1) is RAD51-dependent.18 Since ade2 colony sectors are red while ADE2 sectors are white, the hyper-recombination can be visualized by a simple colony assay (Fig. 2). The rate of heteroallelic recombination in mec1-21 was 10-fold higher than in wild type, while the rates in rad9 and wild type were similar (Table 3). The rate of spontaneous heteroallelic recombination was reduced in mec1-21 rad9, compared to mec1-21, but still four times higher than that observed in wild type (p < 0.05). Thus, similar to SCE, rates of heteroallelic recombination were higher in mec1-21 than in wild type, but reduced in mec1-21 rad9 mutants. Homologous recombination between repeated sequences could potentially generate chromosomal rearrangements. Considering that mec1-21 exhibited a higher rate of recombination between sister chromatids and homologs, we asked whether chromosomal translocations, resulting from ectopic recombination between two his3 fragments (Fig. 1), occur more frequently in mec1 diploid mutants. Compared to wild type, we observed 23-fold increase in spontaneous translocations in mec1-21 (Table 3). The rate of spontaneous translocations in the mec1-21 rad9 diploid was the same as that observed in rad9 diploid (p < 0.05), and sixfold higher compared to that of wild type. Thus, homology-directed translocations occurred more frequently in mec1-21 than in wild type. These results are consistent with observations that S phase defects, resulting from insufficient levels of DNA polymerase α, promote homology-directed translocations.20 RAD52 and G2 checkpoint genes confer UV and HU resistance in mec1-21. We speculate that the spontaneous hyper-recombination in mec1-21 is generated by more recombinogenic lesions, such as double-strand breaks, that occur due to collapsed replication forks or incomplete DNA replication in S phase checkpoint mutants. The RAD9-dependence of the RAD52-mediated recombination indicates that cell cycle checkpoint function is required for spontaneous DNA lesions to initiate recombinational repair. We determined whether RAD52-dependent recombination and RAD9-mediated checkpoint function in mec1-21 also contributes to resistance to DNA damaging agents and ribonucleotide reductase inhibitors, such as UV or HU (Fig. 3), which stall DNA polymerase. We observed that mec1-21 rad52 (YB347) and mec1-21 rad9 (YB331), defective in recombinational repair and G2 checkpoint function, respectively, exhibited a synergistic increase in UV sensitivity compared to the single mutants. To verify that the interaction between mec1-21 and single gene deletions was synergistic, we performed mathematical analysis as described by Brendel and Haynes21 (Suppl. Table 1). mec1-21 chk1 (YB337) double mutant was more UV sensitive than mec1-21 at all levels of UV exposure (Fig. 3). mec1-21 rad52 was more UV sensitive than mec1-Δ sml1 (YB327) and modestly more resistant than mec1-Δ sml1 rad52. The sml1 (YB326) and chk1 (YB335) mutants were as UV resistant as wild type. We also observed a synergistic increase in HU sensitivity in the mec1-21 rad9 mutant, compared to the single mutants (Fig. 5). After exposure to 100 mM HU in YPD for 1 hr, mec1-21 and rad52 mutants exhibited (85.1 ± 4)% and (99 ± 1)% survival, respectively, while the mec1-21 rad52 double mutant exhibited only (42.1 ± 0.3)% survival. These data are consistent with

Figure 2. Heteroallelic recombination in mec1-21 is exhibited by a colony sector assay in diploid strains. Red sectors are Ade- while white sectors are Ade+ on YPD (rich) medium. ADE2 result from recombination between ade2a and ade2-n. Colonies were photographed after a ten-day incubation. Each panel represents a different genotype. (A) Wild type (YB348). (B) mec1-21 (YB325). (C) rad9 (YB350). (D) mec1-21 rad9 (YB345).

©




previous observations that mec1-21 chk1 mutants were synergistically more sensitive to X rays, compared to single mutants. UV exposure triggers G2 arrest and Pds1 activation in mec1-21. Since X-ray exposure triggers G2 arrest in mec1-21, we determined whether UV exposure triggers G2 arrest in mec1-21, by determining whether irradiated cells would form microcolonies or dumb-bell cells, indicative of G2 arrest.22 Cells inoculated on YPD plates were exposed to either 60 J/m2 UV or 3 krads X rays and incubated at 30°C for five hours (Fig. 4). 71% and 83% of the mec1-21 cells after UV and X-ray exposure, respectively, formed either large dumb-bell

Cell Cycle

2421


Table 3 Rates of spontaneous translocations and heteroallelic recombination events in mec1 mutants Genotypea

Translocation (x108)b

Ratioc

Heteroallelic (x106)b

YB348

MEC1

YB325

mec1-21

3.0 ± 0.8

1

0.9 ± 0.02

1

68 ± 16

23

9.1 ± 1.9

0.1

YB345

mec1-21rad9:URA3

9 ± 1

6.4

3.8 ± 1.0

4.2

YB350

rad9:URA3

21 ± 5

7.1

0.7 ± 0.1

0.8

Strain

Ratioc

©

20

08

LA

ND

ES

BIO

SC

IEN CE

.D

ON

OT D


IST RIB

UT E

.

aFor complete genotype, see Table 1. bRate, number of events per cell division; n ≥ 3; cRatio, rate of recombination in mutant/rate of recombination in wild type.

Figure 3. Sensitivity to UV and HU of wild type, chk1, mec1-21, rad9, mec1-Δ sml1 and rad52 single and double haploid mutants. Survival curves are the mean of three independent experiments. Left top panel is the UV survival curve for wild type (black diamond, YB163), mec1-21 (open square, YB311), rad9 (open triangle, YB147), mec1-21 chk1 (black triangle, YB337), and mec1-21 rad9 (black square, YB331). The right top panel is the UV survival for wild type (black diamond, YB163), rad52 (black triangle, YB328), mec1-21 (open square, YB311), mec1-Δ sml1 (open diamond, YB327), mec1-21 rad52 (YB347, black circle), and mec1-Δ sml1 rad52 (“X”). See Table 1 for full genotypes. Wild type, chk1 and sml1 strains show identical UV survival. Symbols may obscure standard deviation. Bottom panel shows yeast growth after 10 μl aliquots from sequential serial dilutions were applied to YPD + 50 mM HU (left) and YPD (right). Cell number exponentially decreases left to right. 2422

Cell Cycle

2008; Vol. 7 Issue 15

IST RIB OT D

ON

Figure 4. Photomicroscopy of haploid mec1-21 and haploid mec1-Δ cells after exposure to UV. Log phase cells were inoculated on YPD and photographed five hours after exposure to 0 or 60 J/m2 UV. (A) mec1-21 (YB319) after no UV exposure. (B) mec1-21 (YB319) after UV exposure. (C) mec1-Δ (YB322) after no UV exposure. (D) mec1-Δ (YB322) after UV exposure.

20

08

LA

ND

ES

BIO

SC

IEN CE

.D

cells or four budded cells, typical of G2 arrested cells.22 mec1-Δ mutants did not form dumb-bell cells, but instead formed microcolonies. After 10 hours of incubation, 43% of the arrested mec1-21 cells resumed growth and formed visible colonies. These data indicate that radiation exposure can trigger G2 arrest in mec1-21, and is consisted with the FACs analysis previously performed.16 We had previously determined that DSB-associated G2 arrest in mec1-21 correlated with Pds1 activation but not Rad53 activation.16 We also determined whether Rad53 and Pds1 were activated after UV (90 J/m2) exposure in mec1-21 and wild-type cells, using western blots (Fig. 5). Thirty minutes after UV exposure, we found that both Rad53 and Pds1 were activated in wild-type cells, and we measured the ratio of activated protein to non-activated protein by scanning densitometry. The ratio of P-Rad53 to Rad53 was 0.8 and 0.2 for wild type and mec1-21, respectively (N = 2). Pds1HA23 appeared as a doublet, with a minor (phosphorylated) form migrating slower than the major form (Fig. 5B). After UV exposure, Pds1 activation resulted in a shift from the major to the minor form. The ratio of P-Pds1 to Pds1 after UV exposure was 3.6 and 2.8 for wild type and mec1-21 cells, respectively. No Pds1 activation was observed in mec1-Δ cells after radiation exposure (data not shown). These data support observations that G2 arrest can be triggered in mec1-21 after UV as well as X-ray exposure, and that this correlates with Pds1 activation. Pre-arresting mec1 rad9 cells with nocodazole partially suppresses UV sensitivity. If defective G2 arrest contributes to the UV sensitivity of mec1-21 rad9, we expected that G2 mec1-21 rad9 cells would exhibit more UV resistance than log phase cells. Wild-type (YB163) G2 cells were UV resistant (100% survival) after exposure to 20 J/m2 and 60 J/m2. We therefore compared the UV sensitivities of mec1-21

©


UT E

.



Figure 5. Rad53 and Pds1 activation following DNA damage exposure in mec1-21 (YB311) and in wild-type (YB163) cells. Arrows indicate the positions of P-Rad53 and P-Pds1. 10 μg protein are loaded per lane. (A) Rad53 after wild-type and mec1-21 cells were exposed to 90 J/m2 UV or 6 krads X rays. X-ray-associated Rad53 phosphorylation was previously published (16). (B) Pds1 activation after wild-type and mec1-21 cells were exposed to 90 J/m2 UV or 6 krads X rays, X-ray-associated Rad53 phosphorylation was previously published.16

rad9, rad9 and mec1-21 in log phase and in G2 cells after exposure to 20 J/m2 and 60 J/m2 (4). We observed that mec1-21 rad9, mec1-21 and rad9 G2 cells were more UV resistant than those in log phase. mec1-21 and rad9 G2 cells were essentially UV resistant after exposure to 20 J/m2, but still UV sensitive after exposure to 60 J/m2. The UV sensitivity of mec1-21 rad9 G2 cells was partially suppressed after exposure to 20 J/m2 (p < 0.05) and 60 J/m2. The data is consistent with previous studies that UV sensitivity of mec1-21 and rad9 cells can be partially suppressed by arresting cells in G2 before irradia-

Cell Cycle

2423


Table 4 UV sensitivities of log phase and G2 arrested mec1-21 rad9, mec1-21 and rad9 cells Genotype (Strain)1 % Survival2 20 J/m2 60 J/m2 mec1-21 rad9 (YB344) Log phase

41 ± 17

2.5 ± 1.5

G2

77 ± 15

9.3 ± 6

1.9

4.1

Log phase

45 ± 9

15 ± 5

G2

96 ± 7

60 ± 10

2.1

4

73 ± 6

45 ± 7

100 ± 0.7

57 ± 15

1.4

1.3

mec1-21 (YB312)

G2

1For full genotype, see Table 1. 2% survival = CFU irradiated/CFU non-irradiated x 100%, N > 2. Ratio

= % survival of G2 cells/% survival of non-irradiated.

ON

tion.24,25 Although RAD9 has multiple functions, these data indicate that triggering G2 arrest is one function that confers UV resistance in mec1-21.

Discussion

20

08

LA

ND

ES

BIO

SC

IEN CE

.D

Specific ATR mutations confer higher frequencies of genomic instability and homologous recombination, including higher frequencies of SCE.2-4 Here, we observed that mec1-21, which results from a missense mutation in the ATR yeast homolog,10 exhibits higher rates of spontaneous SCE, heteroallelic recombination, and homology-directed translocations, while exhibiting more UV resistance compared to the null mutant. Having previously observed that mec1-21 cells can still trigger G2 arrest after exposure to X rays and activate Pds1 (securin),16 we determined whether G2 checkpoint functions contribute to the spontaneous recombination and repair phenotypes of mec1-21 after exposure to DNA damaging agents that stall DNA replication. We observed that the spontaneous hyperrecombination in mec1-21 requires G2 checkpoint genes, while the HU and UV resistance in mec1-21 depends on both G2 checkpoint functions and on homologous recombination. Based on these results, we suggest that more homologous recombination occurs in ATR mutants when some G2 checkpoint functions are retained. We speculate that replication fork collapse or incomplete DNA replication in S phase checkpoint mutants generate double-strand breaks, which can signal the RAD9-mediated checkpoint pathway, and allow time for recombinational repair. Unlike the G2 checkpoint rad9 mutant, which exhibits higher levels of ectopic recombination but not higher levels of sister chromatid exchange or homolog recombination,26 we observed that all types of spontaneous homologous recombination were increased in mec1-21, compared to wild type. Thus, RAD9 may facilitate all types of homologous recombination when recombinogenic lesions are generated during DNA replication. These studies were based on comparing the recombination phenotypes of mec1-21 single and mec1-21 rad9, chk1 and pds1 double mutants. RAD9, PDS1 and CHK1 have been suggested to have

©


Ratio:

UT E

Log phase

.

rad9 (YB347)

IST RIB

Ratio:

OT D

Ratio:

additional roles in DNA repair besides being active at the G2 checkpoint. RAD9 is required for DNA damage tolerance mechanisms,27 for the viability of rad27 mutants defective in the Flap endonuclease,28 and for the maintenance of YACs that contain only one ARS or origin of replication.29 Thus, multiple RAD9-mediated functions may facilitate spontaneous recombination events in mec1-21 that result from S phase defects. Multiple RAD9-mediated functions may also facilitate DNA repair in mec1-21. However, because G2 arrested mec1-21 rad9 cells exhibit more UV resistance than non-synchronized mec1-21 rad9 cells, we suggest that one function of RAD9 that confers UV resistance is by triggering G2 arrest. This is particularly true of mec1-21 rad9 cells exposed to low doses of UV. mec1-21 cells are deficient in maintaining the G2 arrest after UV exposure,24 thus, we speculate that at low levels of UV exposure, pre-arresting cells in G2 allows for repair of most UV-induced lesions, while at higher doses G2 arrest cannot be maintained sufficiently long enough to allow for repair of all UV-induced DNA lesions. The RAD9 pathway for G2 arrest branches into the RAD53 and CHK1 pathways, both of which are required for G2 arrest in cdc13 mutants that delay replication of telomeres.30,31 Chk1 also facilitates replication fork stability at the S phase checkpoint32 and activates Pds1 at the G2 checkpoint. chk1 mutants tolerate persistent single-strand breaks in DNA.33 Our results extend these studies by suggesting that CHK1 is required for homologous recombination triggered by S phase checkpoint defects. Since Pds1 activation in G2 is CHK1-dependent and mec1-21 pds1 mutants are defective in radiation-associated G2 arrest, we do not fully understand why mec1-21 pds1 mutants still exhibit a modest hyper-recombination phenotype. CHK1 may thus have other functions that facilitate homologous recombination. Homologous recombination phenotypes have been previously determined for mec1-Δ mutants10 and esr1-1(mec1) mutants.6 Interestingly, esr1-1 does not exhibit higher rates of spontaneous intragenic (allelic) recombination, compared to wild type,6 while both esr1-1 and mec1-Δ mutants exhibit higher rates of intergenic recombination, compared to mec1-21. However, both of these mutants require an additional mutation in SML1, which encodes an inhibitor of ribonucleotide reductase,19,34 for viability. Further studies are necessary to characterize the homologous recombination phenotypes of hypomorphic mec1 mutants, and studies are now in progress to determine whether higher dNTP levels can suppress recombination in mec1-21. In summary, mec1-21 exhibits more spontaneous recombination between homologous sequences than does wild type. It would be interesting to identify ATR alleles that confer genetic instability phenotypes resulting from homologous hyper-recombination, and which checkpoint functions are retained in such ATR cell lines.

2424

Materials and Methods Media and yeast strains. Standard media for the culture of yeast, SC (synthetic complete, dextrose), SC-HIS (SC lacking histidine), SC-LEU (SC lacking leucine), SC-TRP (SC lacking tryptophan), SC-URA (SC lacking uracil), YP (yeast extract, peptone), and YPD (YP, dextrose), are described by Burke et al.,35 YPL medium contains YP with 2% lactate (pH 5.8); YPGal medium contains YP medium with 2% ultra-pure galactose (Sigma, St Louis, MO). YPD(HU)

Cell Cycle

2008; Vol. 7 Issue 15

OT D

IST RIB

UT E

.

hrs at 30°C degrees. Arrested cells were visualized in the light microscope; approximately 90% of cells were G2 arrested. Microcolony assay for demonstrating cell cycle arrest following DNA damage exposure. We used a microcolony assay to determine whether checkpoint mutants fail to arrest in G2 after exposure to DNA damaging agents.22 Haploid cells were grown to logarithmic phase in YPD liquid medium, and were then plated on solid medium, and exposed to 60 J/m2 UV or 3 krads X rays. Glass cover slips were placed over a specific area inoculated. Plates were incubated at 30°C, then observed with a light microscope after 5, 10 and 20 hrs. Mathematical analysis of UV survival curves. We determined the UV resistance of mec1-21 single and double mutants using stationary phase and log phase cell cultures as previously performed for rad mutants.44 UV resistance conferred by two genes is synergistic if surviving fraction (-ln S) of the double mutant after UV exposure is greater than additive with respect to the single mutants.44 This can be calculated using the formula -ln Sdouble mutant = -ln Smutant 1 + -ln S mutant 2 - (-ln Swild type).21 Western blots. We performed western blots to determine whether Rad53 and Pds1 were phosphorylated in wild type and mec1-21 cells after exposure to radiation, as previously described.16 Protein extracts from yeast cells were prepared as previously described by Foiani et al.,45 separated either on 10% acrylamide/0.066% bis-acrylamide gels for Pds1 detection, or on 10% acrylamide/0.266% bis-acrylamide gels for Rad53 detection, and transferred to nitrocellulose membranes. Rad53 and HA-Pds1p23 were detected by Western blotting using goat anti-Rad53 (yC-19, Santa Cruz) and mouse anti-HA (16B12, Covance, Madison, WI) antibodies respectively. The secondary antibodies used were anti-goat IgG-HRP and antimouse IgG-HRP (Santa Cruz). Acknowledgements

This work was supported by grant CA70105 from the National Cancer Institute and a grant No. 1-FY01-629 from the March of Dimes. We thank Tom Petes for mec1-21, R. Rothstein for mec1 and sml1 deletion strains, and O. Cohen-Fix for plasmid containing Pds1-HA. We thank C. Cera for carefully reading this manuscript. Note

ES

BIO

SC

IEN CE

.D

ON

contains YPD medium supplemented with 50 mM hydroxyurea (HU). YP(A)D contains YPD with 80 mg/L adenine. Relevant yeast strains are listed in Table 1. The mec1-21 strain YA197 (Y620),15 and the YA184 and YA185 strains used to PCR amplify sml1::URA3 and mec1::TRP1,7 respectively, are derived from W303; all other strains are of the S288c background. Strains used to measure SCE contain two overlapping his3 fragments, positioned in tandem at trp1, and were derived from YB163.36 Diploid strains were used to measure translocations that were derived from a cross of one haploid (YB109) that contains the his3 fragments on one copy of chromosomes II and IV, and another which did not contain the his3 fragments (YA102).26 To measure heteroallelic recombination, we replaced the ade2-101 alleles in YB109 and YA102 with ade2-n (YB318) and ade2-a (YB315), respectively, by two-step gene replacement using the plasmid pKH9.37 Heteroallelic recombination was measured by selecting for Ade+ recombinants. mec1 checkpoint mutants that measure spontaneous and DNA damage-associated recombination contain mec1-21 missense mutation. The original MATa mec1-21 strain (Y620) is derived from W303.8 We backcrossed Y620 ten times with strains in the S288c background [YB163, FY251,36 and YB315] to generate meiotic segregants YB316 and YB314, which contain the standard auxotrophic markers but do not contain his3 recombinational substrates, and YB312, which does contain recombinational substrates to measure SCE. To measure translocations and heteroallelic recombination in mec1 and rad strains, mutations were introduced into two haploids by either genetic crosses or by one-step gene replacement,38 one haploid contained the his3 recombination substrates and ade2-n (YB318) and another (YB315) contained ade2-a but did not contain the recombination substrates. YB318 was crossed with YB313 to generate the MATα-inc ade2-n mec1-21 meiotic segregant that contains the GAL1::his3-Δ5' and trp1::his3-Δ3'. YB325 is a homozygous mec1-21 diploid that was then used to measure translocations and heteroallelic recombination. Additional rad and checkpoint mutants were made by either onestep gene disruption38 or by genetic crosses and then screening the phenotype of the appropriate meiotic segregant. The rad52::TRP1 and rad9::LEU2 disruptions were made by selecting for Trp+, and Leu+ transformants using plasmids pSM239 and pTW301,40 respectively. The primer pairs used to amplify the rad52::KanMX and chk1::KanMX were 5' GATTCAACAACTCCCTTGGCGTC3' and 5'TACGACACATGGAGGAAAGAAAAAC3', 5 ' C A AC C TC A AC C A A ATAC TATG T TC C 3 ' and 5'CTGTGGAAGAAAGAAGAAACTTGAG3', respectively. All gene disruptions were confirmed by PCR. Determining rates of spontaneous recombination. The rates (events per cell division) of spontaneous, mitotic events that generate either SCE, hetroallelic recombination, or translocations were determined by the method of the median,41 as executed by Esposito et al.,42 using 11 independent colonies for each rate calculation. For measuring rates of heteroallelic recombination, we obtained colonies from cells that were inoculated on YP(A)D medium, so that there was no growth selection for Ade+ recombinants. At least three independent rate calculations were done for each strain, and statistical significance was determined by the Mann-Whitney U-test.43 Cell cycle arrest in mec1-21. Log phase cells (A600 = 0.5–1) were arrested in G2 by adding nocodazole (15 μg/ml) and incubating for 3

Supplementary materials can be found at: www.landesbioscience.com/supplement/SunCC7-15-Sup.pdf

ND

LA

08

20

©




References 1. Shiloh Y. ATM and related protein kinases: safeguarding genome integrity. Nature Reviews 2003; 3:155-68. 2. O’Driscoll M, Ruiz-Perez V, Woods GC, Jeggo PA. Goodship JA. A splicing mutation affecting expression of ataxia telangiectasia and Rad3-related protein (ATR) results in Seckel syndrome. Nat Genet 2003; 33:497-501. 3. Casper AM, Durkin SG, Arlt MF, Glover TW. Chromosomal instability at common fragile sies in Seckel syndrome. Am J Hum Genet 2004; 75:654-60. 4. Syrrou M, Gergiou I, Paschopoulos M, Lolis D. Seckel syndrome in a family with three affected children and hematological manifestations associated with chromosome instability Genet Couns 1995; 6:37-41. 5. Glover TW, Stein CK. Induction of sister chromatid exchanges at common fragile sites. Am J Hum Genet 1987; 41:882-90. 6. Kato R, Ogawa H. An essential gene, ESR1, is required for mitotic cell growth, DNA repair and meiotic recombination in Saccharomyces cerevisiae. Nucleic Acids Res 1994; 22:3104-12. 7. Zhao XE, Muller EG, Rothstein R. A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools. Mol Cell 1998; 2:329-40. 8. Sanchez Y, Desany BA, Jones WJ, Liu Q, Wang B, Elledge SJ. Regulation of RAD53 by the ATM-like kinases MEC1 and TEL1 in yeast cell cycle checkpoint pathways. Science 1996; 271:357-60. 9. Myung K, Chen C, Kolodner RD. Multiple pathways cooperate in the suppression of genome instability in Saccharomyces cerevisiae. Nature 2001; 411:1073-6.

Cell Cycle

2425

OT D

IST RIB

UT E

.

40. Weinert TA, Hartwell LH. Characterization of the RAD9 gene of Saccharomyces cerevisiae and evidence that it acts posttranslationally in cell cycle arrest after DNA damage. Mol Cell Biol 1990; 10:6554-64. 41. Lea DE, Coulson CA. The distribution of the numbers of mutants in bacterial populations. J Genet 1949; 49:264-84. 42. Esposito MS, Maleas DT, Bjornstad KA, Bruschi CV. Simultaneous detection of changes in chromosome number, gene conversion and intergenic recombination during mitosis of Saccharomyces cerevisiae. Curr Genet 1982; 6:5-11. 43. Zar JH. Two sample hypothesis. In: Savely S, ed. Biostatistical Analysis. Englewood Cliffs, NJ: Prentice Hall 1996; 147-55. 44. Haynes RH, Kunz BA. DNA repair and mutagenesis in yeast. In: Strathern J, Jones E, Broach J, eds. The Molecular Biology of the Yeast Saccharomyces I. New York: Cold Spring Harbor Press 1980; 371-415. 45. Foiani M, Marini F, Gamba D, Lucchini G, Plevani P. The B subunit of the DNA polymerase α-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication. Mol Cell Biol 1994; 14:923-33.

20

08

LA

ND

ES

BIO

SC

IEN CE

.D

ON

10. Craven R, Greenwell P, Dominska M, Petes T. Regulation of genome stability by TEL1 and MEC1, yeast homologs of the mammalian ATM and ATR genes. Genetics 2002; 161:493-507. 11. Cha RS, Kleckner N. ATR homolog Mec1 promotes fork progression, thus averting breaks in replication slow zones. Science 2002; 297:602-6. 12. Gasch AP, Huang M, Metzner S, Botstein D, Elledge SJ, Brown PO. Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p. Mol Biol Cell 2001; 12:2987-3003. 13. Sanchez Y, Bachant YJ, Wang H, Hu F, Liu D, Tetzlaff M, Elledge SJ. Control of the DNA damage checkpoint by Chk1 and Rad53 protein kinases through distinct mechanisms. Science 1999; 286:1166-71. 14. Merrill BJ, Holm C. Requirement for recombinational repair in Saccharomyces cerevisiae is caused by DNA replication defects of mec1 mutants. Genetics 1999; 153:595-605. 15. Desany BA, Alcabasas AA, Bachant JB, Elledge SJ. Recovery from DNA replicational stress is the essential function of the S-phase checkpoint pathway. Genes Dev 1998; 12:2956-70. 16. Sun M, Fasullo M. Activation of the budding yeast securing Pds1 but not Rad53 correlates with double-strand break-associated G2/M cell cycle arrest in a mec1 hypomorphic mutant. Cell Cycle 2007; 6:1896-902. 17. Fasullo MT, Davis RW. Recombination substrates designed to study recombination between unique and repetitive sequences in vivo. Proc Natl Acad Sci USA 1987; 84:6215-9. 18. Bai Y, Symington LS. A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev 1996; 10:2025-37. 19. Zhao X, Georgieva B, Chabes A, Domkin V, Ippel JH, Schleucher J, Wijmenga S, Thelander L, Rothstein R. Mutational and structural analyses of the ribonucleotide reductase inhibitor Sml1 define its Rnr1 interaction domain whose inactivation allows suppression of mec1 and rad53 lethality. Mol Cell Biol 2000; 20:9076-83. 20. Lemoine F, Degtyareva N, Lobachev K, Petes TD. Chromosomal translocations in yeast induced by low levels of DNA polymerase: a model for chromosome fragile sites. Cell 2005; 120:587-96. 21. Brendel M, Haynes RH. Interactions among genes controlling sensitivity to radiation and alkylation in yeast. Mol Gen Genet 1973; 125:197-216. 22. Weinert TA, Hartwell LH. The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae. Science 1988; 241:317-22. 23. Cohen-Fix O, Koshland D. The anaphase inhibitor of Saccharomyces cerevisiae Pds1p is a target of the DNA damage checkpoint pathway. Proc Natl Acad Sci USA 1997; 94:14361-6. 24. Scott KL, Plon SE. Loss of Sin3/Rpd3 histone deacetylase restores the DNA damage response in checkpoint-deficient strains of Saccharomyces cerevisiae. Mol Cell Biol 2003; 23:4522-31. 25. Al-Moghrabi NM, Al-Sharif IS, Aboussekhra A. The Saccharomyces cerevisiae RAD9 cell cycle checkpoint gene is required for optimal repair of UV-induced pyrimidine dimers in both G(1) and G(2)/M phases of the cell cycle. Nucleic Acids Res 2001; 29:2020-5. 26. Fasullo MT, Bennett T, AhChing P, Koudelik J. The Saccharomyces cerevisiae RAD9 checkpoint reduces the DNA damage-associated stimulation of directed reciprocal translocations. Mol Cell Biol 1998; 18:1190-2000. 27. Paulovich AG, Armour CD, Hartwell LH. The Saccharomyces cerevisiae RAD9, RAD17, RAD24 and MEC3 genes are required for tolerating irreparable, ultraviolet-induced DNA damage. Genetics 1998; 150:75-93. 28. Vallen EA, Cross FR. Mutations in RAD27 define a potential link between G1 cyclins and DNA replication. Mol Cell Biol 1995; 15:4291-302. 29. Van Brabant AJ, Buchanan CD, Charboneau E, Fangman WL, Brewer BJ. An origin-deficient yeast artificial chromosome triggers a cell cycle checkpoint. Mol Cell 2001; 7:705-13. 30. Garvik B, Carson M, Hartwell L. Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint. Mol Cell Biol 1995; 15:6128-38. 31. Blankley RT, Lydall D. A domain of Rad9 specifically required for activation of Chk1 in budding yeast. J Cell Sci 2004; 117:601-8. 32. Schollaert KL, Poisson JM, Searle JS, Schwanekamp JA, Tomlinson CR, Sanchez Y. A role for Saccharomyces cerevisiae Chk1p in the response to replication blocks. Mol Biol Cell 2004; 15:4051-63. 33. Karrumbati A, Wilson TE. Abrogation of the Chk1-Pds1 checkpoint leads to tolerance of persistent single-strand breaks in Saccharomyces cerevisiae. Genetics 2005; 169:1833-44. 34. Chabes A, Georgieva B, Domkin V, Zhao X, Rothstein R, Thelander L. Survival of DNA damage in yeast directly depends on increased dNTP levels allowed by relaxed feedback inhibition of ribonucleotide reductase. Cell 2003; 112:391-401. 35. Burke D, Dawson D, Stearns T. Methods in yeast genetics. In: A Cold Spring Harbor Laboratory Course Manual. New York: Cold Spring Harbor Press 2000; 171-81. 36. Fasullo MT, Giallanza P, Bennett T, Cera C, Dong Z. Saccharomyces cerevisiae rad51 mutants are defective in DNA damage-stimulated sister chromatid exchange but exhibit increased rates of homology-directed translocations. Genetics 2001; 158:959-72. 37. Huang KN, Symington LS. Mutation of the gene encoding protein kinase C 1 stimulates mitotic recombination in Saccharomyces cerevisiae. Mol Cell Biol 1994; 14:6039-45. 38. Rothstein RJ. One-step gene disruption in yeast. Methods Enzymol 1983; 101:202-11. 39. Schild D, Calderon IL, Contropoulou R, Mortimer RK. Cloning of yeast recombination repair genes and evidence that several are non-essential genes In: Friedberg EC and Bridges BA, eds. Cellular Responses to DNA Damage. New York: Alan R. Liss Inc 1980; 17-27.

©



2426

Cell Cycle

2008; Vol. 7 Issue 15