Cell Surface Polypeptide CshA Mediates Binding of Streptococcus ...

Download PDF
2 downloads 0 Views 263KB Size Report
Comment
University, Fort Collins, Colo.) were derived from the .... Antiserum to SpaP (from K. W. Knox, University of Sydney, Sydney,. New South Wales, Australia) reacted ...
INFECTION AND IMMUNITY, Oct. 1996, p. 4204–4210 0019-9567/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 64, No. 10

Cell Surface Polypeptide CshA Mediates Binding of Streptococcus gordonii to Other Oral Bacteria and to Immobilized Fibronectin RODERICK MCNAB,1 ANN R. HOLMES,1 JOANNE M. CLARKE,1 GERALD W. TANNOCK,2 1 AND HOWARD F. JENKINSON * Department of Oral Biology and Oral Pathology1 and Department of Microbiology,2 University of Otago, Dunedin, New Zealand Received 15 April 1996/Returned for modification 12 June 1996/Accepted 23 July 1996

Isogenic mutants of Streptococcus gordonii DL1 (Challis) in which the genes encoding high-molecular-mass cell surface polypeptides CshA and/or CshB were inactivated were deficient in binding to four strains of Actinomyces naeslundii and two strains of Streptococcus oralis. Lactose-sensitive interactions of S. gordonii with A. naeslundii ATCC 12104 and PK606 were associated with expression of cshA but not of cshB. Lactoseinsensitive interactions of S. gordonii with A. naeslundii T14V and WVU627, and with S. oralis C104 and 34, were dependent on expression of cshA and cshB. S. gordonii DL1 cells bound to immobilized human fibronectin (Fn), but not to soluble Fn, in a dose-dependent manner, and binding was noninhibitable by heparin. S. gordonii cshA and cshB mutants were also deficient in binding to immobilized human Fn. Antibodies to an NH2-terminal nonrepetitive region (amino acid residues 42 to 886) of recombinant CshA inhibited binding of S. gordonii DL1 cells to A. naeslundii T14V and PK606 and to immobilized Fn. Conversely, antibodies to an amino acid repeat block segment of the COOH-terminal domain (amino acid residues 2026 to 2508) were not inhibitory to adherence. Assays using CshA-specific antibodies revealed that surface expression of CshA was reduced in cshB mutants. The results suggest that CshA acts as a multifunctional adhesin in S. gordonii and that major adhesion-mediating sequences are specified within the nonrepetitive NH2-terminal region of the polypeptide. Porphyromonas gingivalis (27). A second family of highly similar surface lipoproteins with an approximate molecular weight of 35,000 (termed the LraI family [18]) is present in oral streptococci. These proteins are structurally and immunologically unrelated to antigen I/II proteins and include FimA, associated with adherence of Streptococcus parasanguis to salivary pellicle (12) and fibrin (5); SsaB, associated with binding of S. sanguis to salivary glycoprotein (14); and ScaA, a putative adhesin mediating coaggregation of S. gordonii with Actinomyces naeslundii (1, 24). Cell surface proteins CshA (predicted molecular mass, 259 kDa) and CshB (approximate molecular mass, 245 kDa) of S. gordonii are antigenically related polypeptides encoded by genes at separate chromosomal loci (35). These polypeptides have been implicated in the determination of cell surface hydrophobicity and in coaggregation interactions with A. naeslundii T14V (35). CshA precursor (2,508 amino acid residues) is composed of four regions; (i) a 41-amino-acid residue leader peptide directing the export of CshA, (ii) a nonrepetitive region (amino acid residues 42 to 878) predicted to be predominantly a-helical, (iii) an extensive amino acid repeat region (amino acid residues 879 to 2417) representing approximately 60% of the mature polypeptide, and (iv) a COOH-terminal domain responsible for cell wall anchoring. The presence of amino acid repeat blocks, a-helical structure, and a wall anchor domain presents a molecular architecture typical of many cell surface polypeptides produced by gram-positive bacteria (23). There are, however, no significant sequence similarities, or antigenic cross-reactivities, between CshA and members of the antigen I/II family of adhesins. Gene disruption experiments have indicated that CshA in S. gordonii may be more important than CshB for the determination of cell surface hydrophobicity and for coaggregation reactions with A. naeslundii (35). How-

The sanguis group streptococci (including Streptococcus sanguis, Streptococcus oralis, and Streptococcus gordonii) are found at most sites in the human oral cavity and are numerically abundant in dental plaque (13). Colonization and persistence of streptococci in the oral cavity is thought to be dependent on the ability of cells to adhere to oral surfaces including epithelia, salivary pellicle, and other bacteria in plaque (25, 31). These interactions involve both protein (lectin)-carbohydrate and protein-protein recognitions (25). Adherence of bacteria to tissue and serum components may be involved in the genesis of nonoral infections by these organisms, such as infective endocarditis (29). S. gordonii is found at most sites in the oral cavity (13) and demonstrates a range of adherence reactions (19). These include binding to salivary components present either in fluid phase or in pellicle (28), to other oral bacteria, notably members of the genus Actinomyces (6, 25), and to the extracellular matrix glycoprotein fibronectin (Fn) (30). Streptococci possess multiple adhesins (15), and it is now evident that some of these adhesins have multiple binding functions. For example, M proteins of Streptococcus pyogenes may bind human serum albumin, factor H, immunoglobulin G, fibrinogen, and Fn (8, 38). In oral streptococci, members of the antigen I/II family of cell surface adhesins demonstrate some structural similarities to M protein (4). The antigen I/II adhesins SspA and SspB in S. gordonii are responsible, at least in part, for human salivary agglutinin glycoprotein (SAG)-mediated aggregation of cells and adherence of cells to SAG-coated surfaces (10, 11). The antigen I/II proteins also mediate coaggregation reactions with oral actinomyces (10, 21) and with * Corresponding author. Mailing address: Department of Oral Biology and Oral Pathology, University of Otago, P.O. Box 647, Dunedin, New Zealand. Phone: (64) 3 479 7080. Fax: (64) 3 479 0673. Electronic mail address: [email protected]. 4204

VOL. 64, 1996

CshA INTERACTIONS WITH ORAL BACTERIA AND FIBRONECTIN

4205

FIG. 1. Effect of CshA antibodies on S. gordonii adherence. (A and B) Inhibition of attachment of A. naeslundii to immobilized S. gordonii cells. Streptococcal cells (2 3 107 per well) were immobilized in microtiter plate wells and incubated with preimmune serum or CshA polypeptide antisera, and the attachment of radioactively labeled actinomyces cells (input of 107 cells per well) was determined as described in Materials and Methods. Results are presented as percent inhibition of attachment in the presence of immune serum. In the presence of preimmune serum (1:30 dilution), 2.2 3 106 cells of A. naeslundii PK606 or 4.15 3 106 cells of A. naeslundii T14V bound to S. gordonii DL1. (C) Inhibition of streptococcal adherence to immobilized Fn. Radioactively labeled streptococcal cells (2 3 107 per well) were mixed with immune or preimmune serum (diluted appropriately), and portions were applied to BSA-blocked wells or wells coated with Fn (1 mg/ml). Results are presented as percent inhibition of adherence in the presence of immune serum compared with preimmune serum. In the presence of preimmune serum (1:30 dilution), 6.6 3 106 cells of DL1 bound to Fn. At the top is a schematic representation of CshA precursor polypeptide showing the segments (NCshA and CCshA) to which antibodies were raised. L, leader peptide; NR, nonrepetitive region; R, amino acid repeat block region; A, wall anchor domain; aa, amino acids.

ever, expression of both cshA and cshB genes is essential for streptococcal colonization of the murine oral cavity (35). In this study, we have investigated further and defined the role of CshA in adhesive and colonization-related properties of S. gordonii. In addition to being involved in intergeneric coaggregation reactions with a number of different A. naeslundii strains, CshA (and to a lesser extent CshB) appears to mediate adherence of S. gordonii to S. oralis and to immobilized human Fn. Furthermore, while the amino acid repeat block region of CshA is strongly implicated in conferring the property of cell surface hydrophobicity (34), it appears that the NH2-terminal nonrepetitive region carries adhesion sequences necessary for binding of S. gordonii to other oral bacteria and to Fn. MATERIALS AND METHODS Bacteria and growth conditions. S. gordonii DL1 (Challis) and isogenic csh mutant strains used in this study have been previously described (35). The partner bacterial strains for coadherence tests were selected from a range of bacterial coaggregation groups based on visual coaggregation scores (7) and included A. naeslundii ATCC 12104, WVU627, T14V, and PK606, S. oralis C104, and S. oralis 34 (previously designated S. sanguis 34). Streptococci and actinomycetes were grown on TSBY agar (21) in a GasPak System (BBL Microbiology Systems, Cockeysville, Md.). Liquid cultures were grown in BHY medium or TY-glucose medium (21) at 378C without shaking in screw-cap tubes or bottles. Erythromycin (1 mg/ml) and/or chloramphenicol (5 mg/ml) was incorporated into S. gordonii growth media where required. Escherichia coli BL21 [F2 ompT (lon) hsdSB (rB2 mB2)] was grown in 23 YT-G medium (containing, per liter, 16 g of tryptone, 10 g of yeast extract, 5 g of NaCl, and 20 g of glucose [pH 7.0]) supplemented with 100 mg of ampicillin per ml where required. DNA manipulations. Routine molecular biology techniques were performed as specified by Sambrook et al. (37). Plasmid DNA was isolated from E. coli by using Wizard Minipreps (Promega Corp., Madison, Wis.). Chromosomal DNA was purified from S. gordonii as described previously (17). DNA restriction and modifying enzymes (from New England Biolabs Inc., Beverly, Mass.) were used under conditions recommended by the manufacturer. PCR amplification. Synthetic oligonucleotides (DNA Express; Colorado State University, Fort Collins, Colo.) were derived from the nucleotide sequence of cshA (GenBank accession number X65164). To facilitate cloning of PCR prod-

ucts into the glutathione S-transferase (GST) fusion vector pGEX-5X-3 (Pharmacia Biotech, Uppsala, Sweden), the nucleotide sequence at the 59 end of each primer was modified to introduce restriction sites (underlined below) not present in the amplified DNA. PCR primer pair 1 was designed to amplify DNA encoding the nonrepetitive domain of CshA (amino acid residues 42 to 886 [Fig. 1]) and comprised coding-strand primer (designated DET) 59TTACCCGGGATG AAACAAGCGCTTCTGGTG39 and complementary-strand primer (designated FKP) 59AAAAGTCGACTTAGGTTTGAAGGTCACTTGGCC39. PCR primer pair 2 was designed to amplify DNA encoding a portion of the amino acid repeat block region of CshA (amino acid residues 1456 to 2263) and comprised codingstrand primer (designated FPA) 59ACTCCCGGGCATTCCCAGCTGATTCG ACT39 and complementary-strand primer (designated STV) 59AAAGGTCGA CGGAACTGTACTATCGATATGT39. PCR reaction mixtures (0.1 ml) contained S. gordonii DL1 DNA (10 ng), 2.5 U of native Pfu DNA polymerase (Stratagene, La Jolla, Calif.), and a final Mg21 concentration of 3 mM. Conditions for amplification of DNA encoding the nonrepetitive region of CshA (primer pair 1) were as follows: 948C for 2 min, 628C for 40 s, 728C for 90 s (1 cycle); 948C for 25 s, 628C for 40 s, 728C for 90 s (34 cycles); and 728C for 4 min (last cycle). For the amplification of DNA using primer pair 2, the annealing temperature was adjusted to 608C. PCR products were purified by using a Qiaquick PCR purification kit (Qiagen, Inc., Chatsworth, Calif.). PCR products (0.2 mg) were digested with a combination of SmaI and SalI and ligated with the compatible ends of pGEX-5X-3 (0.1 mg) produced by digestion with a combination of SmaI and XhoI. Purification of CshA polypeptide fragments. E. coli BL21 cells harboring pGEX-5X-3 or recombinant derivatives were grown in 23 YT-G medium containing ampicillin (1 liter) to an optical density at 600 nm of 0.7. Isopropyl-b-Dthiogalactopyranoside (IPTG; 0.2 mM, final concentration) was added to induce expression of fusion proteins, and after incubation for 2 h, cells were harvested by centrifugation (5,000 3 g at 48C for 10 min). Bacteria were washed once by suspension in phosphate-buffered saline (PBS; 60 ml; 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4 [pH 7.3]), centrifuged, and resuspended in PBS (50 ml) supplemented with phenylmethylsulfonyl fluoride (1 mM) and EDTA (1 mM). Cells were lysed by sonication (100 W at 48C for 2 min), and GST-CshA fusion polypeptides were purified by glutathione-Sepharose batch binding followed by column elution as described by the manufacturer (GST Gene Fusion System; Pharmacia). Glutathione-eluted material was dialyzed extensively against 0.53 TBSC (13 TBSC is 20 mM Tris-HCl, 0.15 M NaCl, and 2 mM CaCl2 [pH 8.0]) and treated with factor Xa protease (New England Biolabs) (0.1 mg added to 6 mg of polypeptide in 4 ml of TBSC) for 18 h at 238C, and the suspension was then applied to a glutathione-Sepharose column. The column flowthrough containing

4206

MCNAB ET AL.

CshA polypeptide fragments was dialyzed extensively against 1% (wt/vol) ammonium bicarbonate and freeze-dried. The purity of protein preparations was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) (26) and immunoblot analysis. GST fusion plasmid pGEXN1 (containing DNA amplified by primer pair 1) expressed an NH2-terminal CshA polypeptide fragment with a molecular mass of 93 kDa (Fig. 1). Fusion plasmid pGEXCB3 (containing DNA amplified by primer pair 2) expressed a COOHterminal CshA polypeptide fragment with a molecular mass of 100 kDa. Protein concentrations were determined by using a Bio-Rad (Richmond, Calif.) protein assay kit with bovine gamma globulin as the standard. Production of antibodies. Antibodies to the NH2-terminal nonrepetitive region of CshA (NCshA; amino acid residues 42 to 886 [Fig. 1]) were raised in New Zealand White rabbits by intramuscular injection of 20 mg of protein with two boosts each of 5 mg after 2 and 3 months. Antibodies to a COOH-terminal portion of CshA were raised to a gel-purified recombinant polypeptide (155 kDa) that comprised four amino acid repeat blocks and the wall anchor domain at the COOH terminus of CshA (CCshA; amino acid residues 2026 to 2508 [Fig. 1]) fused to b-galactosidase (33). Anti-tCshA antibodies were raised to truncated CshA polypeptide (CshA; 260 kDa) lacking the COOH-terminal region (amino acid residues 2259 to 2508) and released from the cell surface of S. gordonii OB186 cshA8 (35). Bacterial adherence assays. Actinomycetes or streptococci were radioactively labeled by growth in medium containing [methyl-3H]thymidine (6 mCi/ml, 85 Ci/mmol; Amersham Corp., Arlington Heights, Ill.), and adherence of streptococci to immobilized actinomyces cells was measured as described previously (21). In some experiments, the attachment of actinomyces cells to immobilized streptococcal cells was measured in an identical manner. For sugar inhibition tests, lactose or N-acetyl-D-galactosamine (GalNAc) (0.1 M in TNMC) (21) was mixed with an equal volume of bacterial cell suspension (4 3 108 streptococcal cells per ml or 2 3 108 actinomyces cells per ml), and portions (0.05 ml) were tested for adherence to immobilized actinomyces or streptococcal cells accordingly. Adherence of streptococci to immobilized Fn. Human Fn (Boehringer Gmbh, Mannheim, Germany) in coating buffer (50 ml; 0.02 M Na2CO3, NaHCO3 [pH 9.5]) was added to the wells of microtiter plates (0 through 2 mg per well), and plates were incubated at 48C for 16 h. Remaining protein-binding sites were blocked with bovine serum albumin (BSA; fraction V; Boehringer) (0.1% [wt/ vol] in TNMC at 48C for 16 h). Wells were washed once with TNMC, portions (0.05 ml) of streptococcal cell suspension in TNMC were added to each well, and the wells were incubated with gentle shaking (200 rpm) at 378C for 2 h. Unbound cells were aspirated, and numbers of cells bound were determined as previously described (21). For inhibition experiments, wells containing Fn (1 mg) were blocked with BSA, rinsed once with TNMC, and then incubated with solutions (0.05 ml) of various tissue matrix components at 378C for 30 min. The liquid contents of wells were discarded, the wells were rinsed once with TNMC, and attachment of radioactively labeled streptococci was then determined as described above. Tissue matrix components (Sigma Chemical Co., St. Louis, Mo.) were dissolved in TNMC and included heparin (grade 1-A from porcine intestinal mucosa; 174 U/mg), gelatin (type A from porcine skin), or collagen (dissolved in 0.1 M acetic acid and diluted in TNMC). ELISA and antibody inhibition experiments. Immunoreactivities of cell surface antigens on intact cells were determined by enzyme-linked immunosorbent assay (ELISA) (16). To measure inhibition of adherence by antibodies, streptococcal cells were immobilized in microtiter plate wells as described above and then incubated at 48C for 16 h with TNMC containing 1% (wt/vol) gelatin. Wells were washed once with TNMC containing 0.05% (vol/vol) Tween 20. Sera were diluted in TNMC containing 0.1% (wt/vol) gelatin, and portions (0.05 ml) were added to wells containing immobilized streptococci. Plates were incubated at 378C for 2 h without shaking, the wells washed twice with TNMC, and adherence of radioactively labeled actinomyces cells was then measured. To measure antibody inhibition of streptococcal attachment to Fn, BSA (not gelatin) was used as the blocking agent and for serum dilutions. Although S. gordonii did not adhere to BSA-coated wells (,2% of input cells), the presence of serum promoted adherence (not shown). Therefore, numbers of S. gordonii cells adhering to immobilized Fn in the presence of sera were corrected for numbers of S. gordonii cells adhering to BSA-coated wells in the presence of sera. Antisera were diluted with TNMC containing 0.1% (wt/vol) BSA. Equal volumes of diluted serum and labeled streptococcal cell suspension (containing 4 3 108 cells per ml) were mixed, and portions (0.05 ml) were added to BSA-blocked control wells or to BSA-blocked wells containing immobilized Fn (1 mg per well). Plates were then incubated, and numbers of cells bound were measured as described above. Analysis of bacterial proteins. Cell wall polypeptides were extracted from late-exponential-phase streptococcal cells by mutanolysin treatment (10), and E. coli cell lysates were prepared as described previously (35). Proteins were separated by SDS-PAGE on 10% (wt/vol) gels and were transferred from polyacrylamide gels to Hybond-C nitrocellulose membranes (Amersham) by electroblotting (33). Immunoblots were incubated with antibodies to SpaP (P1) polypeptide from S. mutans Ingbritt serotype c, or antibodies to ScaA protein from S. gordonii PK488, diluted 1:500, and antibody binding was detected with peroxidase-conjugated swine immunoglobulins to rabbit immunoglobulin G as described elsewhere (20). Antiserum to SpaP (from K. W. Knox, University of Sydney, Sydney,

INFECT. IMMUN. TABLE 1. Reactivities of CshA antibodies with intact cells of S. gordonii DL1 and csh mutants ELISA reactivitiesa with: Strain

DL1 (wild type) OB235 cshA3 OB271 cshB2 OB277 cshA31 cshB2

Anti-tCshA

Anti-CCshAb

Anti-NCshAb

0.484 0.237 0.347 0.000

0.314 0.139 0.274 0.010

0.389 0.008 0.261 0.000

a A total of 2 3 107 streptococcal cells per well were immobilized, and primary antisera were diluted 1:1,000. ELISA values at an optical density of 492 nm were corrected for respective values obtained with preimmune serum (diluted 1:1,000). Experiments were performed in quadruplicate. Standard deviations did not exceed 10% of the mean. b Recombinant fragments of CshA to which antibodies were raised are depicted in Fig. 1.

New South Wales, Australia) reacted with the SspA and SspB (antigen I/II) polypeptides of S. gordonii (10). ScaA monospecific antibodies (from P. E. Kolenbrander, National Institutes of Health, Bethesda, Md.) were raised to recombinant ScaA protein from S. gordonii PK488 (24), purified from E. coli.

RESULTS Specificity and immunoreactivity of antibodies to CshA polypeptide fragments. The reactivities of three antisera with CshA9 or CshA recombinant fragments were determined on Western blots (immunoblots). Anti-tCshA antibodies reacted with CshA9, NCshA, and the repeat domain fragment encoded by GST fusion plasmid pGEXCB3. Anti-NCshA antibodies (Fig. 1) reacted with NCshA and CshA9 but not with the CshA repeat domain fragment. Anti-CCshA antibodies (Fig. 1) reacted with CshA9 and repeat domain CshA but did not react with NCshA. The immunoreactivities of the three antisera with intact cells of S. gordonii DL1 or csh mutant strains were determined by ELISA. Reactivities of anti-tCshA or antiCCshA antibodies with cells of mutant strains OB235 cshA3 and OB271 cshB2 were less than corresponding reactivities with strain DL1 cells (Table 1). These antisera contained antibodies reacting with both CshA and CshB polypeptides (35). In contrast, anti-NCshA antibodies did not react with cells of OB235 cshA3, indicating that these antibodies were CshA specific. Interestingly though, immunoreactivity of anti-NCshA serum with OB271 cshB2 cells was less than that with DL1 cells (Table 1). This result suggested that in the absence of CshB polypeptide, less CshA was presented on the cell surface. Cells of the double mutant OB277 cshA31 cshB2 did not react significantly with any of the antisera (Table 1). To determine whether inactivation of cshA and cshB genes affected production of other known S. gordonii cell surface protein adhesins SspA, SspB, and ScaA (see the introduction), relative immunoreactivities of S. gordonii DL1 or csh mutant cells were compared in ELISA using SspA/SspB- or ScaAspecific sera. Reactivities of wild-type or mutant cells were not significantly different with the respective sera (data not shown), suggesting that csh mutants were unaffected in cell surface expression of these other adhesins. Role of CshA in adherence of streptococci to A. naeslundii. Previous observations that mutants of S. gordonii no longer presenting CshA or CshB at the cell surface were deficient in adherence to A. naeslundii T14V (35) were extended to include A. naeslundii ATCC 12104, WVU627, and PK606. The ability of S. gordonii OB235 cshA3 cells to adhere to the four A. naeslundii strains was reduced in each case by at least 50% (Table 2). Cells of strain OB271 cshB2 were between 15 and 20% reduced in attachment to all A. naeslundii strains, while

VOL. 64, 1996

CshA INTERACTIONS WITH ORAL BACTERIA AND FIBRONECTIN

4207

TABLE 2. Adherence of S. gordonii DL1 or csh mutant cells to four A. naeslundii strains in the presence or absence of 50 mM lactose % of input cellsa attached (mean 6 SD; n 5 4) to A. naeslundii: T14V

T14V 1 lactose

ATCC 12104

ATCC 12104 1 lactose

WVU627

WVU627 1 lactose

PK606

PK606 1 lactose

55.8 6 3.6 28.4 6 3.6 48.0 6 0.7 33.8 6 2.4

61.7 6 2.8 22.1 6 3.6 51.4 6 2.7 35.8 6 5.1

42.0 6 8.4 16.6 6 1.6 35.3 6 5.0 17.2 6 2.7

29.5 6 2.9 20.7 6 4.1 24.8 6 2.2 17.9 6 4.6

54.3 6 4.1 13.7 6 3.1 47.4 6 3.6 41.0 6 4.3

54.8 6 8.0 14.4 6 2.4 46.9 6 2.0 43.5 6 3.0

44.9 6 6.9 19.4 6 1.9 36.4 6 0.7 22.0 6 1.9

33.6 6 4.0 20.4 6 6.6 26.6 6 1.7 20.6 6 1.7

Strain

DL1 (wild type) OB235 cshA3 OB271 cshB2 OB277 cshA31 cshB2 a

Input cell number, 2 3 107. Samples were assayed in quadruplicate; results are presented for a representative experiment from four.

OB277 cshA31 cshB2 cells were between 25 and 60% reduced in ability to adhere (Table 2). Addition of lactose (50 mM) inhibited by approximately 30% the attachment of DL1 (wild type) and of OB271 cshB2 cells to A. naeslundii ATCC 12104 and PK606 (Table 2). In contrast, lactose did not inhibit the binding of OB235 cshA3 or OB277 cshA31 cshB2 cells to A. naeslundii ATCC 12104 and PK606 (Table 2). Lactose did not inhibit the attachment of S. gordonii wild-type or csh mutant cells to A. naeslundii T14V or WVU627 (Table 2). Role of CshA in intrageneric coadherence. As well as exhibiting coadherence with A. naeslundii, S. gordonii also participates in coadherence with other oral streptococci, especially S. oralis (25). Accordingly, we found that S. gordonii DL1 cells bound to immobilized cells of S. oralis C104 or S. oralis 34 (approximately 29% of input S. gordonii cells [Table 3]). Cells of strains OB235 cshA3, OB271 cshB2, and OB277 cshA31 cshB2 all were reduced in their abilities to adhere to the S. oralis strains (Table 3). CshA2 mutants were always more deficient in adherence than CshB2 mutants. Addition of lactose (50 mM) did not reduce adherence significantly (Table 3). However, adherence levels of S. gordonii DL1 and csh mutant strains to S. oralis C104 and 34 were reduced in the presence of GalNAc (Table 3). Thus, inhibition of intrageneric adherence by GalNAc appeared to be independent of expression of cshA and/or cshB. Antibody inhibition of coadherence. To determine the ability of antibodies to inhibit coadherence, we reversed the coadherence assay phases such that streptococcal cells were immobilized. Initial experiments confirmed that the coadherence and lactose inhibition patterns were similar in the reverse assay to those obtained when actinomyces cells were immobilized. A. naeslundii ATCC 12104 and PK606 cells (exhibiting partially lactose sensitive coadherence) adhered to immobilized S. gordonii DL1 cells (25.1 and 25.0% input cells, respectively), while 44.3 and 35.5% input cells of A. naeslundii T14V and WVU627, respectively (exhibiting lactose-insensitive coadherence), adhered to streptococci. Adherence values for the four

actinomyces strains to OB277 cshA31 cshB2 were reduced by between 41 and 70%. The ability of antibodies raised to fragments of CshA to inhibit adherence of A. naeslundii PK606 (partially lactose sensitive) or A. naeslundii T14V (lactose insensitive) to S. gordonii DL1 was then tested. Pretreatment of immobilized S. gordonii DL1 with anti-tCshA or anti-NCshA antibodies significantly inhibited adherence of A. naeslundii T14V or PK606 cells to the streptococci and was antibody dose dependent (Fig. 1A and B). Greater inhibition of binding was observed for A. naeslundii PK606 cells than for A. naeslundii T14V cells (Fig. 1A and B). Pretreatment of immobilized S. gordonii DL1 cells with anti-CCshA antibodies did not inhibit adherence of A. naeslundii PK606 or T14V cells to streptococci (Fig. 1A and B). The reduced levels of adherence of the two actinomyces strains to S. gordonii OB277 cshA31 cshB2 cells were not affected by pretreatment of streptococci with any of the three antisera (not shown). Role of CshA in adherence of streptococcal cells to Fn. In view of the similarity of CshA amino acid sequences to those of other streptococcal and staphylococcal Fn- or collagen-binding proteins (35), we measured adherence of S. gordonii DL1 or csh mutant cells to immobilized human Fn. Numbers of S. gordonii cells binding to Fn were proportional to Fn concentration immobilized (Fig. 2A), with a maximum of 6 3 106 bacteria (30% input cells) binding to 2 mg of Fn. Cells of OB235 cshA3 or OB271 cshB2 were 51 or 29%, respectively, reduced in their abilities to attach to immobilized Fn (1 mg) compared with the wild-type strain, while cells of OB277 cshA31 cshB2 were 39% reduced in ability to bind (Fig. 2B). Wild-type cells did not bind significantly to immobilized type I collagen (data not shown). Anti-tCshA or anti-NCshA antibodies (diluted 1:30) inhibited by 57.6 or 55.3%, respectively, the attachment of S. gordonii DL1 cells to immobilized Fn. Inhibition was dose dependent and reduced to approximately 25% at 1:120 dilution of antiserum (Fig. 1C). In contrast, anti-CCshA antibodies were not inhibitory to adherence of S. gordonii DL1 to Fn. The

TABLE 3. Adherence of S. gordonii DL1 or csh mutant cells to S. oralis 34 and C104 in the presence or absence (control) of 50 mM lactose or 50 mM GalNAc % of input cellsa attached (mean 6 SD; n 5 4) to: S. oralis 34

Strain

DL1 (wild type) OB235 cshA3 OB271 cshB2 OB277 cshA31 cshB2 a

S. oralis C104

Control

1Lactose

1GalNAc

Control

1Lactose

1GalNAc

29.4 6 1.2 11.9 6 0.5 18.6 6 1.9 9.9 6 1.1

30.7 6 0.1 10.7 6 0.3 18.5 6 1.8 8.0 6 0.2

22.4 6 1.7 8.8 6 0.7 13.6 6 1.3 5.7 6 0.3

28.7 6 2.3 13.2 6 1.5 21.4 6 1.2 11.6 6 0.4

32.0 6 1.1 11.4 6 0.6 20.6 6 0.4 9.3 6 0.3

21.5 6 0.3 10.0 6 0.4 16.1 6 0.9 8.8 6 0.3

Input cell number, 2 3 107. Samples were assayed in quadruplicate; results are presented for a representative experiment from four.

4208

MCNAB ET AL.

FIG. 2. Adherence of S. gordonii DL1 or csh mutant strains to immobilized Fn. (A) Increasing amounts of Fn were applied to microtiter plate wells, and the numbers of radioactively labeled S. gordonii DL1 cells bound (input of 2 3 107 cells) were determined as described in Materials and Methods. (B) Comparison of adherence of S. gordonii DL1 or csh mutant strains to immobilized Fn (1 mg per well).

reduced level of adherence of OB277 cshA31 cshB2 cells to immobilized Fn was not affected by any of the three antisera (not shown). Several extracellular matrix components, which bind to different regions of Fn, were tested for their abilities to inhibit adherence of S. gordonii cells to Fn. Incubation of immobilized Fn with heparin (100 U/ml) did not affect subsequent numbers of S. gordonii cells bound (not shown), suggesting S. gordonii cells did not adhere to the heparin-binding region of Fn. Incubation of Fn with collagen or gelatin (1 mg/ml) resulted in 28.3 or 43.4%, respectively, reduction in binding of S. gordonii DL1 cells to Fn. However, pretreatment with collagen or gelatin also reduced the numbers of OB277 cshA31 cshB2 mutant cells bound by 51.4 or 68.6%, respectively. Inhibition of attachment of S. gordonii to Fn by pretreatment with collagen or gelatin was dose dependent. These data suggest that S. gordonii cells may bind to sequences within the collagen- and gelatinbinding region of Fn; however, this interaction was not dependent on CshA or CshB. DISCUSSION Previous work has strongly implicated the cell wall-associated polypeptides CshA and CshB in determining cell surface hydrophobicity and adhesion properties in S. gordonii DL1 (34, 35). We have extended these observations and now show that isogenic mutants of S. gordonii DL1 which do not express cell surface CshA or CshB are deficient in adherence to A. naeslundii, S. oralis, and immobilized human Fn. Evidence in this report suggests that CshA plays a major role in adherence of S. gordonii to these substrates. Thus, antibodies specific to the CshA polypeptide were able to inhibit adherence of S. gordonii to A. naeslundii and to Fn. Moreover, cshA mutants were unaffected in production and surface expression of antigen I/II polypeptides SspA and SspB, which are known to mediate binding of S. gordonii to A. naeslundii (10, 21). Mutants were also unaffected in expression of ScaA, implicated in coaggregation of S. gordonii and A. naeslundii (1, 24). These observations rule out the possibility that reduced adherence of cshA mutants is due to altered cell surface expression of other adhesins. CshA is thus a multifunctional adhesin that seems to have a wide range of potential ligands. What is not known is whether A. naeslundii, S. oralis, and Fn all carry a structurally related ligand recognized by a single binding domain within CshA, or if CshA has multiple ligand-binding sites with various

INFECT. IMMUN.

ligand specificities. To gain insight as to how CshA might function in intergeneric coadherence, we investigated the lactose susceptibility of the reaction between S. gordonii DL1 or cshA mutants and A. naeslundii. Binding of DL1 cells to A. naeslundii ATCC 12104 or PK606 cells was partially lactose inhibitable, whereas the reduced binding of OB235 cshA3 cells was no longer lactose sensitive. Thus, CshA might be involved in lactose-sensitive adherence. However, binding of DL1 cells to A. naeslundii T14V or WVU627 cells was noninhibitable by lactose, yet OB235 cshA3 cells were deficient also in binding to these strains. These somewhat complex data suggest that CshA modulates the activity or presentation of a lactose-sensitive adhesin in those coaggregation reactions that are lactose sensitive. Alternatively, it is possible that CshA mediates directly either lactose-sensitive or lactose-insensitive interactions with A. naeslundii, depending on the available receptor. Clearly CshA does not mediate GalNAc-sensitive adherence of S. gordonii to S. oralis, since cshA mutants which were reduced in ability to bind S. oralis were still sensitive to GalNAc inhibition of adherence. CshA may act in concert, therefore, with another adhesin, such as the 100-kDa protein recently described (9), to mediate intrageneric coaggregation. Previous work on streptococcal adhesion to other oral bacteria has been largely descriptive. The present study provides the first molecular data on the functional binding domains of a streptococcal coaggregation adhesin. It is clear that adherence of S. gordonii to other oral bacterial cells and to salivary glycoproteins involves expression of multiple cell surface adhesins (15, 18, 19). In further evidence of this, it has been shown recently that binding of S. gordonii DL1 cells to parotid SAG involves the activities of two surfaceexpressed antigen I/II polypeptides designated SspA and SspB (10). However, isogenic mutants of S. gordonii in which the sspA and sspB genes were inactivated still retained 50% of wild-type ability to bind to SAG, suggesting the presence of adhesins in addition to SspA and SspB which interact with SAG. The SspA and SspB proteins also mediate adherence of S. gordonii DL1 to A. naeslundii (10, 21), since sspA sspB double mutants are .80% impaired in binding. Thus, the molecular basis of the interaction of S. gordonii with A. naeslundii appears to involve the activities of at least three proteins, SspA, SspB, and CshA. Adherence of S. gordonii OB277 cshA31 cshB2 cells to A. naeslundii may be attributable to the presence of SspA and SspB proteins on the streptococcal surface. Inactivation of the sspA and sspB genes has a much greater effect on adherence of S. gordonii to A. naeslundii than does inactivation of the cshA and cshB genes, which suggests that the CshA and CshB polypeptides do not function effectively in the absence of SspA and SspB. This observation provides evidence for cooperative interactions between adhesins on the streptococcal cell surface. The ability of pathogenic organisms to adhere to Fn is considered to be important for their colonization and virulence (36). Soluble Fn is present in parotid saliva and in salivary pellicle and may promote the binding of streptococci to oral surfaces (2, 3). The ability of oral streptococci to attach to immobilized Fn, such as may be exposed or deposited at sites of endothelial damage, is thought to be an important step in the pathogenesis of infective endocarditis (29). Adherence of S. gordonii DL1 to Fn is dependent at least in part on the expression of CshA. The interaction of S. gordonii with Fn differs in a number of ways from interactions of other streptococcal species with Fn. First, S. gordonii binds conformationally specific determinants in Fn present in immobilized, but not fluid-phase, Fn (30). Second, our evidence suggests that the NH2-terminal region of CshA, rather than the amino acid

VOL. 64, 1996

CshA INTERACTIONS WITH ORAL BACTERIA AND FIBRONECTIN

repeat block region, carries the Fn-binding domain(s). Both of these differences might be related to the absence, within the CshA amino acid sequence, of a conserved core sequence (ED[T/S][X9,10]GG[X3,4][I/V]DF, where X represents any amino acid) implicated in the binding of soluble Fn by COOHterminal repeat regions of other streptococcal Fn-binding proteins (22, 32, 36). Third, Fn-binding proteins carrying core consensus sequences interact with the NH2-terminal fibrinand heparin-binding domain of Fn (36), while Streptococcus pneumoniae cells bind to the COOH-terminal heparin-binding domain of Fn (40). The CshA-mediated binding of S. gordonii DL1 cells to Fn was unaffected by heparin. Thus, we suggest that CshA-mediated binding of S. gordonii to Fn may involve a hitherto unrecognized mechanism. Adherence of S. gordonii DL1 cells, and reduced adherence of OB277 cshA31 cshB2 mutant cells, to Fn was inhibited by pretreatment of Fn with collagen or gelatin. The mechanism of non-CshA-mediated attachment of S. gordonii to immobilized Fn therefore might be similar to that for group B streptococcal attachment to Fn, which is also inhibitable by collagen (39). Antibodies to the NH2-terminal nonrepetitive region of CshA, but not antibodies to a portion of the COOH-terminal amino acid repeat block region, inhibited the adherence of S. gordonii DL1 to A. naeslundii and to immobilized human Fn. Both antibody preparations nevertheless reacted with the surface of intact cells of S. gordonii DL1, indicating that inhibition of adherence by anti-NCshA antibodies was a specific effect and not simply due to a steric effect of surface-bound immunoglobulins. The use of these antibodies in ELISA revealed also that in strain OB271 cshB2, the amount of CshA on the cell surface was reduced by approximately 33%. We therefore propose that CshA is the major adhesion-mediating polypeptide of the two polypeptides CshA and CshB and that reduced adherence of cshB mutant cells can be more or less wholly accounted for by reduced presentation of CshA on the surface of these cells. This conclusion supports the evidence that Csh polypeptide-mediated adherence of S. gordonii involves primarily the NH2-terminal region of CshA. This polypeptide appears to be involved in, but not the sole determinant of, a wide range of adherence reactions exhibited by S. gordonii. Clearly, multiple adhesin-receptor interactions would contribute to higher affinity binding of S. gordonii to oral actinomyces and Fn. Interestingly, cells of the double mutant strain OB277 cshA31 cshB2 are unaffected in ability to bind to experimental salivary glycoprotein pellicle (35). Presumably, under these conditions sufficient multiple interactions occur between other S. gordonii adhesins and salivary pellicle receptors to effect adhesion of S. gordonii cells in the absence of CshA and CshB.

5.

6. 7. 8. 9. 10.

11. 12. 13. 14. 15. 16. 17. 18. 19. 20.

21.

22.

23.

24.

ACKNOWLEDGMENTS We thank K. W. Knox for SpaP (P1) antiserum, P. E. Kolenbrander for ScaA antiserum, and R. A. Baker for skilled technical assistance. J.M.C. was in receipt of an Otago Medical Research Foundation Summer Research Scholarship. H.F.J. gratefully acknowledges the award of a Commonwealth Medical Fellowship. This work was supported by the Health Research Council of New Zealand.

25. 26. 27.

28. 1. 2. 3. 4.

REFERENCES Andersen, R. N., N. Ganeshkumar, and P. E. Kolenbrander. 1993. Cloning of the Streptococcus gordonii PK488 gene, encoding a gene which mediates coaggregation with Actinomyces naeslundii PK606. Infect. Immun. 61:981–987. Babu, J. P., and M. K. Dabbous. 1985. Interaction of salivary fibronectin with oral streptococci. J. Dent. Res. 65:1094–1100. Babu, J. P., W. A. Simpson, H. S. Courtney, and E. H. Beachey. 1983. Interaction of human plasma fibronectin with cariogenic and noncariogenic oral streptococci. Infect. Immun. 41:162–168. Bleiweis, A. S., P. C. F. Oysten, and L. J. Brady. 1992. Molecular, immunological and functional characterization of the major surface adhesin of Strep-

29.

30.

31.

4209

tococcus mutans, p. 229–241. In J. E. Ciardi, J. E. McGhee, and J. M. Keith (ed.), Genetically engineered vaccines, Plenum Press, New York. Burnette-Curley, D., V. Wells, H. Viscount, C. L. Munro, J. C. Fenno, P. Fives-Taylor, and F. L. Macrina. 1995. FimA, a major virulence factor associated with Streptococcus parasanguis endocarditis. Infect. Immun. 63: 4669–4674. Cassels, F. J., C. V. Hughes, and J. L. Nauss. 1995. Adhesin receptors of human oral bacteria and modeling of putative adhesin-binding domains. J. Ind. Microbiol. 15:176–185. Cisar, J. O., P. E. Kolenbrander, and F. C. McIntire. 1979. The specificity of coaggregation reactions between human oral streptococci and strains of Actinomyces viscosus or Actinomyces naeslundii. Infect. Immun. 24:742–752. Cleary, P., and D. Retnoningrum. 1994. Group A streptococcal immunoglobulin-binding proteins: adhesins, molecular mimicry or sensory proteins? Trends Microbiol. 2:131–136. Clemans, D. L., and P. E. Kolenbrander. 1995. Identification of a 100kilodalton putative coaggregation-mediating adhesin of Streptococcus gordonii DL1 (Challis). Infect. Immun. 63:4890–4893. Demuth, D. R., Y. Duan, W. Brooks, A. R. Holmes, R. McNab, and H. F. Jenkinson. 1996. Tandem genes encode cell-surface polypeptides SspA and SspB which mediate adhesion of the oral bacterium Streptococcus gordonii to human and bacterial receptors. Mol. Microbiol. 20:403–413. Demuth, D. R., E. E. Golub, and D. Malamud. 1990. Streptococcal-host interactions. Structural and functional analysis of a Streptococcus sanguis receptor for a human salivary glycoprotein. J. Biol. Chem. 265:7120–7126. Fives-Taylor, P. M., F. L. Macrina, T. J. Pritchard, and S. S. Peene. 1987. Expression of Streptococcus sanguis antigens in Escherichia coli: cloning of a structural gene for adhesion fimbriae. Infect. Immun. 55:123–128. Frandsen, E. V. G., V. Pedrazzoli, and M. Kilian. 1991. Ecology of viridans streptococci in the oral cavity and pharynx. Oral Microbiol. Immunol. 6:129– 133. Ganeshkumar, N., M. Song, and B. C. McBride. 1988. Cloning of a Streptococcus sanguis adhesin which mediates binding to saliva-coated hydroxylapatite. Infect. Immun. 56:1150–1157. Hasty, D. L., I. Ofek, H. S. Courtney, and R. J. Doyle. 1992. Multiple adhesins of streptococci. Infect. Immun. 60:2147–2152. Holmes, A. R., P. K. Gopal, and H. F. Jenkinson. 1995. Adherence of Candida albicans to a cell surface polysaccharide receptor on Streptococcus gordonii. Infect. Immun. 63:1827–1834. Jenkinson, H. F. 1987. Novobiocin-resistant mutants of Streptococcus sanguis with reduced cell hydrophobicity and defective in coaggregation. J. Gen. Microbiol. 133:1909–1918. Jenkinson, H. F. 1994. Cell surface protein receptors in oral streptococci. FEMS Microbiol. Lett. 121:133–140. Jenkinson, H. F. 1995. Genetic analysis of adherence by oral streptococci. J. Ind. Microbiol. 15:186–192. Jenkinson, H. F., and R. A. Easingwood. 1990. Insertional inactivation of the gene encoding a 76-kilodalton cell surface polypeptide in Streptococcus gordonii Challis has a pleiotropic effect on cell surface composition and properties. Infect. Immun. 58:3689–3697. Jenkinson, H. F., S. D. Terry, R. McNab, and G. W. Tannock. 1993. Inactivation of the gene encoding surface protein SspA in Streptococcus gordonii DL1 affects cell interactions with human salivary agglutinin and oral actinomyces. Infect. Immun. 61:3199–3208. Joh, H. J., K. House-Pompeo, J. M. Patti, S. Gurusiddappa, and M. Ho¨o¨k. 1994. Fibronectin receptors from gram-positive bacteria: comparison of active sites. Biochemistry 33:6086–6092. Kehoe, M. A. 1994. Cell-wall-associated proteins in gram-positive bacteria, p. 217–261. In J.-M. Ghuysen and R. Hakenbeck (ed.), Bacterial cell walls. Elsevier Science, Amsterdam. Kolenbrander, P. E., R. N. Andersen, and N. Ganeshkumar. 1994. Nucleotide sequence of the Streptococcus gordonii PK488 coaggregation adhesin gene, scaA, and ATP-binding cassette. Infect. Immun. 62:4469–4480. Kolenbrander, P. E., and J. London. 1993. Adhere today, here tomorrow: oral bacterial adherence. J. Bacteriol. 175:3247–3252. Laemmli, U. K., and M. Favre. 1973. Maturation of the head of bacteriophage T4. I. DNA packaging events. J. Mol. Biol. 80:575–599. Lamont, R. J., S. Gil, D. R. Demuth, D. Malamud, and B. Rosan. 1994. Molecules of Streptococcus gordonii that bind to Porphyromonas gingivalis. Microbiology 140:867–872. Ligtenberg, A. J. M., E. Walgreen-Weterings, E. C. I. Veerman, J. J. de Soet, J. de Graaff, and A. V. N. Amerongen. 1992. Influence of saliva on aggregation and adherence of Streptococcus gordonii HG 222. Infect. Immun. 60: 3878–3884. Lowrance, J. H., L. M. Baddour, and W. A. Simpson. 1990. The role of fibronectin binding in the rat model of experimental endocarditis caused by Streptococcus sanguis. J. Clin. Invest. 86:7–13. Lowrance, J. H., D. L. Hasty, and W. A. Simpson. 1988. Adherence of Streptococcus sanguis to conformationally specific determinants in fibronectin. Infect. Immun. 56:2279–2285. Marsh, P. D., and D. J. Bradshaw. 1995. Dental plaque as a biofilm. J. Ind. Microbiol. 15:169–175.

4210

MCNAB ET AL.

32. McGavin, M. J., S. Gurusiddappa, P.-E. Lindgren, M. Lindberg, G. Raucci, and M. Hook. 1993. Fibronectin receptors from Streptococcus dysgalactiae and Staphylococcus aureus. J. Biol. Chem. 268:23946–23953. 33. McNab, R., and H. F. Jenkinson. 1992. Gene disruption identifies a 290 kDa cell-surface polypeptide conferring hydrophobicity and coaggregation properties in Streptococcus gordonii. Mol. Microbiol. 6:2939–2949. 34. McNab, R., and H. F. Jenkinson. 1995. Characterization of CshA, a high molecular mass adhesin of Streptococcus gordonii, p. 371–376. In J. J. Ferretti, M. S. Gilmore, T. R. Klaenhammer, and F. Brown (ed.), Genetics of streptococci, enterococci and lactococci. Karger, Basel. 35. McNab, R., H. F. Jenkinson, D. M. Loach, and G. W. Tannock. 1994. Cell-surface-associated polypeptides CshA and CshB of high molecular mass are colonization determinants in the oral bacterium Streptococcus gordonii. Mol. Microbiol. 14:743–754.

Editor: V. A. Fischetti

INFECT. IMMUN. 36. Patti, J. M., B. L. Allen, M. J. McGavin, and M. Ho ¨o¨k. 1994. MSCRAMMmediated adherence of microorganisms to host tissues. Annu. Rev. Microbiol. 48:585–617. 37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 38. Schmidt, K.-H., K. Mann, J. Cooney, and W. Kohler. 1993. Multiple binding of type 3 streptococcal M protein to human fibrinogen, albumin and fibronectin. FEMS Immunol. Med. Microbiol. 7:135–144. 39. Tamura, G. S., and C. E. Rubens. 1995. Group B streptococci adhere to a variant of fibronectin attached to a solid phase. Mol. Microbiol. 15:581–589. 40. van der Flier, M., N. Chhun, T. M. Wizemann, J. Min, J. B. McCarthy, and E. I. Tuomanen. 1995. Adherence of Streptococcus pneumoniae to immobilized fibronectin. Infect. Immun. 63:4317–4322.